ID: 1190291771

View in Genome Browser
Species Human (GRCh38)
Location X:48997730-48997752
Sequence CAGAACAGGGAGAAGAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1257
Summary {0: 1, 1: 0, 2: 9, 3: 126, 4: 1121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190291771 Original CRISPR CAGAACAGGGAGAAGAGGAG GGG Intronic
900423568 1:2566237-2566259 CAGAAAAGGGAGAAAAGGGGTGG - Intergenic
900626156 1:3609600-3609622 CAGAGAAGGGAGAGGAGGGGAGG + Intronic
900677199 1:3895086-3895108 CACAGCAGGGAGGAGAGGTGGGG - Intronic
900820461 1:4882885-4882907 AAGATCAGTGAGAACAGGAGAGG + Intergenic
900908625 1:5578343-5578365 GAGAAAGGAGAGAAGAGGAGAGG - Intergenic
901232318 1:7648090-7648112 AAGAAGAGAGAGAAGAGAAGAGG + Intronic
901533311 1:9867100-9867122 TGGAACAGGGAGAAGAGAGGGGG + Intronic
902213183 1:14918202-14918224 CAGAATAGGGAGAACAAGATGGG + Intronic
902594261 1:17497447-17497469 CAGAAGAGGGAGGATGGGAGGGG - Intergenic
902760597 1:18578358-18578380 CAGAACAGCGAGAAGGCCAGAGG + Intergenic
902868304 1:19295787-19295809 CAGAACAGTGAGGACAGGAGTGG - Intergenic
903071727 1:20730155-20730177 CAAAACACGGAGAAAAGGAGAGG + Intronic
903121926 1:21221814-21221836 CAGAACTGGGTGAAGAAGAACGG - Exonic
903423323 1:23234470-23234492 TAGAGCAGGGAGGAAAGGAGGGG - Intergenic
903644296 1:24884401-24884423 GAGAGCAGGGACATGAGGAGTGG - Intergenic
904079383 1:27862544-27862566 GAGGACAGAGAGAGGAGGAGAGG - Intergenic
904080773 1:27871465-27871487 AAAAACAGGGAGAAGAGGCTGGG - Intergenic
904080822 1:27871785-27871807 TAAAACAGGGAGAAGAGGGCCGG - Intergenic
904213226 1:28899430-28899452 CAGGAAAGGGGGAAGAGGGGAGG - Intronic
904447813 1:30588817-30588839 CAGAGCAGGGGAAAGAGGAGGGG + Intergenic
904461264 1:30681407-30681429 AAGAAGAAGAAGAAGAGGAGTGG + Intergenic
904698536 1:32344521-32344543 CTGAACAAGCAGAAGAGAAGGGG - Intergenic
904812585 1:33172996-33173018 CCAGACATGGAGAAGAGGAGAGG - Intronic
904945316 1:34194933-34194955 ATGAAGAGGAAGAAGAGGAGGGG + Intronic
905319082 1:37103004-37103026 AAGAACAGAAAGAAAAGGAGAGG + Intergenic
905347825 1:37323431-37323453 AAGAACAGGGAGTTGGGGAGGGG - Intergenic
905456464 1:38091559-38091581 CTGCACAGTGAGGAGAGGAGGGG + Intergenic
905636705 1:39558797-39558819 GAGCACAGGGAGGAGAGGAAGGG + Intergenic
905656199 1:39687553-39687575 CAGAGCAGGGAGGAGAAAAGGGG - Intronic
906203741 1:43975897-43975919 CAGACCAGAGAAAAGAAGAGAGG - Intronic
906520450 1:46464107-46464129 GGGAGGAGGGAGAAGAGGAGGGG - Intergenic
906524888 1:46488277-46488299 CAGAAGGGAGAGGAGAGGAGAGG - Intergenic
906639329 1:47432304-47432326 CAGAACAGGAAGAGGGGAAGAGG + Intergenic
907287385 1:53390536-53390558 CAGAAGGAGGAGAAGGGGAGTGG + Intergenic
907366414 1:53964300-53964322 GAGATGTGGGAGAAGAGGAGAGG - Intronic
907386326 1:54127934-54127956 CAGAGCAGGGTGAAGAGGAACGG - Intergenic
907936905 1:59049605-59049627 GAGAACTGGGAGAGAAGGAGGGG + Intergenic
908504927 1:64787512-64787534 CAGAACTTGGAAAAGAGCAGGGG - Intronic
909074798 1:71040153-71040175 AAGAAAAGAGAGAGGAGGAGAGG + Intronic
909503523 1:76362173-76362195 CAGAGCAGGAAGAAGAGAGGCGG + Intronic
910413150 1:86967444-86967466 CAGTAGGGGGAGAAGGGGAGGGG - Intronic
910495252 1:87819708-87819730 GAGAAGAGGGAGAAGTGAAGAGG + Intergenic
910734732 1:90441009-90441031 AAGAAAAGGGAGAAGAGGGAAGG - Intergenic
910758402 1:90713649-90713671 CACAAACGGGAGAAAAGGAGGGG + Intronic
910799324 1:91130059-91130081 CAGACAAGGGAGAAAAGGAAGGG - Intergenic
910851152 1:91650972-91650994 AAGAGCAGGGAGATGAGGGGAGG + Intergenic
911110669 1:94181075-94181097 CAGGACTGAGAGAATAGGAGAGG + Intronic
911265123 1:95734105-95734127 CAGCACAGGGAGAAAAGTAGAGG + Intergenic
911265386 1:95737120-95737142 CAAAAATGGGAGTAGAGGAGGGG + Intergenic
911991741 1:104706897-104706919 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
912173901 1:107134993-107135015 AAGAAAAGAGAGGAGAGGAGAGG - Intergenic
912661562 1:111535987-111536009 AAGAGAAGGGAGGAGAGGAGGGG - Intronic
912886439 1:113479390-113479412 AAGTACAGGAAGAAGAGGAAGGG - Intronic
912903361 1:113676768-113676790 TAATAAAGGGAGAAGAGGAGAGG - Intronic
913321586 1:117592296-117592318 CAGGACAGTGAGAGGAAGAGTGG - Intergenic
914049987 1:144123609-144123631 AAGAAAATGGAGGAGAGGAGGGG - Intergenic
914129195 1:144841842-144841864 AAGAAAATGGAGGAGAGGAGGGG + Intergenic
914197936 1:145459876-145459898 CCGAAGAGGGAGACGAAGAGGGG - Intergenic
914477038 1:148033008-148033030 CCGAAGAGGGAGACGAAGAGGGG - Intergenic
914743974 1:150487603-150487625 AGGACCAGGGAGAGGAGGAGTGG - Intronic
914803142 1:150974707-150974729 CGGAAGAGGGAGGAGAGGCGCGG - Exonic
915518357 1:156426964-156426986 CAGGACTAGGAGAAAAGGAGTGG - Intronic
915734746 1:158077666-158077688 CACAGCAGGGAGCAAAGGAGAGG - Intronic
915837339 1:159188293-159188315 GAGGGGAGGGAGAAGAGGAGGGG - Intronic
915840095 1:159206340-159206362 CAGAATAGGGCGAGGAGCAGGGG - Exonic
916393077 1:164354341-164354363 TAGAACAGTCAGGAGAGGAGAGG + Intergenic
916450864 1:164919164-164919186 CAAGGCAGGGAGAATAGGAGTGG + Intergenic
916481362 1:165217518-165217540 CAAAACGAGGAGAAGAGAAGGGG + Intronic
916620380 1:166490237-166490259 CAGAAAAAGGAAAAGACGAGGGG - Intergenic
916676567 1:167068848-167068870 CAGCACAGGGAGAAGAGCCCAGG - Intronic
916817106 1:168364794-168364816 AAGAAAAGAGAGAAGAGGAGAGG - Intergenic
916824138 1:168428214-168428236 CAGAAAAAGGAAAAGTGGAGAGG + Intergenic
916861722 1:168813070-168813092 CAGAACTGGGAGTACAGGTGGGG - Intergenic
917049685 1:170906821-170906843 AAAAACAGGGAGAAAAGAAGTGG - Intergenic
917606231 1:176632940-176632962 AACAACAGGAAGAAGAGGAGGGG + Intronic
917737341 1:177932936-177932958 CAGAAGAGTGGGATGAGGAGGGG - Intronic
917777141 1:178349999-178350021 CAGAACAGGAAGAACAGCACAGG - Intronic
918143420 1:181736493-181736515 CAGGGCAGGGTGAAGGGGAGAGG + Intronic
918179423 1:182073360-182073382 CAGAAGAGATAGAAGAGGAGTGG - Intergenic
919261043 1:195194430-195194452 CAGAATTAGGAGAAGAGAAGTGG - Intergenic
919509332 1:198441557-198441579 CAGAGTAGGAAGAGGAGGAGAGG - Intergenic
919775824 1:201193351-201193373 CAGGACAGAGAGGAGAGAAGTGG + Intronic
919795671 1:201320148-201320170 GAGAACAGGCAGGAGAGGGGAGG - Intronic
919854128 1:201694175-201694197 CAGAACACGGAGAGCTGGAGGGG + Intronic
919976692 1:202617384-202617406 CAGAGCAGGAGGAAGAGGCGAGG - Intronic
920073741 1:203321841-203321863 GAGAAAAGAGAGGAGAGGAGAGG - Intergenic
920112700 1:203598455-203598477 CAGAAAAGGGGGAGAAGGAGGGG - Intergenic
920201044 1:204259806-204259828 CAGACTGGGAAGAAGAGGAGTGG + Intronic
920336487 1:205248700-205248722 AAGAAGAGGGAGAAGAGGGTGGG - Intronic
920356751 1:205379025-205379047 TAGAAGAGGGAGAAGAGGATTGG - Intergenic
921046020 1:211478716-211478738 CAGAACCAGGAGATGAGGATGGG + Exonic
921080520 1:211735518-211735540 CAGAACAAAGAAAAGGGGAGGGG - Intergenic
921246654 1:213250231-213250253 CAGCACTGGGAGAAGAGTGGGGG + Intronic
921251863 1:213305617-213305639 CAGAACACAGAGTAGAGGAGTGG + Intergenic
921440445 1:215180177-215180199 CAGAACATGAAAAAGAGTAGAGG - Intronic
921749238 1:218773873-218773895 CAGAAGAGGTAGAAGAGATGGGG - Intergenic
921923905 1:220695995-220696017 TAGAAAAGGAAGAGGAGGAGTGG + Intronic
922025353 1:221743469-221743491 CTGATCAGGGAGAAGAGTAGGGG + Intergenic
922155555 1:223037810-223037832 CTGAACACGGAGAGGAGCAGAGG - Intergenic
922453085 1:225752282-225752304 CAGAACAGGGGGAAGAAAATGGG - Intergenic
922528884 1:226327821-226327843 GAGAACAGGGAGCTGAGGACTGG - Intergenic
922609387 1:226913181-226913203 CAGTAAAGTGAGAAGGGGAGAGG + Intronic
922643485 1:227260765-227260787 CAGATAAGGGAGAAGAAGAATGG - Intronic
922651943 1:227348229-227348251 TAGAAGAAAGAGAAGAGGAGAGG - Intergenic
922800617 1:228363120-228363142 GAGAAGAGGGAGAGGAGGAGAGG + Intronic
922927950 1:229366144-229366166 CAGAACGGGGAGAGTGGGAGGGG - Intergenic
923113451 1:230912067-230912089 CAGAACACAGAGAAGGGGCGTGG + Intronic
923707160 1:236353250-236353272 CAGATAAGGGAGACCAGGAGGGG - Intronic
923816730 1:237388159-237388181 GAGAACATGGTGAAGAGCAGCGG + Exonic
923848763 1:237768865-237768887 CAGAACAATGGGAAGAGGGGAGG - Intronic
923908782 1:238415790-238415812 GAGAAGAGAGAGAAGAGGAGAGG + Intergenic
924327318 1:242908963-242908985 GAGAAGATGGAGAGGAGGAGGGG - Intergenic
924428405 1:243974774-243974796 AACAACTAGGAGAAGAGGAGTGG - Intergenic
924719983 1:246613696-246613718 CAGAAGAGGGAGACGGGAAGAGG - Intronic
1062897438 10:1115008-1115030 CAAAAAAGGGAGATGGGGAGGGG - Intronic
1063229437 10:4049696-4049718 GAGAACAGGGAGCCTAGGAGAGG + Intergenic
1063472326 10:6298053-6298075 CAGAACAGAAAGAAGGGGGGAGG + Intergenic
1063784471 10:9365251-9365273 CAGGAGAGGGAAGAGAGGAGAGG - Intergenic
1063924276 10:10962108-10962130 AAGAAGAGAGAGAAGAGAAGAGG + Intergenic
1063960204 10:11300408-11300430 CAGAACTGGCAGCAGAAGAGAGG + Intronic
1064793269 10:18983406-18983428 AAGAACAGAGAGAAGATTAGAGG + Intergenic
1065257410 10:23884978-23885000 GAGAAATGGGAGAAGAGGAAAGG - Intronic
1065414125 10:25466076-25466098 CAGAAAAAGGAAAAGGGGAGGGG + Intronic
1066192551 10:33069338-33069360 CAGAACAAGAAGAAAAGGAGAGG - Intergenic
1066309009 10:34177310-34177332 CTGCATAGGGAGATGAGGAGGGG - Intronic
1066402239 10:35087770-35087792 GAGACCAGTGAGAAGAGCAGTGG - Intronic
1066413115 10:35192921-35192943 CAAAAGAGGGAGAAGTGGAGAGG - Intronic
1066497545 10:35956788-35956810 CAGAAGAGGGAGAAAGGGAGGGG - Intergenic
1066625199 10:37398856-37398878 CAGAGGAGGGAGAAAGGGAGGGG - Intergenic
1067009605 10:42698043-42698065 GAGAAGAGGGAGAAGAAGAAGGG - Intergenic
1067279337 10:44859517-44859539 TAGAACTGGGAGAAGTGGGGAGG + Intergenic
