ID: 1190287886

View in Genome Browser
Species Human (GRCh38)
Location X:48972513-48972535
Sequence AATCACACCTCCTCCGCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190287880_1190287886 26 Left 1190287880 X:48972464-48972486 CCACTCCGAGGGGGTAGTCTCTC No data
Right 1190287886 X:48972513-48972535 AATCACACCTCCTCCGCTAGAGG No data
1190287879_1190287886 27 Left 1190287879 X:48972463-48972485 CCCACTCCGAGGGGGTAGTCTCT No data
Right 1190287886 X:48972513-48972535 AATCACACCTCCTCCGCTAGAGG No data
1190287881_1190287886 21 Left 1190287881 X:48972469-48972491 CCGAGGGGGTAGTCTCTCTTATC No data
Right 1190287886 X:48972513-48972535 AATCACACCTCCTCCGCTAGAGG No data
1190287883_1190287886 -5 Left 1190287883 X:48972495-48972517 CCATATCCAGTGGCCTCAAATCA No data
Right 1190287886 X:48972513-48972535 AATCACACCTCCTCCGCTAGAGG No data
1190287878_1190287886 28 Left 1190287878 X:48972462-48972484 CCCCACTCCGAGGGGGTAGTCTC No data
Right 1190287886 X:48972513-48972535 AATCACACCTCCTCCGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190287886 Original CRISPR AATCACACCTCCTCCGCTAG AGG Intergenic
No off target data available for this crispr