1067661433 10:48238793-48238815 CAGATCAGGGAGAAGAACTGTGG - Intronic
1068785494 10:60968061-60968083 CAGAACAGGGTTCAGAGAAGTGG - Intronic
1069140862 10:64823504-64823526 AAGATAAGGAAGAAGAGGAGAGG + Intergenic
1069149421 10:64938597-64938619 AAGAAGAGAGAGAAGAGGAGGGG - Intergenic
1069449053 10:68501525-68501547 GAGAAAGAGGAGAAGAGGAGAGG + Intronic
1069591075 10:69642330-69642352 CAGAACACGGCAAAGGGGAGGGG - Intergenic
1069740154 10:70682208-70682230 CAGAAGAAAGAGAAGAGGACCGG + Intronic
1070158132 10:73848953-73848975 CAGATCAGGAAGAGGAGGAAGGG + Intronic
1070278255 10:75028909-75028931 AAGAAGAGGAAGAAGAGGAAGGG + Exonic
1070284658 10:75073935-75073957 CAGAACAGCTAGAACAGGGGAGG + Intergenic
1070285855 10:75083248-75083270 AAGAAGAGGGAGGTGAGGAGGGG - Intergenic
1070398680 10:76034109-76034131 CACAACAGGAAATAGAGGAGCGG + Intronic
1070498747 10:77050309-77050331 AAAAACTGGGAGAAGAGGAAGGG + Intronic
1070620655 10:78007833-78007855 CAGAACAGTGAGTTGATGAGTGG - Exonic
1070717649 10:78734201-78734223 CAGACCAGGGGAAAGAGAAGAGG + Intergenic
1070889584 10:79932865-79932887 GAGAACAGAGAGAGGATGAGAGG - Intergenic
1071307043 10:84308806-84308828 CAGTACAGGGAGCAGAGGGCAGG - Intergenic
1071503516 10:86219543-86219565 CAGAGCAGGGAGAAGGGGAGCGG - Intronic
1072645674 10:97251634-97251656 GGGAAAAGGAAGAAGAGGAGGGG + Intronic
1072767123 10:98104246-98104268 CAGGAAGGGGAGAAGAGGGGAGG - Intergenic
1072954331 10:99875439-99875461 CAGATCTGGGAGAATGGGAGAGG - Intergenic
1073118726 10:101108362-101108384 CAGGATAGGGAGAGGAGGCGGGG - Intronic
1073321238 10:102617482-102617504 CTGCCAAGGGAGAAGAGGAGGGG - Intronic
1073337195 10:102718651-102718673 AAGACCAGGAACAAGAGGAGAGG - Intronic
1073339288 10:102732830-102732852 GAGACCAGGGAGAAGCTGAGGGG - Intronic
1073553973 10:104429891-104429913 CAGAGCAGGCAAAAGAGGAGAGG - Intronic
1073713104 10:106068411-106068433 CAGAACAGGGGGCTGAGGAAAGG - Intergenic
1073953256 10:108836024-108836046 AAGAAAAGGAAGAAGAAGAGAGG + Intergenic
1074060474 10:109960880-109960902 CTGCCCAGGGAGAAGGGGAGGGG + Intergenic
1074162838 10:110848234-110848256 GAAAACAGGGTGAGGAGGAGAGG - Intergenic
1074195069 10:111176591-111176613 AAGAAAAGGAAGAAAAGGAGAGG - Intergenic
1074322802 10:112418849-112418871 CTGAGGAGGAAGAAGAGGAGGGG + Intronic
1074581350 10:114722292-114722314 CAGAGCAGGAGGAAGAGAAGGGG + Intergenic
1075107257 10:119548506-119548528 CAGACCACAGAGAAGAGGACAGG + Intergenic
1075193341 10:120331573-120331595 GGGAATAGGGAGAAGAAGAGAGG - Intergenic
1075446835 10:122519112-122519134 CAGAACATTGAGAGCAGGAGAGG - Intergenic
1075456694 10:122589512-122589534 AAGCAGAGGGAGAAGAGGAAAGG + Intronic
1075825878 10:125356729-125356751 CAGAGCAGGGAGGAGGGGAGAGG - Intergenic
1075984776 10:126775369-126775391 CAGAAGGGGGAGAGTAGGAGGGG + Intergenic
1076091348 10:127689038-127689060 AAGAAGAGGAGGAAGAGGAGGGG + Intergenic
1076153825 10:128187561-128187583 CGAAACAGGGCGCAGAGGAGAGG - Intergenic
1076172591 10:128334609-128334631 CAGTACAGTGAGAATAGAAGGGG - Intergenic
1076259371 10:129053712-129053734 CAGAACAGGGAAAAAGGAAGGGG - Intergenic
1076299490 10:129414303-129414325 CAGAACAGGATGACGAGCAGTGG - Intergenic
1076463531 10:130662556-130662578 CAGAATTGGAAGAGGAGGAGTGG - Intergenic
1076515006 10:131040207-131040229 GAGAACAGGAGGAAGAGGAGTGG - Intergenic
1076815432 10:132912321-132912343 CAGGAGAGAGAGAAGAAGAGAGG - Intronic
1076841631 10:133048816-133048838 CAGAACAGCAGGCAGAGGAGGGG + Intergenic
1077016050 11:399555-399577 CAGAGGAGGGACAGGAGGAGGGG - Intronic
1077074778 11:695397-695419 CAGGACAGTGAGGAGAGCAGGGG - Exonic
1077180301 11:1209269-1209291 GGGAAAAGGGAGAAGTGGAGGGG - Intergenic
1077308616 11:1878736-1878758 CAGAACAGGGAGCAGGGCTGGGG - Intronic
1077702676 11:4456289-4456311 CACAACAGGGAAAAGATGAAGGG + Intergenic
1077842224 11:5987382-5987404 CAGAATAGGGAATACAGGAGAGG - Intergenic
1077849280 11:6058729-6058751 CTGAATAGGGAAAAGAGGAGAGG - Intergenic
1078099750 11:8323091-8323113 CAGCACAGGCAAAGGAGGAGAGG + Intergenic
1078804843 11:14688176-14688198 GAGAAGAGGGAGAGGGGGAGAGG - Intronic
1079089015 11:17467773-17467795 TAGAACAGGGAAAAGTGGAGGGG - Intronic
1079121695 11:17689804-17689826 CAGAGCAAGGAGGAGAGTAGAGG - Intergenic
1079155136 11:17939195-17939217 CAGAACAAGGAGAACAAGAGGGG + Intronic
1079173325 11:18116636-18116658 TAGAAGAGGGGGAAGAGGAGGGG + Intronic
1079297573 11:19246881-19246903 CAGAAGAGGGAGAAAGAGAGAGG - Intergenic
1079387322 11:19992090-19992112 CACAACTAGGAGAAGAGGAAAGG - Intronic
1079424512 11:20327371-20327393 TAGAATGGGGAGAAGAGGAAGGG - Intergenic
1079477803 11:20849495-20849517 CAGGAGAGTGAGAAGAGGATAGG + Intronic
1079862439 11:25690727-25690749 CAGAACAGTGAGAGGAAGCGTGG - Intergenic
1080284027 11:30587059-30587081 CAGGACAGGAAGGTGAGGAGAGG + Intergenic
1080862938 11:36166013-36166035 GAGAGGAGGGAGGAGAGGAGAGG - Intronic
1080928410 11:36782649-36782671 CAGAAGAGGGGGAAGATGATAGG + Intergenic
1080951318 11:37036455-37036477 CAGAACAGAGAGAGGTGGAGAGG + Intergenic
1081286671 11:41278974-41278996 TAGAACAGGGAGGATGGGAGAGG - Intronic
1081572539 11:44300696-44300718 CAACACAGGGAGAAATGGAGTGG + Intronic
1081841591 11:46205821-46205843 CAAAAAAGGGAGAAGAGGCCAGG + Intergenic
1081875199 11:46403827-46403849 CAGAAAAGGGCCAAGGGGAGTGG + Intronic
1083109201 11:60388380-60388402 CAGAGCTGGGATAGGAGGAGAGG + Intronic
1083743338 11:64722512-64722534 GAGAAGAGAGAGAAGTGGAGAGG - Intronic
1083897046 11:65625195-65625217 CAGAAGACTGAGAAGAGGACAGG - Exonic
1083986814 11:66221002-66221024 AAGTGCAGGGTGAAGAGGAGGGG - Intronic
1083998332 11:66283122-66283144 CAGAGGTGGTAGAAGAGGAGGGG - Exonic
1084400637 11:68940967-68940989 CAGGACAGGGGGAGGAGGAGGGG - Intergenic
1084409829 11:69000351-69000373 GAAAACAGGGAAAAGAGAAGTGG + Intergenic
1085029287 11:73259898-73259920 TAGAGCAGGGAGAACAGGGGTGG - Intergenic
1085040529 11:73323952-73323974 GAGAACAGGGAGAAGGACAGAGG - Intronic
1085389836 11:76176685-76176707 CAGGACTGGGGGATGAGGAGAGG + Intergenic
1085502645 11:77037947-77037969 AAGAAGAAGAAGAAGAGGAGGGG + Intronic
1086186682 11:84025906-84025928 AAGAAAAAAGAGAAGAGGAGAGG + Intronic
1087174380 11:95082642-95082664 CAGGGGAGGGAGGAGAGGAGGGG - Intergenic
1087508009 11:99053044-99053066 CATAAGAGGGAGTAGAGGTGGGG - Intronic
1088509511 11:110560259-110560281 GACAAGAGGGAGATGAGGAGTGG + Intergenic
1088602241 11:111491177-111491199 AAGAACAGGGGGAAGATTAGTGG + Intronic
1088680009 11:112231887-112231909 CAGAGACAGGAGAAGAGGAGGGG + Intronic
1088687208 11:112295001-112295023 GAGAATAGGCAGAAGAGGAAGGG - Intergenic
1089068808 11:115682664-115682686 CAGAAGAGAGAGAACCGGAGAGG + Intergenic
1089359580 11:117876846-117876868 ACGGACAGGGAGAGGAGGAGAGG - Exonic
1089414543 11:118276357-118276379 CAGAACAGGAAGAGGGGTAGAGG + Intergenic
1089567958 11:119382002-119382024 CAGCCCAGTGAGAAGGGGAGTGG - Intergenic
1089643898 11:119865470-119865492 GAGATCAGGAAGAAGGGGAGGGG - Intergenic
1090292213 11:125555237-125555259 CAGAAGAGTGAGTAGAGGAGTGG - Intergenic
1090363749 11:126190002-126190024 CAGAGGAGGGAGGAGAGCAGAGG - Intergenic
1090378699 11:126309886-126309908 CAGAAAAGGCAGAAGAAGAAGGG - Intronic
1090657411 11:128856480-128856502 CAGAAGAGGGAGCAGGGGAGGGG + Intronic
1091074939 11:132606641-132606663 CAGAAGTGGGAAAAGGGGAGAGG - Intronic
1091124357 11:133082402-133082424 GAGGATAGGGAGGAGAGGAGGGG - Intronic
1091169331 11:133506503-133506525 CAGAGCAGGTAGAGGAGCAGAGG - Intronic
1091193509 11:133713707-133713729 CAGAAACGGGGGAAGTGGAGTGG - Intergenic
1091234125 11:134008381-134008403 CAGAGCAGGGAGAGGAGAGGTGG - Intergenic
1091257826 11:134206287-134206309 CAGACAAGGGAAAGGAGGAGAGG + Intronic
1091635571 12:2194175-2194197 CAGGAGGGGAAGAAGAGGAGAGG - Intronic
1091797449 12:3305419-3305441 CAGAATAGGGAGCAGGGGAGGGG - Intergenic
1092041901 12:5392792-5392814 GGGAATGGGGAGAAGAGGAGAGG - Intergenic
1092074029 12:5658065-5658087 AAGAAAAGGGGGATGAGGAGAGG - Intronic
1092206735 12:6619350-6619372 GAGAAGAGAGAGGAGAGGAGAGG + Exonic
1092247042 12:6869489-6869511 CAGAAAAGGAAAAAGGGGAGGGG + Intronic
1092577275 12:9800458-9800480 CAGAAGGGGAAGAATAGGAGGGG - Intergenic
1092629312 12:10361342-10361364 AAGAACAGGAAGAAGAGGGCAGG + Intergenic
1092735622 12:11579775-11579797 CTGAACTGGGAGAAGAAGGGTGG - Intergenic
1092936362 12:13367684-13367706 CAGAACCGGAAGCTGAGGAGTGG + Intergenic
1093563118 12:20566660-20566682 AAGGACTGGGAGCAGAGGAGAGG + Intronic
1093569968 12:20655519-20655541 CAGAACAGTGGGATGAGGAAGGG - Intronic
1094083755 12:26566122-26566144 GAGGAGAGGGAGAGGAGGAGAGG + Intronic
1094339389 12:29393640-29393662 TGGAAGAGGGAGAAGAGGAAGGG + Intergenic
1094695681 12:32816228-32816250 AAGAAGAGGGAGAGAAGGAGGGG - Intronic
1094759321 12:33512297-33512319 GGGATCAGGGAGAGGAGGAGAGG - Intergenic
1094787086 12:33860826-33860848 CAGAGCAGGAAGAAGGGCAGGGG - Intergenic
1095182441 12:39161484-39161506 AAGAACAGGAAGAAAAAGAGTGG + Intergenic
1095323525 12:40859274-40859296 CAGAATTGAGAGATGAGGAGAGG + Intronic
1095824726 12:46519295-46519317 CAAAAGAGAGAGAAGAGGAGAGG - Intergenic
1095911961 12:47436771-47436793 CTGAAGAGGGGGATGAGGAGAGG + Intergenic
1095982862 12:47982774-47982796 CTGAGCAGGGAGAAGAGGAGCGG - Intronic
1096139158 12:49227846-49227868 AAGAACAGAGAGAAGAGATGAGG - Intronic
1096233514 12:49910576-49910598 AAGAACAGTGAGAAGGGTAGGGG - Intergenic
1096263050 12:50104772-50104794 AAGAACAGGGAGAGGAAGGGAGG + Intronic
1096808366 12:54154354-54154376 CCACACTGGGAGAAGAGGAGAGG + Intergenic
1096839167 12:54370257-54370279 CAGTACGGGGAGAAGAGGATGGG + Exonic
1096866975 12:54570397-54570419 TAGAACAGGCATGAGAGGAGTGG - Intronic
1096879420 12:54655332-54655354 CAGAACAGGAAGAAGGGAAGTGG - Intergenic
1097265868 12:57744638-57744660 CAGAACAGGGGGAAGGGGGTGGG + Intronic
1097296243 12:57965960-57965982 CAGAAAAAGGAAAAGAGGAGGGG + Intergenic
1097660316 12:62422956-62422978 CAGTAAAGGTAGAAAAGGAGAGG + Intergenic
1097921794 12:65083816-65083838 AAGAAAAGAGAAAAGAGGAGAGG - Intronic
1098066747 12:66626733-66626755 CAGAACTGTGAAATGAGGAGTGG - Intronic
1098086329 12:66848266-66848288 AAGAAGAGAGAGAAGAGGAGTGG - Intergenic
1098334719 12:69391378-69391400 CAGAAGAGGCTAAAGAGGAGAGG - Intergenic
1099030419 12:77519592-77519614 CAGAAAACCGAGAAGGGGAGAGG + Intergenic
1099147821 12:79069145-79069167 CAGAAGAGAGAGAACAGGAATGG + Intronic
1099447813 12:82773150-82773172 AATAACAGTGAGAAGAAGAGTGG - Intronic
1099879601 12:88451843-88451865 CAGAGCAGGGAGAGTGGGAGAGG - Intergenic
1099970884 12:89499347-89499369 TAGAAGAGGGAGGAAAGGAGCGG + Intronic
1100007311 12:89909886-89909908 AAAAACTGGGAAAAGAGGAGAGG - Intergenic
1100206721 12:92357797-92357819 CAAAACAGAGAGAGGAGCAGAGG - Intergenic
1100406491 12:94276678-94276700 TAGAAAAGGGAGGTGAGGAGAGG + Intronic
1100469086 12:94873945-94873967 CAGAACTCGAGGAAGAGGAGAGG - Intergenic
1101260114 12:103020328-103020350 CAGAGAAGCAAGAAGAGGAGTGG - Intergenic
1101576136 12:105998396-105998418 CAGAACATGGAGAGTAGAAGAGG - Intergenic
1101596637 12:106172230-106172252 CAGGTCAGGTAGAAGACGAGAGG + Intergenic
1101949494 12:109163508-109163530 AAGAAGAGAGAGAATAGGAGAGG + Intronic
1101968379 12:109296039-109296061 CAGAGAAAGGGGAAGAGGAGAGG - Intronic
1102050815 12:109860807-109860829 CAAAAGAGGGAGAGGAGGAGAGG - Intronic
1102176815 12:110882099-110882121 CAGCACAGGGAGAAGGTGTGTGG + Intronic
1102515269 12:113441949-113441971 CAGGGCAGGGACATGAGGAGGGG + Intergenic
1102518951 12:113467469-113467491 CAGGGAAGGGAGAAGAGGGGGGG - Intronic
1102529111 12:113533069-113533091 CAGAGCAGGGAGTAGAGCTGAGG - Intergenic
1102794196 12:115674192-115674214 GAGAAGAGGAAGAAGAGAAGAGG - Intergenic
1102875196 12:116443722-116443744 GAGAAAGGGGAGAGGAGGAGAGG + Intergenic
1102904450 12:116663332-116663354 CAGAGCAGGGAGAGGTGGGGAGG - Intergenic
1102934281 12:116883426-116883448 CAGCAGAGGGGGAAGAGAAGGGG + Intergenic
1102959684 12:117084646-117084668 CAGAACAGGGAGGATGGGAGGGG + Intronic
1102993562 12:117331490-117331512 CTGAAGAGGAAGAACAGGAGGGG + Intronic
1103180549 12:118907521-118907543 GAGAAGAAGGAGAAGAGAAGAGG + Intergenic
1103237440 12:119385193-119385215 CAGAGCAGGGAGGAGAAGGGTGG - Intronic
1103418781 12:120763160-120763182 CAGAACAGGGAGGAGATGGCTGG + Exonic
1103878575 12:124148523-124148545 AGCAACAGTGAGAAGAGGAGGGG + Intronic
1103887055 12:124210398-124210420 CTTAAGATGGAGAAGAGGAGAGG - Intronic
1103893688 12:124258889-124258911 CGGAACAGGCAGCAGAGGAATGG + Intronic
1104363199 12:128153256-128153278 CAGAGCAGGAACAAGAGCAGGGG + Intergenic
1104410153 12:128551068-128551090 CTGGAAAGGGAGAAGGGGAGAGG - Intronic
1104429391 12:128704570-128704592 CAGTGCAGGGAGAAGAGGGGAGG + Intronic
1104451875 12:128875876-128875898 CAGAGAAAGGAGAAGATGAGGGG - Intronic
1104621924 12:130320422-130320444 CAGGAATGGGAGGAGAGGAGAGG + Intergenic
1104763783 12:131313659-131313681 CAAGAAAGGGAGCAGAGGAGGGG + Intergenic
1105898484 13:24738380-24738402 GGGAACAGGGAGAACAGAAGGGG - Intergenic
1106205167 13:27586400-27586422 CTGAGCTGGGAGAAGAGGGGTGG - Intronic
1106243047 13:27925337-27925359 AAGAGGAGGGAAAAGAGGAGGGG - Exonic
1106365547 13:29075954-29075976 CAGAAGAGTGAGAAGAAGATAGG + Intronic
1106929330 13:34646927-34646949 GAGAACAGAAAGAAAAGGAGAGG + Intergenic
1107355986 13:39567588-39567610 AGGAAAAGGTAGAAGAGGAGAGG - Intronic
1107457346 13:40567022-40567044 CAGGCCAGGGTGAAGAGAAGTGG - Intronic
1107768054 13:43758467-43758489 CAGAGGAGGGACAAGAAGAGAGG + Intronic
1107958339 13:45538896-45538918 CAGAGAAGAGAGGAGAGGAGAGG - Intronic
1107961544 13:45563646-45563668 CAGTACATGCAGAAGGGGAGAGG + Intronic
1108108569 13:47041644-47041666 AAGGACAGGGTGAAGAGGTGTGG - Intergenic
1108247625 13:48533221-48533243 CAGCCTAGGGAGGAGAGGAGGGG - Exonic
1108569922 13:51739563-51739585 CAGCATACGGAAAAGAGGAGAGG + Intronic
1108950753 13:56088794-56088816 CAGAACAGGAGGAAGAGAGGGGG - Intergenic
1109690233 13:65878519-65878541 AAGAAGAGGGAGAAGAGGTAGGG - Intergenic
1109895125 13:68676806-68676828 AAGAAAAGAGAGGAGAGGAGAGG - Intergenic
1110079343 13:71291147-71291169 TAGAAAAAGGAAAAGAGGAGGGG - Intergenic
1110366872 13:74696616-74696638 CAGAAATGGGAGGAGGGGAGGGG - Intergenic
1110430528 13:75417607-75417629 CAGACCAGGCAGAGGAGGAGGGG + Intronic
1111570316 13:90075744-90075766 CAGAAAAGTGACATGAGGAGTGG - Intergenic
1111782767 13:92750471-92750493 CAGAAAAAGGAGAAAATGAGAGG + Intronic
1111956223 13:94761438-94761460 GGGAACAGGGAGAAGAGAATGGG - Intergenic
1112622639 13:101067285-101067307 AAGAGGAGGGGGAAGAGGAGGGG + Intronic
1112622644 13:101067297-101067319 AAGAGGAGGGGGAAGAGGAGGGG + Intronic
1112622649 13:101067309-101067331 AAGAGGAGGGGGAAGAGGAGGGG + Intronic
1112895511 13:104295040-104295062 TAAAACAGAGAGAAGAGGAAAGG + Intergenic
1113250596 13:108448493-108448515 GACAAGAGGGAGATGAGGAGGGG - Intergenic
1113535526 13:111063298-111063320 CAGCAAAGGGAGATGGGGAGGGG - Intergenic
1113889604 13:113728916-113728938 CAGAGGTGGGAGGAGAGGAGAGG + Intronic
1114172708 14:20289589-20289611 CTCAACAGGGAGTGGAGGAGAGG - Exonic
1114269230 14:21091041-21091063 CACCACCGGGAGCAGAGGAGCGG - Exonic
1114308221 14:21442632-21442654 GAGAAAGGGGAGGAGAGGAGAGG + Intronic
1114573913 14:23695346-23695368 CAGCACCGGGAGAAGAGCAAAGG + Intergenic
1114726825 14:24946697-24946719 CAAGAAAGGGAGAAGAAGAGAGG + Intronic
1114823386 14:26048831-26048853 CACAAAAGGGAAAAGAAGAGAGG + Intergenic
1115395842 14:32907375-32907397 CAGAACAAGGAGAAGAGTAGAGG - Intergenic
1115975254 14:38990151-38990173 CAGAAAAGAGGGAAGAGGAAAGG - Intergenic
1116475862 14:45338591-45338613 GAGAAGAGGAAGAAGAGGAGAGG + Intergenic
1116538693 14:46069075-46069097 GAGAATTGTGAGAAGAGGAGTGG + Intergenic
1116544410 14:46145683-46145705 CAGAGAAGGTAGATGAGGAGAGG + Intergenic
1116774076 14:49159593-49159615 CAGACTAAGGAGAAGAGAAGGGG + Intergenic
1117079601 14:52137583-52137605 TGGAAGAGGGAGAAGAGGAAGGG + Intergenic
1117786665 14:59292848-59292870 GAGAAATGGCAGAAGAGGAGAGG - Intronic
1117864829 14:60136291-60136313 GAGGTCAGGTAGAAGAGGAGAGG - Exonic
1118040763 14:61914037-61914059 CAGAATAGGAAAAATAGGAGAGG - Intergenic
1118326948 14:64787663-64787685 AAGAAGAGGAAGAAGAGGACAGG + Intronic
1118574223 14:67225458-67225480 CAGCACAGGGAGGAGGAGAGAGG + Intronic
1118680342 14:68235342-68235364 TAGATCAAGCAGAAGAGGAGGGG + Intronic
1119266451 14:73265520-73265542 CAGAATAGGAGGAAGGGGAGAGG - Intronic
1119331931 14:73801306-73801328 CAGAATTGGGAGAATAGGGGAGG - Intergenic
1119543574 14:75456328-75456350 CAGAACACGGAGATGAAGAAGGG - Intronic
1119764251 14:77178455-77178477 CAGAAAGGAGAGGAGAGGAGGGG - Intronic
1120025624 14:79581004-79581026 CTGTTCAGGGAGCAGAGGAGTGG + Intronic
1120556526 14:85934546-85934568 CAGAAAAAGGAAAAGGGGAGGGG + Intergenic
1120947888 14:90015145-90015167 AAGCCCAGGGAGGAGAGGAGTGG + Intronic
1121156433 14:91689276-91689298 CAGAGCGGGGAGTAGAGGACTGG - Intronic
1121280858 14:92696706-92696728 AAGAAAAGAAAGAAGAGGAGAGG + Intergenic
1121310838 14:92934214-92934236 TAGAACAGGGCTCAGAGGAGGGG + Intronic
1121765618 14:96483092-96483114 AAGAAAAGGCAGAAGAGGAGCGG + Exonic
1121777067 14:96598113-96598135 GAGAGGAGGGGGAAGAGGAGAGG - Intergenic
1122038153 14:98963166-98963188 CAGAAGAAGAAGAAGAAGAGAGG + Intergenic
1122068723 14:99191484-99191506 AAAGACAGAGAGAAGAGGAGGGG + Intronic
1122415209 14:101546259-101546281 GGGAACAGGGAGAAGAAGCGGGG + Intergenic
1122621340 14:103059008-103059030 AAGAAGAAGAAGAAGAGGAGTGG + Intergenic
1122634206 14:103122717-103122739 CGGAGCAGGCAGAAGGGGAGGGG - Intergenic
1122747970 14:103910930-103910952 TAGTAAAGGGAGAAGAGGAATGG + Intergenic
1123419851 15:20122856-20122878 AAGAAAACGGAGGAGAGGAGGGG - Intergenic
1123446009 15:20330676-20330698 AAGAAAACGGAGGAGAGGAGGGG + Intergenic
1123529073 15:21129392-21129414 AAGAAAACGGAGGAGAGGAGGGG - Intergenic
1124342932 15:28901650-28901672 CGGCACAGGGAGATGAGAAGGGG - Intronic
1124395283 15:29295271-29295293 CTGGAGTGGGAGAAGAGGAGTGG + Intronic
1124465112 15:29931250-29931272 CAGAGGAGGAGGAAGAGGAGGGG + Intronic
1124660686 15:31548558-31548580 CAGAACAGGCAGAAGAGACTTGG - Intronic
1124957831 15:34371122-34371144 GAGAAGAGGAAGAGGAGGAGGGG - Intergenic
1125318790 15:38459672-38459694 CAGCCCAGGGAGGAAAGGAGAGG - Intronic
1125347379 15:38731992-38732014 CAGAATAGGTAGAAGGGAAGTGG - Intergenic
1125440123 15:39692854-39692876 AAGAAAGGGGAGAAGGGGAGTGG + Intronic
1125760116 15:42090588-42090610 GAGGTCAGAGAGAAGAGGAGTGG + Intronic
1125760484 15:42092962-42092984 GAGGTCAGAGAGAAGAGGAGTGG + Intronic
1125882834 15:43208771-43208793 CAGCACTGTGAGAAGAGGGGCGG + Exonic
1126718788 15:51553603-51553625 GAGAGGAGGAAGAAGAGGAGGGG - Intronic
1127117877 15:55744886-55744908 GGGAACAGGGAGAAGGGGAAGGG - Intergenic
1127321307 15:57849008-57849030 GAGAAAAGGGAAAGGAGGAGAGG + Intergenic
1127541282 15:59941369-59941391 CAGAAGAGGGAGCAGTGGGGTGG - Intergenic
1127886556 15:63206623-63206645 CAGATGACGGAGGAGAGGAGGGG - Intronic
1128756386 15:70186443-70186465 AAGCAGATGGAGAAGAGGAGTGG - Intergenic
1128894019 15:71356571-71356593 AAGGAAAGGGAGAAAAGGAGGGG + Intronic
1129129689 15:73482361-73482383 AAGAACAGGAACAAGAGAAGGGG - Intronic
1129160880 15:73747057-73747079 GTGAACAAGGAGAAGAGTAGAGG - Intronic
1129244617 15:74271830-74271852 CAGAGCAGAGGGCAGAGGAGGGG + Intronic
1129258058 15:74345402-74345424 CAGAGCAGGGAGGAGGTGAGAGG - Intronic
1129294464 15:74592303-74592325 CAGAACAATGTGAAGAGGAAGGG - Intronic
1129314410 15:74732513-74732535 CAGATCTGGGAGATGAGGGGAGG + Intergenic
1129395013 15:75239199-75239221 AAGACAAGGGAGGAGAGGAGAGG + Intergenic
1129601040 15:76998314-76998336 CAGAACACGGGGCGGAGGAGGGG + Intronic
1129649966 15:77478166-77478188 GAGAATAGGGAGATGAGGTGGGG + Intronic
1130106507 15:80932497-80932519 CAGAGAAGGCAGAAGAGGGGCGG + Intronic
1130221081 15:82020234-82020256 TATGACAGAGAGAAGAGGAGAGG - Intergenic
1130577021 15:85102119-85102141 GAGAACAGCAAGAAAAGGAGAGG + Intronic
1130585204 15:85175274-85175296 GAGGGGAGGGAGAAGAGGAGAGG + Intergenic
1130639926 15:85662989-85663011 AATACCAGGGATAAGAGGAGGGG - Intronic
1130943043 15:88527122-88527144 AAGAACAAAGAGAATAGGAGAGG - Intronic
1131169180 15:90164649-90164671 CAGGAGAGGGAGGAGACGAGAGG + Intronic
1131586026 15:93693665-93693687 CAGAACAGGAAAAAGAGATGAGG + Intergenic
1131676363 15:94674508-94674530 AAGGAGAGGGGGAAGAGGAGGGG - Intergenic
1131707761 15:95016651-95016673 CTGATCAGAAAGAAGAGGAGGGG + Intergenic
1132319250 15:100913507-100913529 CAAAACTGGCAGAAGAAGAGAGG - Intronic
1132712903 16:1277149-1277171 CAGGACAGGGGTAAGAGGAGAGG + Intergenic
1133139908 16:3736075-3736097 TAGAACAAGAAGAAGAGGAGAGG - Exonic
1133392055 16:5418668-5418690 CAGAAGAGGGAGGAAAGAAGGGG - Intergenic
1133415153 16:5600765-5600787 AAGAAGAGGAAGAAGAGGAAAGG + Intergenic
1133467416 16:6041144-6041166 CAAAACAGGAAAAAGATGAGTGG - Intronic
1133825364 16:9273526-9273548 AGGAAGAGGGGGAAGAGGAGGGG - Intergenic
1134322552 16:13176839-13176861 CAGAGAGGGGAGAAGAGGTGTGG - Intronic
1134375228 16:13665955-13665977 AGGAAGAGGAAGAAGAGGAGGGG + Intergenic
1134507618 16:14820975-14820997 GAGAACAAGGGGAAGAGAAGAGG - Intronic
1134523309 16:14928081-14928103 GAGAAAAGGGGGGAGAGGAGAGG - Intronic
1134695316 16:16219737-16219759 GAGAACAAGGGGAAGAGAAGAGG - Intronic
1134710906 16:16326565-16326587 GAGAAAAGGGGGGAGAGGAGAGG - Intergenic
1134752053 16:16633044-16633066 TAGAATAGGGAGATGGGGAGAGG - Intergenic
1134948678 16:18342044-18342066 GAGAAAAGGGGGGAGAGGAGAGG + Intergenic
1134976516 16:18574949-18574971 GAGAACAAGGGGAAGAGAAGAGG + Intergenic
1135050033 16:19185192-19185214 CAGGACAGGGAGAGAAGGAAGGG - Intronic
1135084744 16:19466339-19466361 AAGAAAAGAGAGGAGAGGAGAGG - Intronic
1135612537 16:23881117-23881139 CATCACAGAGTGAAGAGGAGAGG - Intronic
1135814791 16:25622716-25622738 CAGAGCAGGGAGCAAAGGAGCGG - Intergenic
1136122207 16:28145351-28145373 CAGGGTGGGGAGAAGAGGAGGGG - Intronic
1136360891 16:29779036-29779058 CAGACCAGGGAGAGCTGGAGGGG + Intronic
1136395343 16:29989474-29989496 GAGAAGAGAGAGAAGAGGAGAGG - Intronic
1136516466 16:30771668-30771690 CTGGAGAGGGAGAACAGGAGGGG + Intronic
1136605506 16:31331006-31331028 GAGAGGAGGGAGAAGAGGTGGGG + Intronic
1136720758 16:32317999-32318021 AAGAAAACGGAGGAGAGGAGGGG - Intergenic
1136839138 16:33524280-33524302 AAGAAAACGGAGGAGAGGAGGGG - Intergenic
1137316013 16:47323878-47323900 GAGAACAGGGAGAGGAAGACGGG + Intronic
1137714439 16:50589816-50589838 GAGAAAAGAGAGGAGAGGAGAGG - Intronic
1138198171 16:55069482-55069504 CAGGACAGGGAGGAGATGAGGGG - Intergenic
1138430968 16:56969071-56969093 AAGAGGAGGCAGAAGAGGAGAGG - Intronic
1138678251 16:58667119-58667141 GAGAACTGGGAGAGGAGGAGGGG + Exonic
1139008793 16:62607212-62607234 CAGAAGAGAGGGAAGAGGAGAGG - Intergenic
1139041499 16:63004460-63004482 CAGAGCAGGGAGAGGAAGGGGGG - Intergenic
1139313760 16:66050178-66050200 GGGAAAAGGGAGAAGAGGAGAGG + Intergenic
1139505652 16:67396840-67396862 CAGAGGGGGGAGCAGAGGAGGGG + Intronic
1139687134 16:68612762-68612784 CAGGAGGAGGAGAAGAGGAGAGG + Intergenic
1140963229 16:79937809-79937831 AAGGAGAGGGGGAAGAGGAGGGG - Intergenic
1141594011 16:85086571-85086593 CAGAACAGGGCGAGGAGCTGGGG + Intronic
1141669906 16:85486195-85486217 GAGTACAGAGAGAAGGGGAGAGG - Intergenic
1141713944 16:85716384-85716406 GAGAGGAGGGAGAAGAGGAAGGG + Intronic
1141739164 16:85879168-85879190 CAGAACTGTGAGATGACGAGTGG - Intergenic
1141900332 16:86986866-86986888 CAGATCAGGGAGGGGAGGGGAGG + Intergenic
1142108388 16:88318360-88318382 CAGAGCATGGAGAGGAGGAAGGG - Intergenic
1142130673 16:88430291-88430313 CAGGGCAGGCAGCAGAGGAGGGG + Exonic
1142160383 16:88554538-88554560 CAGGTCAGAGAGGAGAGGAGAGG - Intergenic
1142377652 16:89714592-89714614 CAGAGCAGGGGCAGGAGGAGTGG + Intronic
1203005674 16_KI270728v1_random:199771-199793 AAGAAAACGGAGGAGAGGAGGGG + Intergenic
1203137224 16_KI270728v1_random:1735891-1735913 AAGAAAACGGAGGAGAGGAGGGG + Intergenic
1203149303 16_KI270728v1_random:1824567-1824589 AAGAAAACGGAGGAGAGGAGGGG - Intergenic
1142768350 17:2078786-2078808 GCGAACAGGGAGAAGACAAGGGG + Intronic
1143216627 17:5229926-5229948 AAGAAAGGAGAGAAGAGGAGAGG - Intronic
1143679638 17:8466950-8466972 CAGACCAGGAGGAGGAGGAGCGG - Exonic
1143706133 17:8698820-8698842 CAGGAAGGGGAGAGGAGGAGTGG + Intergenic
1144002993 17:11072952-11072974 CAGGAGGGAGAGAAGAGGAGGGG - Intergenic
1144479039 17:15613776-15613798 CAGAACTGGGCCAAGAGGGGAGG + Intronic
1144919265 17:18749957-18749979 CAGAACTGGGCCAAGAGGGGAGG - Intronic
1144966304 17:19078806-19078828 AAGAAGAGGCAGAGGAGGAGGGG - Intergenic
1144981614 17:19173251-19173273 AAGAAGAGGCAGAGGAGGAGGGG + Intergenic
1144986610 17:19204988-19205010 AAGAAGAGGCAGAGGAGGAGGGG - Intergenic
1145071359 17:19811231-19811253 GAAAACAGGGAGAAGAGGCAGGG + Intronic
1145684030 17:26637370-26637392 CTAGACAGGGAGAAGAGGAAAGG + Intergenic
1146646152 17:34578888-34578910 AGGAAGACGGAGAAGAGGAGGGG - Exonic
1146670844 17:34736488-34736510 GAGGAGAGGGAGAGGAGGAGAGG + Intergenic
1146700211 17:34951534-34951556 GAGCACAGGGAGAGGAGGTGAGG - Intronic
1147051987 17:37802170-37802192 CAGAGCAAGGAGAGGGGGAGAGG - Intergenic
1147497078 17:40926897-40926919 AAGAAAGGAGAGAAGAGGAGGGG - Intronic
1147498831 17:40942627-40942649 AAGAAGAAGAAGAAGAGGAGGGG - Intergenic
1147582488 17:41635214-41635236 CAAAACAGGAAGCAGAGGTGGGG + Intergenic
1147703462 17:42410305-42410327 TAGAAGAGGGTGCAGAGGAGGGG + Intronic
1147859389 17:43509010-43509032 AAGAAGAGGAAGAAGAGGAGAGG - Intronic
1147869571 17:43578001-43578023 CAAGACAGGAAGAAGGGGAGGGG + Intronic
1147930846 17:43979787-43979809 TAGAAGAGGGGGAAGAGTAGGGG + Intronic
1148261004 17:46183539-46183561 CAAAAGAAGGAAAAGAGGAGAGG + Intronic
1148331835 17:46818129-46818151 CCCAAAATGGAGAAGAGGAGTGG + Intronic
1148440908 17:47711207-47711229 CAGAACAGGGAAAGGAGGACAGG - Exonic
1148551437 17:48552653-48552675 CACAAGGGGGAGAAGAGGACTGG + Exonic
1148653272 17:49264934-49264956 AGTGACAGGGAGAAGAGGAGGGG + Intergenic
1148740210 17:49888368-49888390 CAGTGCAGGGGGAGGAGGAGGGG + Intergenic
1148984961 17:51613316-51613338 GAGAGGGGGGAGAAGAGGAGGGG - Intergenic
1149134732 17:53350919-53350941 GAGATCAGGGAGATGAGTAGGGG - Intergenic
1149387113 17:56153320-56153342 CAGTGCAGGGTCAAGAGGAGAGG - Intronic
1149430649 17:56593845-56593867 AAGAGCAGCGAGAGGAGGAGGGG + Exonic
1149516161 17:57282594-57282616 CAGAACAGGGAGAGGAAGCAGGG - Intronic
1149584786 17:57778692-57778714 ATGTACAGAGAGAAGAGGAGTGG + Intergenic
1149746120 17:59100089-59100111 CAAAAGAGGGAGAGGAGGAGAGG - Intronic
1149885305 17:60333684-60333706 AAGAAAAGAGAGGAGAGGAGAGG + Intronic
1150644274 17:66968487-66968509 GAGAGGAGGGAGAGGAGGAGGGG - Intronic
1150644294 17:66968541-66968563 GAGAGGAGGGAGAGGAGGAGGGG - Intronic
1150644315 17:66968595-66968617 GAGAGGAGGGAGAGGAGGAGGGG - Intronic
1150644326 17:66968622-66968644 GAGAGGAGGGAGAGGAGGAGGGG - Intronic
1150644337 17:66968649-66968671 GAGAGGAGGGAGAGGAGGAGGGG - Intronic
1150644348 17:66968676-66968698 GAGAGGAGGGAGAGGAGGAGGGG - Intronic
1150767467 17:68013579-68013601 AAGAAGAGGAAGAAGAGGAAGGG + Intergenic
1150964159 17:69948422-69948444 AAGAAGAAGAAGAAGAGGAGGGG + Intergenic
1151116474 17:71740971-71740993 CAGAGCTGGGGGAAGGGGAGAGG - Intergenic
1151439857 17:74121193-74121215 CAGAAGAGGGAGTAGGGAAGTGG + Intergenic
1151568909 17:74916303-74916325 GAGAACAGGGAGAAGAGCTGTGG + Exonic
1151892510 17:76958998-76959020 CAGCACAGGGAGATTGGGAGAGG - Intergenic
1151983460 17:77527823-77527845 TAGAACAAGGAGAAAAGGAAAGG + Intergenic
1152100066 17:78296203-78296225 CAGAAAAGGGAGAGGTGAAGAGG + Intergenic
1152155718 17:78631631-78631653 CAAAAGAGTGAGAAGAGAAGAGG + Intergenic
1152228460 17:79103318-79103340 AAGACGAGGAAGAAGAGGAGTGG + Intronic
1152297533 17:79476840-79476862 CAGAGAAGGAGGAAGAGGAGGGG + Intronic
1152805210 17:82352426-82352448 CAGACCAGTGGGCAGAGGAGGGG + Intergenic
1153257995 18:3192078-3192100 CAGAGCAGGGAGAAGATGTTAGG + Intronic
1153530904 18:6044670-6044692 AAAAAGAGGAAGAAGAGGAGGGG + Intronic
1153532439 18:6061696-6061718 CAGAGAAGGGAGAAAAAGAGAGG - Intronic
1153544516 18:6192351-6192373 CAGAGCAGGCAGGAGAGGATGGG + Intronic
1153562593 18:6386269-6386291 CATGACAGGGAGAAGAGCATAGG + Intronic
1153647075 18:7204975-7204997 GAGAAAAGGGAGAAGCGGGGTGG - Intergenic
1154033245 18:10772507-10772529 CAGAACACAGAGGAGAGGACTGG - Intronic
1155076778 18:22364305-22364327 CAGAAGAGGAGGAAGAGGAGGGG - Intergenic
1155313836 18:24551781-24551803 CAGAAATGGGAGAGGAGGAGGGG - Intergenic
1155403499 18:25463350-25463372 AAGAACACAGAAAAGAGGAGGGG + Intergenic
1156270370 18:35525039-35525061 CAGGCCAAGGAGAAGAGGAGAGG - Intergenic
1156275274 18:35578134-35578156 CAGGGAAGGGAGAAGAGTAGAGG - Intergenic
1156322843 18:36044143-36044165 AGGAAGAGGGGGAAGAGGAGCGG + Intronic
1156681758 18:39598374-39598396 AGGAAGAGGAAGAAGAGGAGGGG - Intergenic
1156928262 18:42609850-42609872 CAGAACTGGAAGTAGAGGAGTGG + Intergenic
1157049497 18:44145301-44145323 CAGAGCAGGGACAAGCTGAGAGG + Intergenic
1157112034 18:44830179-44830201 CACAAAAGGGAGAAGAGGGGAGG + Intronic
1157379786 18:47203094-47203116 CAGAAAAGAGAGAAAAGGAAAGG + Intergenic
1157475529 18:48021176-48021198 TAGAGGAGGGAGAGGAGGAGAGG - Intergenic
1157796618 18:50580852-50580874 CAGAGCAGGGAGCAAAGGAGGGG - Intronic
1158129253 18:54134559-54134581 GAGAAAAGAAAGAAGAGGAGAGG + Intergenic
1158182233 18:54729302-54729324 GAGACTAGGGAGAAAAGGAGAGG + Intronic
1158332335 18:56376309-56376331 AAGAAAAGAGAGAAGAGGAGAGG + Intergenic
1158416544 18:57253919-57253941 CAGAACCTGTAGAAGTGGAGTGG + Intergenic
1158536061 18:58309267-58309289 CAGAGCAGGGATGACAGGAGTGG - Intronic
1158580413 18:58676122-58676144 CAAAACAGGGAGAAGTTAAGTGG - Intronic
1159194223 18:65090892-65090914 GAGAAGAGAGAGAAGAGGTGGGG - Intergenic
1159990918 18:74906245-74906267 CAAAACAGGGAAGAGAGGAGAGG - Intronic
1160019377 18:75168355-75168377 CATACCAGTGGGAAGAGGAGAGG + Intergenic
1160038621 18:75323002-75323024 CAGAACAGTGGGAGGAGGAGAGG - Intergenic
1160208608 18:76858357-76858379 CAAAAAAGGGAGAAGGGGGGAGG - Intronic
1160234041 18:77071513-77071535 CAGAACAGAAAGATGAGGAAGGG + Intronic
1160581277 18:79885783-79885805 CAGGACAGGGAGATGGGGATGGG + Intronic
1160607777 18:80065449-80065471 CAGAGCAGGGAGCAGATGTGTGG - Intronic
1160716727 19:580123-580145 CAGAGCAGGGACCAGAGGTGTGG + Intronic
1160748785 19:723948-723970 CAGACCAGGGAGGGGAGGGGAGG + Intronic
1160965658 19:1745998-1746020 GGGAAGAGGGAGAGGAGGAGGGG + Intergenic
1160975531 19:1790543-1790565 CAGTGGAGGGAGAAGGGGAGAGG - Intronic
1161104972 19:2438787-2438809 CAGAACAGGCAGGAGAGGCTGGG - Intronic
1161207068 19:3046910-3046932 CAGAGGAGGGGGAGGAGGAGAGG - Intronic
1161504293 19:4635810-4635832 CAGAGCAGGGACAGAAGGAGGGG - Intergenic
1161668697 19:5592174-5592196 CAGAGCGGGGAGAACAGGAAAGG - Intronic
1161829243 19:6590701-6590723 CAGAACAGGGAGGCGAGGCGGGG - Intronic
1162101555 19:8342412-8342434 CAGGGCAGGGAGCGGAGGAGAGG - Intronic
1162311159 19:9908102-9908124 CGGAAGAGGGAGAGGAGGTGAGG - Intronic
1162326025 19:10000080-10000102 AAGGGCAGGGAGAAGAGAAGAGG - Intronic
1162874164 19:13608554-13608576 TGCAACAGGGAGAAGGGGAGGGG - Intronic
1162952763 19:14081766-14081788 CAGAATAGGGGGCAGGGGAGGGG - Exonic
1163019579 19:14475150-14475172 CAGATCAGGGAGAAGAGCCCGGG + Intronic
1163095659 19:15055303-15055325 CAGGAGAGGGGGAAGAGCAGAGG - Intronic
1163369020 19:16891756-16891778 CAAAAAAAAGAGAAGAGGAGAGG + Exonic
1163667255 19:18609104-18609126 GAGAGGAGGGGGAAGAGGAGAGG - Intronic
1164249916 19:23467465-23467487 GAGAAGAGAGAGAAGAAGAGAGG - Intergenic
1165356826 19:35309718-35309740 CAGGACAGAGAAAAAAGGAGGGG + Intronic
1165381538 19:35484974-35484996 GAGTACAGGAAGAAGAGGGGAGG - Intergenic
1165435453 19:35792508-35792530 CAGAACTGGGAGGTGAGCAGTGG - Intergenic
1165730804 19:38143423-38143445 GAGAACAGGGAAAGGAGGAGAGG - Intronic
1166069220 19:40377635-40377657 CAGAACAGGGCCAGGTGGAGGGG - Intronic
1166070604 19:40385181-40385203 CAGACTAGGGGGCAGAGGAGAGG - Intronic
1166295797 19:41888706-41888728 TACAATGGGGAGAAGAGGAGGGG - Intronic
1166329304 19:42069424-42069446 AAGGACAGGTGGAAGAGGAGAGG + Intronic
1166887937 19:45973113-45973135 CAGAGCGGGGAGTTGAGGAGGGG - Intronic
1167165828 19:47799213-47799235 CAGAAGAAGCAGGAGAGGAGAGG + Intergenic
1167373550 19:49099244-49099266 CAGAGCAGGGAGAAGAGACATGG - Intronic
1202689376 1_KI270712v1_random:76172-76194 AAGAAAATGGAGGAGAGGAGGGG - Intergenic
925230792 2:2232234-2232256 AAGAAAAGGCAGAAAAGGAGAGG + Intronic
925515087 2:4673221-4673243 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
925556305 2:5134677-5134699 CAGAAAAGGCGGCAGAGGAGTGG - Intergenic
925625925 2:5842048-5842070 AAGAAGAGGGAGAGGAGGGGAGG + Intergenic
926083892 2:10009420-10009442 CTGGACAGGGAGAGCAGGAGGGG - Intergenic
926138188 2:10352267-10352289 CAGAACAGTGAGATGGGGAGAGG - Intronic
926623213 2:15067363-15067385 AAGAAAAGAGAGGAGAGGAGAGG + Intergenic
926634183 2:15163199-15163221 GAGAATAGGGCGAAGAGAAGTGG + Intergenic
926798837 2:16641066-16641088 CAGAAGTGGGAGCAGAGGAGGGG - Intronic
926828382 2:16932768-16932790 CAGAAAAGGGGGAAGAGGGAAGG - Intergenic
926957760 2:18320012-18320034 AAGAAGAGGAGGAAGAGGAGGGG + Intronic
927899558 2:26809439-26809461 CTGAGCAAGGTGAAGAGGAGGGG + Intergenic
928047127 2:27946671-27946693 GAGAAGAGAGAGGAGAGGAGAGG + Intronic
928050404 2:27988197-27988219 CAGGACAGAGAAAAGAGGGGTGG - Intronic
928434534 2:31246022-31246044 CAGAGTAGGGAGCAGAGGAAGGG + Intronic
928478396 2:31654957-31654979 CAGAACTTGGAGAAGAAGAAAGG - Intergenic
928613954 2:33017958-33017980 TAGAGCACGGAGATGAGGAGGGG - Intronic
929072206 2:38043575-38043597 CAGAGAAGGCAGAAGAAGAGGGG - Intronic
929240727 2:39650515-39650537 CAGAACTGGTAGAAGAGAAAGGG + Intergenic
929442399 2:41974213-41974235 CAGGGCAGGGAGAGGAGGAGAGG + Intergenic
929444500 2:41991946-41991968 GAGGGGAGGGAGAAGAGGAGGGG + Intergenic
929813166 2:45208932-45208954 CAGAAGAGGGTGGAGAGCAGTGG - Intergenic
930303815 2:49652204-49652226 CAAAACTGGGAGAAAAGGAGAGG + Intergenic
931927204 2:67086407-67086429 CAGAGCAGAGAGAGAAGGAGAGG - Intergenic
932439174 2:71721025-71721047 CAGAGAGAGGAGAAGAGGAGTGG - Intergenic
932584509 2:73018242-73018264 CAGAAAAGGAAGAAAAGGAAAGG + Intronic
932937460 2:76121358-76121380 TTGAACAGTGAGAAGAGGATGGG + Intergenic
933132190 2:78685450-78685472 CAGAAGCGGGAGAATGGGAGGGG + Intergenic
933141903 2:78801608-78801630 TAGAAGAGGGAGATGGGGAGGGG + Intergenic
933236493 2:79870447-79870469 GAGAACAGGGGGAAAAGGGGAGG + Intronic
933453139 2:82483008-82483030 GAGAAGAGAAAGAAGAGGAGAGG - Intergenic
933646795 2:84819737-84819759 CATATCAGGGTGAAGAGGAAAGG - Intergenic
933957058 2:87379920-87379942 AAGAAAATGGAGGAGAGGAGGGG + Intergenic
934241178 2:90271809-90271831 AAGAAAATGGAGGAGAGGAGGGG + Intergenic
934271998 2:91544877-91544899 AAGAAAATGGAGGAGAGGAGGGG - Intergenic
934487046 2:94725308-94725330 GAGAAAAGGGGGAAGAGGAGAGG + Intergenic
934724525 2:96607087-96607109 CAGAGAAGGGAGAAAAAGAGAGG + Intronic
934756272 2:96827007-96827029 CAGAACGGTGAGGAGAGCAGGGG - Intronic
935076104 2:99745966-99745988 CAGAAGTGGGAGGATAGGAGTGG + Intronic
935114658 2:100125076-100125098 TAGAACGTGGAGAAGAGGAGAGG + Intronic
935669854 2:105545842-105545864 CTGAATTGGGAGAAAAGGAGGGG - Intergenic
935736552 2:106111121-106111143 CAGGACAGGGAGAATGAGAGTGG + Intronic
936075627 2:109399910-109399932 CAGCGCAGGGAGAAATGGAGTGG - Intronic
936810065 2:116387900-116387922 CAGAGCAGGGTGGAGAAGAGTGG - Intergenic
936981079 2:118265994-118266016 AAGCAGAGGGAGAAGAGCAGAGG - Intergenic
937702659 2:124881592-124881614 AAGAACAGGGGGAAGAGAAGTGG + Intronic
937875640 2:126823382-126823404 CAGGAGAGGGAAGAGAGGAGAGG - Intergenic
937983232 2:127627050-127627072 AAGAGCCGGGAGAAGAGCAGCGG - Exonic
937998859 2:127716003-127716025 CAGGGCAGGGAGAGGAAGAGAGG + Intronic
938463330 2:131511668-131511690 CAGAAGAGACAGAAGAGCAGAGG - Intergenic
938989431 2:136612730-136612752 CAGAACATTGTGAAGGGGAGAGG + Intergenic
939054689 2:137350487-137350509 CATATCAGTGAGGAGAGGAGGGG + Intronic
939506734 2:143055680-143055702 AAGGAAAGGGAGGAGAGGAGAGG + Exonic
941038203 2:160590533-160590555 GAGGAGAAGGAGAAGAGGAGGGG - Intergenic
941072060 2:160966673-160966695 CAGGGCAGGGAGAGGAGCAGGGG + Intergenic
941478917 2:165982157-165982179 CAGAAAAGGGAGATGAGCAAGGG + Intergenic
941622119 2:167789918-167789940 AAGAATAAGGACAAGAGGAGTGG - Intergenic
941849243 2:170162568-170162590 CATCACAGGGAAAAGGGGAGTGG - Intergenic
941888644 2:170555188-170555210 AGAAACAGGGAGAAAAGGAGAGG - Intronic
941918668 2:170828593-170828615 GACAACAGAGGGAAGAGGAGGGG - Intronic
941918728 2:170828824-170828846 CAGCAGAGGGAGGAGAGGTGAGG - Intronic
942183241 2:173400840-173400862 GAGAAAGGAGAGAAGAGGAGGGG - Intergenic
943278238 2:185896711-185896733 AAGAAGAGGAAGAGGAGGAGGGG + Intergenic
943557146 2:189419815-189419837 AAGAAAAGAGAGGAGAGGAGAGG + Intergenic
943800893 2:192056399-192056421 AAGAAGAGGAAGAGGAGGAGGGG + Intronic
944572603 2:201059636-201059658 CTTAAGAGGGAGAAGGGGAGAGG - Intronic
944811125 2:203328421-203328443 CAGGACCGGGAGAGGAGGAGCGG - Exonic
944975285 2:205042820-205042842 CAGGACAGGGAGAAGGGATGAGG - Intronic
945010558 2:205458266-205458288 GACAAGAGGAAGAAGAGGAGAGG - Intronic
945265544 2:207888086-207888108 CAGAACTGGGTGGAGAGGAAAGG - Intronic
945582377 2:211611312-211611334 CAGAAAAAGGAAAAGGGGAGGGG + Intronic
945828715 2:214757024-214757046 CAGAGCAGGAGGAAGAGGCGAGG - Intronic
945975181 2:216264942-216264964 TAGAGCAGGGAGCAGAGGAAGGG - Intronic
946047205 2:216831055-216831077 AAGAAAAGGAAAAAGAGGAGAGG + Intergenic
946375849 2:219308660-219308682 CAGAAGAGGATGAAGAGGGGAGG - Intronic
946539252 2:220665818-220665840 GAGATGAGGGAGCAGAGGAGAGG - Intergenic
946903619 2:224395499-224395521 AAGCACAGGGAGAAAAGCAGAGG + Intronic
947154610 2:227149420-227149442 CAGAAAAGAGAGATGAGGAAGGG - Intronic
947349638 2:229229775-229229797 CAGGAAAGGGAGAAGACGGGTGG - Intronic
948017956 2:234705479-234705501 TAGAGCAGGAGGAAGAGGAGAGG - Intergenic
948360965 2:237419975-237419997 CAAAGCAGAGAGAAGTGGAGAGG + Intergenic
948841124 2:240649562-240649584 CAGGACAGGCTGAAGAGGGGCGG + Intergenic
949008770 2:241666872-241666894 AAGAACTGGGAGAAGGGGACGGG - Intronic
949010096 2:241673338-241673360 CAGGACAGGCAGCAGAGCAGCGG - Exonic
1169947005 20:10999777-10999799 CAGAACTGGCAGAAGTGGACAGG - Intergenic
1170155472 20:13265209-13265231 GAGAACAGGGAGCTGGGGAGGGG - Intronic
1170462785 20:16594012-16594034 AAGAAAAAAGAGAAGAGGAGAGG + Intergenic
1170767301 20:19301155-19301177 CTGAACAGGGAGAGGTGCAGGGG - Intronic
1170804173 20:19615672-19615694 CAAAACAGGCAGAACAAGAGGGG + Intronic
1170888822 20:20363156-20363178 AAGAGCAGGGAGAAGAGTGGGGG + Intergenic
1171095526 20:22329074-22329096 CAGTAAAGTGAGAAGAGAAGAGG - Intergenic
1171172403 20:23027192-23027214 CAGAACAGGCAGGAGAGGGGAGG + Intergenic
1171319993 20:24234038-24234060 GAAGACAGGGAGAGGAGGAGAGG + Intergenic
1171411399 20:24950761-24950783 CAGGACAGGGCCAGGAGGAGAGG - Intronic
1171948164 20:31396870-31396892 CAGAACTGGGAGAGGAGATGGGG - Intergenic
1172017920 20:31889928-31889950 CAGGACAGGAAGAAGAGGGGAGG + Intronic
1172580829 20:36046555-36046577 TGGAAGAGGGAGAAGAGGAAGGG - Intergenic
1172608350 20:36230917-36230939 CAGAACAAGGAAGAGAGTAGAGG - Exonic
1172880250 20:38195139-38195161 AAGAACAGGGAGCAGAGGCGGGG + Intergenic
1173003380 20:39121654-39121676 CAGAAGATGCAGATGAGGAGGGG + Intergenic
1173281318 20:41630933-41630955 GAGAACAGAGAGTAGAGGTGAGG - Intergenic
1173322159 20:41997979-41998001 AAGAAGAGGGTGAAGAGGAGGGG - Intergenic
1173472258 20:43332998-43333020 TAGGAGAGGGAGAAGAGGAAAGG - Intergenic
1173547993 20:43914335-43914357 CAGATCAGTGAGACGAGGAGGGG + Intergenic
1173859712 20:46275203-46275225 AGGAACAGGGAGAGGGGGAGCGG - Intronic
1174068066 20:47879829-47879851 GGGAACAGAGAGAACAGGAGGGG - Intergenic
1174108630 20:48181809-48181831 CTGCACAGGGAGTGGAGGAGGGG + Intergenic
1174483999 20:50850083-50850105 GAGACCAGGGAGAAGTAGAGCGG + Intronic
1174613717 20:51819959-51819981 CAGAGCAGGAAGAAGTGAAGAGG + Intergenic
1175072383 20:56345345-56345367 GAGAACATGGAGAAGCTGAGTGG + Intergenic
1175147324 20:56906800-56906822 CAGAACAGAAAAAAGAGAAGGGG - Intergenic
1175223137 20:57428970-57428992 GAGCTCAGGGAGAGGAGGAGGGG - Intergenic
1175823127 20:61922747-61922769 CAAAACAGAGAGAAAGGGAGAGG - Intronic
1176057159 20:63154877-63154899 GAGAAGAGGGAGAAGGGGAGAGG - Intergenic
1176128997 20:63488353-63488375 AAGAACGTGGAGAAGAAGAGCGG - Exonic
1176154755 20:63613192-63613214 AAGAACAGTGAGAAGTAGAGAGG - Intronic
1176478745 21:7258718-7258740 CAGAACAGAGTGGAGTGGAGTGG + Intergenic
1176757040 21:10733270-10733292 CAGAGCAGAGAGGAGTGGAGTGG - Intergenic
1176891654 21:14326798-14326820 GAGAGAAGAGAGAAGAGGAGGGG + Intergenic
1177618104 21:23551305-23551327 CAGGAAAGAGAGCAGAGGAGAGG - Intergenic
1177783521 21:25644499-25644521 CAGAAGAGAGAGAACAAGAGAGG - Intronic
1177874346 21:26612529-26612551 CAAAATAGGGAGTAGAGGTGAGG + Intergenic
1178595701 21:33950461-33950483 AAGAAGAGGGAAATGAGGAGGGG + Intergenic
1178629892 21:34250433-34250455 AAGAACAGGAAGAAGAGGAAAGG - Intergenic
1179149176 21:38795693-38795715 CAGACCATGGGGAAGAGGCGTGG - Intergenic
1179582656 21:42353229-42353251 CAGAAGTGGCAGAAGTGGAGTGG - Intergenic
1179726050 21:43341754-43341776 GGGAACAGGGAGACGAGCAGGGG - Intergenic
1179963298 21:44784213-44784235 GAGAGGAGGGAGGAGAGGAGAGG + Intronic
1180013840 21:45070081-45070103 CAGAAGAGGGAGACGATGGGTGG - Intergenic
1180072080 21:45441592-45441614 CAGATCACGGAGAGGAGCAGGGG - Intronic
1180186656 21:46143366-46143388 CACAAGAGGGAGATGGGGAGGGG - Intronic
1180338208 22:11598414-11598436 CAGAAGAGTGAGAGGTGGAGGGG - Intergenic
1180552044 22:16548440-16548462 AAGAAAACGGAGGAGAGGAGGGG + Intergenic
1180703359 22:17793839-17793861 CAAAAAAGGAAGAGGAGGAGAGG + Intronic
1181185873 22:21103269-21103291 AAAACCAGGGAGAACAGGAGAGG - Intergenic
1181389143 22:22566901-22566923 CAAAAAAGAAAGAAGAGGAGAGG - Intergenic
1181389218 22:22567500-22567522 CAGAACAAGAGGGAGAGGAGAGG + Intergenic
1181606284 22:23981861-23981883 CAGAAAAGGCTGAAGATGAGAGG - Intronic
1181776221 22:25161751-25161773 CAGGAAAAGGAGAAGGGGAGGGG - Intronic
1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG + Intergenic
1182075734 22:27494285-27494307 CAGGGCAGGGACAAGAGCAGAGG + Intergenic
1182397323 22:30045916-30045938 GACAAAAGGGAGAAAAGGAGAGG + Intergenic
1182520744 22:30883308-30883330 CAGTACAGGGTGAACAGGATGGG - Intronic
1182895101 22:33852931-33852953 CAGAACAGGGTAAAGAGGGATGG + Intronic
1183034098 22:35127703-35127725 CTACACAGGGAGAAAAGGAGAGG - Intergenic
1183244020 22:36679718-36679740 GAGAACAGGGAGAGCTGGAGTGG - Intronic
1183305133 22:37078854-37078876 GAGAAGAAGGAGAAGAGGAAGGG + Intronic
1183311970 22:37115072-37115094 CAGGACAGGAGGATGAGGAGAGG - Intergenic
1183337769 22:37260468-37260490 CAGAGGCGGGAGAAGTGGAGCGG + Intergenic
1183440822 22:37822310-37822332 CAGCAGAGGGGGCAGAGGAGAGG + Intergenic
1183537356 22:38410691-38410713 GAGACCGGGGAGAAGGGGAGGGG + Intergenic
1183576941 22:38697204-38697226 AAGCAAAGGGAGAAGAGGTGAGG - Intronic
1183587593 22:38762123-38762145 CAGTCCAGGGAACAGAGGAGAGG - Intronic
1183596949 22:38818597-38818619 CAAAACAGGGAGAGGAGAAAGGG + Exonic
1183742266 22:39675373-39675395 CAGAGCATGGGGAAGGGGAGAGG - Intronic
1183791757 22:40077064-40077086 AAGAAAAGAGAGAAGAGGAGAGG + Intronic
1183803723 22:40190762-40190784 CAGAGAGGGGAGGAGAGGAGAGG + Intronic
1184019178 22:41809091-41809113 GGGAACAGGGAGAAAAGGTGAGG + Intronic
1184170851 22:42758987-42759009 CAGGACAGGCAGAATAGCAGAGG - Intergenic
1184327995 22:43806166-43806188 AAGAAAAGAGAGGAGAGGAGGGG + Intronic
1184424176 22:44399399-44399421 CTGGAGAGGGATAAGAGGAGAGG + Intergenic
1184709734 22:46242068-46242090 CAGAAGAGGGGCAAGAGAAGAGG - Exonic
1184883961 22:47330824-47330846 AAGAAGAGGGAGAAAAGGAGGGG - Intergenic
1184912745 22:47547238-47547260 CAGCTCAGGGAGAAGATGACAGG - Intergenic
1184984724 22:48122049-48122071 CAGAACACAGAGAACACGAGGGG + Intergenic
1185157891 22:49205229-49205251 CAGAGCAGAGAAAGGAGGAGAGG + Intergenic
1203303571 22_KI270736v1_random:93893-93915 TAGAAAGGGGAGGAGAGGAGGGG + Intergenic
949379970 3:3433557-3433579 CAGAAGAGGGAGAAGAAGAGAGG + Intergenic
949644993 3:6083331-6083353 TAGAACAGGCAGAGGAGGAGGGG - Intergenic
949670040 3:6389026-6389048 CAGAAAAGGAAGGAGATGAGTGG + Intergenic
949750784 3:7350427-7350449 CAGACCAGGAGGAAGAGAAGTGG - Intronic
950199828 3:11034992-11035014 TAGAAGAGGGAGGGGAGGAGAGG + Intronic
950393068 3:12711879-12711901 TAGAGCGGGGAGGAGAGGAGAGG - Intergenic
950420417 3:12895528-12895550 CAGGACAGGGAACAGAGGAGAGG + Intergenic
950915598 3:16641873-16641895 GAGAAGAGGGAGAAGTGAAGGGG - Intronic
951179457 3:19641933-19641955 AAGAACAAAGAGAAGAGGTGGGG + Intergenic
951599340 3:24356116-24356138 CAGAACTAGGAAAAAAGGAGAGG + Intronic
952405500 3:33001166-33001188 AAGGAGAAGGAGAAGAGGAGAGG - Intronic
952478728 3:33737600-33737622 GAGTACAGGGAAAAGAAGAGGGG - Intergenic
952747056 3:36791368-36791390 CAGAATCAGCAGAAGAGGAGTGG - Intergenic
953322842 3:41987663-41987685 CACAGAAGGGAGGAGAGGAGTGG - Intergenic
953732492 3:45462284-45462306 CAGAACAGGAAGAAAAGGGCTGG + Intronic
953871283 3:46629662-46629684 GAGGAGAGGGGGAAGAGGAGGGG + Intergenic
953947047 3:47158447-47158469 CTGAGGAGGAAGAAGAGGAGGGG - Intronic
954009025 3:47618636-47618658 CAGGGCTGAGAGAAGAGGAGCGG + Intronic
954117713 3:48476397-48476419 CAAAATAAGGAGAGGAGGAGGGG + Intronic
954367389 3:50153951-50153973 AAGAGAAGGGAGAGGAGGAGAGG + Intergenic
954424898 3:50438132-50438154 AGGAACAGGGAGAACAGGGGTGG + Intronic
954438307 3:50507742-50507764 CACATTAGGGAGAGGAGGAGGGG + Intergenic
955211032 3:56941093-56941115 GAGAACTGGGAGAGGAGGTGGGG + Intronic
955300218 3:57771178-57771200 AAGAGAAGGGAGGAGAGGAGAGG - Intronic
955406497 3:58629013-58629035 TGGAACAGGGAGAAAAGGAGTGG - Intergenic
955507414 3:59645980-59646002 CAGAGCAGGGAGCAGAGCATGGG + Intergenic
955601233 3:60647543-60647565 CAGATCAAGGGGCAGAGGAGAGG - Intronic
955752978 3:62201533-62201555 CAGAATAGTGAAAACAGGAGTGG + Exonic
956199817 3:66694563-66694585 CTTAACAGGAAGGAGAGGAGAGG - Intergenic
956780860 3:72601961-72601983 CGGGACTGGGAAAAGAGGAGAGG + Intergenic
956849759 3:73217968-73217990 CAGAGAAGGGGGAAGAGGAAAGG - Intergenic
957683426 3:83469704-83469726 CAGAAGACAGAGGAGAGGAGAGG + Intergenic
957876010 3:86147421-86147443 TAAAACAGGGATTAGAGGAGAGG - Intergenic
958571057 3:95883525-95883547 CATAAGCGGGAGAGGAGGAGTGG + Intergenic
958821904 3:98984634-98984656 GAGAACAAGGAGAAGAGGCAGGG - Intergenic
958949504 3:100401158-100401180 CCGAAGAGGGAGAGGAGGGGCGG + Exonic
958973589 3:100640360-100640382 TAGTATAGGGAGAAGAGGAGAGG + Intronic
958978785 3:100696930-100696952 CTGAACATCGAGAAGAGCAGGGG + Intergenic
959150360 3:102600242-102600264 CAGGAAAGGGAGATGAGAAGGGG - Intergenic
959677049 3:109048162-109048184 AAGAACAGAGAGGAGGGGAGTGG + Intronic
960540064 3:118851904-118851926 CAGAAAAAGGAAAAGGGGAGGGG + Intergenic
960707810 3:120497381-120497403 CAGAAAAGGGGGAAGGTGAGTGG - Intergenic
961347991 3:126277191-126277213 CAGAGCAGGAGGAAGAGGGGTGG + Intergenic
961505128 3:127365569-127365591 CAGAGCAGGAAGAAGAGCAAAGG - Intergenic
961623848 3:128245502-128245524 CTGGACAGGGAGAAGCAGAGTGG + Intronic
961712866 3:128840616-128840638 CAGCCCAGGGAGAAGGGGAGAGG + Intergenic
961737324 3:129010430-129010452 CGGAACAGGGAGGAGAGGCCTGG + Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
962022858 3:131518307-131518329 CAGATGAGGGAGAACTGGAGAGG - Intergenic
962162647 3:133015142-133015164 AAGAGCAGGAAGAAGAGGAGAGG - Intergenic
962246397 3:133797923-133797945 TAGAAGAGGGAGAAGGGGAAGGG + Intronic
963960024 3:151299421-151299443 AAGAAAAGAGAGGAGAGGAGGGG - Intronic
964330334 3:155595014-155595036 CAGAGCTTGGAGAAGTGGAGAGG + Intronic
964580764 3:158234671-158234693 AGGAACAGGGAGAAGAGGATTGG - Intronic
964606809 3:158569259-158569281 CAGAACAGGACTGAGAGGAGAGG - Intergenic
964627446 3:158772836-158772858 CAGGAAAGAGTGAAGAGGAGGGG + Intronic
965107886 3:164381273-164381295 TAAAACACGGAGAAGAGGAATGG + Intergenic
965128277 3:164658653-164658675 AAGAACAGGGGAAAGGGGAGAGG + Intergenic
965502429 3:169472551-169472573 AAGAAAAGAGAGGAGAGGAGAGG + Intronic
966305861 3:178533922-178533944 AAGAGAAGGGAGAAGAGGGGAGG - Intronic
966323165 3:178723634-178723656 CAAAAGAGGGAGATGAAGAGAGG - Intronic
966547793 3:181170323-181170345 AAGAAAAGGGAAAAAAGGAGAGG - Intergenic
966770570 3:183500154-183500176 CAGAGCAGGCAGGAGAGGAAAGG - Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967493950 3:190122103-190122125 AAGAAAAGAGAGGAGAGGAGGGG + Intronic
968702223 4:2062508-2062530 CAGGACAGGGGGCCGAGGAGGGG + Intronic
969454752 4:7294793-7294815 GAGAGGAGGGAGAGGAGGAGGGG - Intronic
969454823 4:7294974-7294996 GAGAGGAGGGAGAGGAGGAGGGG - Intronic
969495276 4:7522910-7522932 GGGAACAGGGAGGAGAGAAGAGG - Intronic
969599777 4:8169462-8169484 CAGACCAGGGAGCAGGTGAGGGG - Intergenic
969654203 4:8486900-8486922 CAGCCCAGGGAGGAGGGGAGAGG + Intronic
970236530 4:13964367-13964389 CTGAAAAGGAGGAAGAGGAGGGG - Intergenic
970443834 4:16108057-16108079 AAGAACAAGGCTAAGAGGAGAGG + Intergenic
970524652 4:16919019-16919041 CAGCAAAGGGAGATGAGGTGGGG - Intergenic
970903312 4:21185482-21185504 GAGAAAAAGGAGAAGAGGAGGGG - Intronic
971034445 4:22677784-22677806 AAGAGTAGGGAGAAGAGGTGGGG - Intergenic
971310287 4:25520385-25520407 AAGAAAAGAGAGGAGAGGAGAGG + Intergenic
971395574 4:26224172-26224194 GAGTACAGGGGGAAGGGGAGGGG - Intronic
971435137 4:26613419-26613441 CAGAAAAGAGAGATGAGGAAAGG + Intronic
971621549 4:28860421-28860443 AAGAAGAGGAGGAAGAGGAGAGG + Intergenic
972350086 4:38228677-38228699 AAGGACAGGGAGAACAGGAGAGG + Intergenic
973865849 4:55112243-55112265 AGGAAAAGGGGGAAGAGGAGGGG - Intronic
973948621 4:55987376-55987398 CAGGACAGGTATTAGAGGAGAGG - Intronic
973956734 4:56070210-56070232 TGGAACCGGGAGGAGAGGAGAGG - Intergenic
974069386 4:57110264-57110286 CCGAAGAGGAGGAAGAGGAGAGG + Exonic
974121102 4:57640179-57640201 CTGAACATGGAGAGGAGCAGCGG + Intergenic
974356518 4:60820005-60820027 AAAAACAGGGAGAGGAGGAATGG - Intergenic
975406178 4:73993220-73993242 AAGAAAGGGGAGAAGAGGTGAGG - Intergenic
975714124 4:77189346-77189368 CGGCACAGAGAGAAGAGGTGTGG - Intronic
975839068 4:78455095-78455117 CAGAGCAAAGAGAAGAGGACTGG - Intronic
975856009 4:78625207-78625229 TTGAACTGGGAGAAAAGGAGAGG - Intergenic
975997071 4:80328135-80328157 GAGAACAGGGAAATGAGGAAGGG + Intronic
976389409 4:84493559-84493581 GAGAAAAGGGAGGAGAGGGGAGG + Intronic
977009468 4:91618551-91618573 GAGAAAAGGGAGAAGAAGAGTGG + Intergenic
977866947 4:102040204-102040226 CAGAACTAGCAGAAGAGCAGAGG - Intronic
977914277 4:102573635-102573657 CAGAAGAAGATGAAGAGGAGTGG - Intronic
978396308 4:108284098-108284120 CAGGTCAGGGAGGAGAGAAGAGG + Intergenic
979457225 4:120940746-120940768 CAGAGCACGGAGAACAGCAGAGG - Intergenic
979998057 4:127456667-127456689 AGGAAGAGGAAGAAGAGGAGGGG - Intergenic
980180403 4:129393754-129393776 CAGTAGAGGGAGTAGAGAAGTGG - Intergenic
980208570 4:129754986-129755008 GAAAACAGGGAGAGAAGGAGGGG + Intergenic
980795709 4:137679969-137679991 AAGAAGAGGCAGAAGAGAAGAGG + Intergenic
980975512 4:139606651-139606673 CTGAGCAGGGAGTTGAGGAGCGG + Intronic
981270929 4:142846592-142846614 CAGAGGAGGAGGAAGAGGAGCGG - Intronic
981278448 4:142929317-142929339 AAGAACATTGAGAAGAAGAGAGG - Intergenic
981482174 4:145250259-145250281 AAGAACAGGGAGCAAACGAGTGG - Intergenic
981637966 4:146902158-146902180 CAGAGGAGGGAAAAGAGGAAGGG - Intronic
981739554 4:147987798-147987820 CTCAGGAGGGAGAAGAGGAGTGG + Intronic
981900427 4:149855690-149855712 GAGTACAGTGAGGAGAGGAGAGG - Intergenic
981948118 4:150373812-150373834 AAACACAGGGAAAAGAGGAGAGG - Intronic
982175919 4:152705482-152705504 AGGAGCAGGGAGAAGTGGAGGGG - Intronic
983028767 4:162771921-162771943 CAGAACAAAGAGAAGAGGAGAGG + Intergenic
983057998 4:163122340-163122362 CAGAACAAAAAGAAGTGGAGAGG + Intronic
983739546 4:171111773-171111795 CAGAAGGGAGAGAAGAGGTGTGG + Intergenic
983954032 4:173676195-173676217 CAGAAATGGTAGCAGAGGAGGGG + Intergenic
984076251 4:175184423-175184445 TAGAAGAGGGAGAGAAGGAGGGG - Intergenic
984375743 4:178926638-178926660 CAGAGGAGGAGGAAGAGGAGGGG + Intergenic
984968493 4:185164597-185164619 CAGAAAAGAGAGATGAGGAAGGG - Intronic
985445304 4:190018396-190018418 CAGAAGAGCGAGAGGTGGAGGGG - Intergenic
985552437 5:540485-540507 CAGATCAGTGAGAAGATGGGAGG - Intergenic
985684632 5:1275555-1275577 CAGAACAGGGAGCCCAGGGGAGG + Intronic
985885561 5:2675004-2675026 CAGAGCAGGGAGGGTAGGAGTGG + Intergenic
986140542 5:5025963-5025985 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
986341231 5:6791104-6791126 CAGAGCAGGGAGAGGAGATGGGG - Intergenic
986360374 5:6972310-6972332 CTCAGCAGGGAGAAGAAGAGAGG + Intergenic
986607529 5:9536875-9536897 CAGAACAGTGACAGGAGGACAGG + Intronic
986671329 5:10145592-10145614 CAGAAGATGGGGAAGAGGGGAGG + Intergenic
986950048 5:13071993-13072015 CAGAGCAGGAAAAAGAGAAGGGG + Intergenic
987279973 5:16403164-16403186 CAGGACCGAGAGAGGAGGAGAGG + Intergenic
987366700 5:17155058-17155080 CAGAACATGGAGGAAAGGAGAGG - Intronic
987503954 5:18746306-18746328 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
987660877 5:20873906-20873928 CAGAAAATGGAAAAGAGCAGAGG + Intergenic
988596121 5:32592825-32592847 AAGAACAGGAAGCAGATGAGGGG + Intronic
988820816 5:34883065-34883087 CAAAACAGAGAAAAGAAGAGAGG + Intronic
988843121 5:35102530-35102552 AAGAAAAGAGAGGAGAGGAGAGG - Intronic
989456603 5:41651121-41651143 CAGAACAGATAGGAGTGGAGTGG + Intergenic
990404815 5:55478633-55478655 CAGCAGAGGAAGATGAGGAGAGG + Intronic
990624040 5:57591749-57591771 AAGAACAGAGCAAAGAGGAGAGG + Intergenic
990727094 5:58768070-58768092 CAGAACAGCAAGAAGAGGAATGG + Intronic
990977628 5:61573285-61573307 CAGGGAAGGGGGAAGAGGAGGGG - Intergenic
990983256 5:61620097-61620119 CAGACCTGGGATTAGAGGAGAGG + Intergenic
991178645 5:63722079-63722101 CAGAACAGGGACAGGCGCAGTGG + Intergenic
991198527 5:63962190-63962212 CAGAAGAGAGAGAAGAGAGGAGG - Intronic
991511130 5:67377309-67377331 CAGAACTGGGAAAAGGAGAGGGG - Intergenic
991540314 5:67720485-67720507 AAGAGGAGGGAGAAGAGGAGAGG - Intergenic
991662124 5:68961230-68961252 CAGCACAGAGCGAAGAGGAAGGG - Intergenic
992102833 5:73423705-73423727 CAGAACAAAGAGAACAGGACAGG + Intergenic
992270470 5:75057575-75057597 CAGAACACTGAGAAGTTGAGGGG + Intergenic
993163054 5:84314279-84314301 CAGATCATGGAGAAGAGGGTAGG + Intronic
993920725 5:93797798-93797820 CAGAAATGGGAGAACAAGAGAGG + Intronic
993944985 5:94107977-94107999 CAGAACTGACAGCAGAGGAGAGG - Intronic
994227963 5:97275950-97275972 CAAAACAGGAAGTGGAGGAGTGG - Intergenic
994622151 5:102176555-102176577 AAGAACAGGAAGAAGAGAAAAGG - Intergenic
995428378 5:112048993-112049015 CAGAGGAGAGAGGAGAGGAGGGG + Intergenic
995566348 5:113435582-113435604 CAGAGCAGGGCCAAGAAGAGTGG + Intronic
995714495 5:115068784-115068806 CAGAAAAAGGAGAAGAGGAGGGG - Intergenic
995764234 5:115598648-115598670 TCGAACAGAGAGAAGAGTAGGGG - Intronic
996070285 5:119123441-119123463 GAGAGGAGGGAGAGGAGGAGAGG + Intronic
996337809 5:122403878-122403900 CAGGATAAGGAGAAGAGGGGAGG - Intronic
997281966 5:132655075-132655097 CCGAGGAGGAAGAAGAGGAGGGG - Intergenic
997293842 5:132757364-132757386 CTGCTCAGGGAGAAGTGGAGGGG - Intronic
997895376 5:137711476-137711498 CCCAACAGGGAGAAGTGGACAGG + Intronic
998177581 5:139911365-139911387 AAGGACTGGGAGTAGAGGAGCGG + Intronic
998225393 5:140322811-140322833 AAGCAGAGGGAGAAGAGGGGTGG - Intergenic
998464083 5:142329249-142329271 AAGTACAGAGAGCAGAGGAGGGG + Intergenic
998663014 5:144261836-144261858 CAGATAAGTGAGAAGAGGAAAGG - Intronic
998820518 5:146053677-146053699 GAGGACAGGAAGAAGAGTAGAGG - Intronic
998986220 5:147760373-147760395 CAGAAGAGGGACAAGAGAAGAGG + Intronic
999295699 5:150458334-150458356 CAGGACAGGAAGAAGAGGGTGGG + Intergenic
999622945 5:153490799-153490821 CAGAACAGCGAGAAGAATAAAGG + Intronic
999928598 5:156406434-156406456 CAAAATAAAGAGAAGAGGAGAGG - Intronic
999962220 5:156768101-156768123 CAGAGAAGGGAGCAGTGGAGAGG - Intergenic
1000121434 5:158201690-158201712 AAGGAAAGAGAGAAGAGGAGGGG - Intergenic
1000210927 5:159105337-159105359 GAGGGCAGGGAGCAGAGGAGAGG + Intergenic
1000211789 5:159114038-159114060 CAGAAGGGGGAGAAAAAGAGTGG - Intergenic
1001581132 5:172799276-172799298 CAGAATAGGTAGAGAAGGAGAGG - Intergenic
1001677095 5:173528094-173528116 CAGGACGAAGAGAAGAGGAGAGG - Intergenic
1001702943 5:173720779-173720801 CAGAACAGAGGGGAGGGGAGGGG + Intergenic
1001851617 5:174972522-174972544 CAGAACAGTGGGAAGACAAGTGG - Intergenic
1001859653 5:175042870-175042892 GAGAACAGGGCGAAGAGTTGAGG + Intergenic
1002027086 5:176402953-176402975 CAGATGTGGGAGGAGAGGAGTGG + Intronic
1002450972 5:179318361-179318383 CAAGACAGGGAGGAGAGGCGGGG + Intronic
1002862384 6:1091637-1091659 CAGACCAGGGAAAAGGGGAAAGG - Intergenic
1003014912 6:2460542-2460564 CAGAGCAGGGAGAGGAGGCTGGG + Intergenic
1003261827 6:4524406-4524428 CTGAGGAGGAAGAAGAGGAGGGG - Intergenic
1003343971 6:5248257-5248279 CAGCACAGGGAGAAGGGGACTGG - Intronic
1003775164 6:9352279-9352301 CAGAGCAGGAGAAAGAGGAGGGG - Intergenic
1004208663 6:13615579-13615601 CGGAAGCGAGAGAAGAGGAGCGG + Exonic
1004411597 6:15386241-15386263 AAGAACAGGGAGAGGGAGAGGGG - Intronic
1004492041 6:16126820-16126842 CAGAAGAGGAAGAAGAGGCGAGG - Intergenic
1004539901 6:16539955-16539977 CAAAAAAAGGAGAAAAGGAGAGG + Intronic
1004728252 6:18332025-18332047 CAGAACGGGGAGAATGGGTGAGG + Intergenic
1004797425 6:19103163-19103185 AGGAGCAGGGACAAGAGGAGAGG + Intergenic
1006171865 6:32097758-32097780 CAGAAGAGGGTGGAGAGGTGGGG - Intronic
1006348127 6:33499738-33499760 GAGAATAGAGAGAAGATGAGTGG - Intergenic
1006747852 6:36357444-36357466 CAGAGCAGGATGAAGAGGGGTGG + Intronic
1006799119 6:36748269-36748291 TAGAAGAGGGAGAACAGCAGGGG + Intronic
1006945775 6:37783666-37783688 CAGCACAGGGAGGGGCGGAGAGG - Intergenic
1007056386 6:38889851-38889873 CAGAACAGGTTGATGAAGAGTGG - Intronic
1007272130 6:40645887-40645909 CAGCACATGTAGAAGGGGAGGGG + Intergenic
1007303530 6:40886878-40886900 GAGGAGAGGGAGAAGAGGAGAGG + Intergenic
1007766613 6:44164327-44164349 CAGGATAGGGAGTAGGGGAGGGG + Intronic
1008228951 6:48959790-48959812 AAGAAAAGGAAGGAGAGGAGGGG - Intergenic
1008418320 6:51268705-51268727 AGGAACAGGGGGAAGAGGGGAGG - Intergenic
1008450817 6:51648339-51648361 CAGGACAGTGAGGAGAGGAAAGG + Intronic
1008601625 6:53101665-53101687 CAAGACAGGGAGGACAGGAGAGG + Intergenic
1008879911 6:56371526-56371548 GTGAACAGGCAGAAGAGGAAAGG - Intronic
1008964253 6:57298459-57298481 GAGAACAAAGAGATGAGGAGTGG + Intergenic
1009657850 6:66568997-66569019 CGAAACAGTGAGTAGAGGAGTGG - Intergenic
1009677744 6:66847855-66847877 CAGAACAGGAGGTAGAGGAAGGG + Intergenic
1009866154 6:69400013-69400035 AAGAATGGGGAAAAGAGGAGGGG + Intergenic
1010370679 6:75103476-75103498 CAGAACATGGGGAAGCAGAGGGG - Intronic
1010549537 6:77204232-77204254 CAGAACAGGTATAAGTGGAGGGG - Intergenic
1011059265 6:83245070-83245092 AAGAACAGGGAGAGCAGGTGTGG + Intronic
1011111252 6:83838844-83838866 AAGGACAAAGAGAAGAGGAGTGG + Intergenic
1011165908 6:84445594-84445616 CAAAACAGGAAGAAGTAGAGGGG - Intergenic
1012444891 6:99297324-99297346 CAGAGCAGGGAGAACAATAGAGG + Intronic
1012549332 6:100453409-100453431 CAGATCAGGCAGAAGAGGCAAGG - Intronic
1012788340 6:103659746-103659768 GAGAAGAGGGAGGAGAGAAGTGG - Intergenic
1012957845 6:105590173-105590195 CAGAATAGGGGAAAGAGCAGTGG + Intergenic
1013418075 6:109942229-109942251 CAGAGCTGGGGGAAGAGAAGTGG + Intergenic
1013599855 6:111693713-111693735 CAGAGCAGGGAGAGGGAGAGTGG - Intronic
1013611734 6:111802249-111802271 CAGAGCAAGAGGAAGAGGAGAGG - Intronic
1013821384 6:114157198-114157220 GGGAACAGGGAGAAGAGGATGGG - Intronic
1013941138 6:115664307-115664329 CAGAGGAGGGAGAGAAGGAGAGG + Intergenic
1014493059 6:122086523-122086545 CAGAGCAGGAGGAAGAGGTGGGG + Intergenic
1014727720 6:124992566-124992588 TAGAATAGTGAGAAGAGGGGAGG + Intronic
1015149710 6:130023085-130023107 GAAAACAGGCAGAAAAGGAGAGG - Intronic
1015351998 6:132231050-132231072 CAGAACAGAGAGAAGTTGAGAGG - Intergenic
1015524397 6:134161766-134161788 TAAAGGAGGGAGAAGAGGAGGGG - Intergenic
1015738890 6:136431964-136431986 CAAAGCAGGAAGAAAAGGAGAGG - Intronic
1015831499 6:137374566-137374588 CAAAACAGAGAAGAGAGGAGAGG - Intergenic
1015880099 6:137863764-137863786 CAGTGCAGGGAAAAGGGGAGGGG + Intergenic
1016062404 6:139644337-139644359 AAGAACTGGGAGAGTAGGAGTGG + Intergenic
1016445177 6:144124679-144124701 GAGAACAGCTAGCAGAGGAGAGG + Intergenic
1017135437 6:151143430-151143452 AAGAACAGGCAGTAGAGGAAAGG + Intergenic
1017702676 6:157090872-157090894 CTGGAGAGGGAGAAGGGGAGGGG - Intronic
1017876440 6:158528999-158529021 CAGGACAGGGAGCAGAGCAGGGG - Intergenic
1017891108 6:158640081-158640103 CAGAACTGGGAACAGTGGAGGGG - Intronic
1018251067 6:161871009-161871031 CAGAAGACAGAGAAGGGGAGAGG + Intronic
1018415864 6:163601692-163601714 GAGGACAGGGAGGAGGGGAGAGG - Intergenic
1018549666 6:164981303-164981325 CAGAGCAGAGAGAAGGGGAAAGG + Intergenic
1019011848 6:168849311-168849333 AAGAAGAAGAAGAAGAGGAGTGG + Intergenic
1019474927 7:1239792-1239814 CGGGAGAGGGAGAGGAGGAGGGG + Intergenic
1019551733 7:1606665-1606687 AAGAAGAGGGGGAAGGGGAGGGG - Intergenic
1019564816 7:1674061-1674083 CGGAGCAGGGAGCAGAGCAGTGG - Intergenic
1019564833 7:1674137-1674159 CAGAGCAGGGAGCAGAGGAGTGG - Intergenic
1019564853 7:1674209-1674231 CGGAGCAGGGAGCGGAGGAGTGG - Intergenic
1019722784 7:2583541-2583563 CAGAACGTTCAGAAGAGGAGAGG - Intronic
1019781171 7:2940652-2940674 AAAAAGAGGAAGAAGAGGAGGGG + Intronic
1020094750 7:5362041-5362063 AAGAACCGGGAGAGGAGGAGGGG + Intronic
1020543101 7:9487166-9487188 CAAAACAGTGAGAAAAGTAGGGG - Intergenic
1020673504 7:11150432-11150454 CAGGACAGGGAGGAGAATAGAGG - Intronic
1020739091 7:11990524-11990546 CAGAAGAGGGAGAAAAGGAGAGG - Intergenic
1020791902 7:12637498-12637520 AAGAAAAGGGATAGGAGGAGAGG + Intronic
1021380464 7:19959764-19959786 CTGAGCAGGAAGAAGAGGCGAGG - Intergenic
1021414466 7:20366203-20366225 CACAACAGGTAGGAGAGGAAGGG - Intronic
1021598379 7:22340717-22340739 CGGACCAGAGGGAAGAGGAGAGG - Intronic
1021655316 7:22868564-22868586 CAGAACTGGGATAAGGAGAGAGG - Intergenic
1021820737 7:24495104-24495126 CTGAACATTGAGAAGAGCAGAGG - Intergenic
1022066457 7:26864210-26864232 CGGCACAGGGAGGAGAGGAGAGG - Intronic
1023280324 7:38562651-38562673 AAAAAGAGGGAGAAGAGGGGAGG + Intronic
1023549799 7:41357478-41357500 CACAACAGGGAGATGATGGGTGG - Intergenic
1023607565 7:41943867-41943889 CAGAAGAGGAAGAGGTGGAGAGG - Intergenic
1023719288 7:43076653-43076675 CAGAAAAAGGAAAAGAGGAGGGG + Intergenic
1024206784 7:47169738-47169760 AAGAACAGTGAGAAGAGGAAAGG + Intergenic
1024565354 7:50675798-50675820 CAGCACATGGAGATGGGGAGGGG + Intronic
1024891631 7:54210634-54210656 GAGAAGAGGGAAAAGTGGAGAGG + Intergenic
1025094006 7:56083885-56083907 AAGAACTGGGAGAAAAGCAGAGG + Intronic
1025227677 7:57178723-57178745 CAGTACAGGAGGAAGAGGAGAGG - Intergenic
1026033235 7:66813369-66813391 CAGAAGAGGGTGGAGAGGACAGG - Intergenic
1026205586 7:68254862-68254884 CAGAAGAAGGAGAAAAGAAGAGG - Intergenic
1026272661 7:68850149-68850171 AAGAAAAGAGAGGAGAGGAGGGG - Intergenic
1026301651 7:69103088-69103110 AAGAAGGCGGAGAAGAGGAGAGG - Intergenic
1026331927 7:69359652-69359674 AAGAAGAGGAAGAAGAGGAAGGG + Intergenic
1026404671 7:70052643-70052665 CTGAACTGGGAGTAGAGGTGAGG + Intronic
1026506148 7:70985929-70985951 GAGACCAGGAAGAAGAGGACTGG + Intergenic
1027433460 7:78138352-78138374 GAGAAGAAAGAGAAGAGGAGAGG + Intronic
1027614023 7:80399254-80399276 CAGAGCAGGAATAAGAGAAGAGG - Intronic
1028487296 7:91373859-91373881 CAGAACATGGAAGGGAGGAGAGG + Intergenic
1028727800 7:94109151-94109173 AAGAAGAGGAAGAAAAGGAGAGG + Intergenic
1028729106 7:94124754-94124776 CAGAAGAGCCAGAAGAGAAGTGG + Intergenic
1028926916 7:96368188-96368210 CATAAAAGGCAGAAGAAGAGTGG - Intergenic
1029361975 7:100094367-100094389 CAGAAGAGGGAGATGGGGAAGGG + Intronic
1029423663 7:100484107-100484129 CAGGACAAGGGGAAGGGGAGGGG + Intronic
1029940911 7:104479685-104479707 CAGAAGTGGAAGAAGAGGACGGG - Intronic
1029953706 7:104614576-104614598 GAGAAGAGAGAGAAGAGAAGAGG - Intronic
1030106147 7:105989220-105989242 CAGAAAGTGGAGAAGAGGTGGGG - Intronic
1030320742 7:108164541-108164563 CGGAACCGAGAGGAGAGGAGAGG + Intronic
1030440229 7:109579946-109579968 AAGAAGAGTGAGAAGAGGAGGGG - Intergenic
1030865579 7:114698498-114698520 CAGCACAGGGAGAGTAGGGGAGG - Intergenic
1030944521 7:115700360-115700382 GAGAGAAGAGAGAAGAGGAGAGG - Intergenic
1031001271 7:116417942-116417964 CAGAAAAGGGAGGGGAGGAAGGG + Intronic
1031045191 7:116879675-116879697 CACAGCAGGGAGGTGAGGAGTGG - Intronic
1031407262 7:121400829-121400851 CAGAAGAGAGAGAAAAAGAGAGG + Intergenic
1031570649 7:123355186-123355208 GAGAACAGAGAAAAGAGAAGGGG - Intergenic
1031656092 7:124357659-124357681 CAGAACAAGAAGAAGATGAAGGG - Intergenic
1032017316 7:128388429-128388451 CAGAAGAGGGAGAAGCAGAAAGG + Intergenic
1032319450 7:130872703-130872725 GAGAAGAGAGAAAAGAGGAGAGG + Intergenic
1032369672 7:131334287-131334309 GAGAAAAGGGAGAAAAGGAAGGG - Intronic
1032398263 7:131606274-131606296 CAGAGAAGGGAGAAGAGGTTAGG - Intergenic
1032628127 7:133615251-133615273 AGGAGGAGGGAGAAGAGGAGGGG - Intronic
1033154603 7:138946106-138946128 GAGAAAAGGGAGCAGATGAGAGG - Intronic
1033511624 7:142065377-142065399 CAGAAGAGGGAAATGTGGAGCGG - Exonic
1033514696 7:142094406-142094428 CAGAAGAGGGAAATGTGGAGCGG - Intronic
1033524405 7:142196196-142196218 CAGAAGAGGGAAATGTGGAGCGG - Intronic
1033585409 7:142771095-142771117 CAGCACAGTCAAAAGAGGAGAGG - Intergenic
1033776829 7:144620656-144620678 CAGAAGACTCAGAAGAGGAGAGG + Intronic
1033832636 7:145271798-145271820 GAGAAGGAGGAGAAGAGGAGGGG + Intergenic
1033844105 7:145411610-145411632 TACAAGAGGGAGGAGAGGAGAGG + Intergenic
1034439478 7:151079431-151079453 AAGAATAGGGAGAACAGTAGAGG - Intronic
1034446807 7:151117873-151117895 CAGCACTGGGAAAAGAGTAGGGG - Intronic
1035611657 8:969700-969722 CTGAACAGGGAGCTGAGGGGAGG - Intergenic
1035959821 8:4124869-4124891 CAGAAAAAGGAAAAGCGGAGGGG + Intronic
1036290713 8:7487175-7487197 TATCACAGGGAGAAAAGGAGGGG - Intergenic
1036330776 8:7824362-7824384 TATCACAGGGAGAAAAGGAGGGG + Intergenic
1036445379 8:8817606-8817628 CACAGCAAGGAGAACAGGAGGGG - Intronic
1036459262 8:8937534-8937556 CAGAAGAGGAGGAAGAGGAGGGG + Intergenic
1036705254 8:11041681-11041703 GACTAGAGGGAGAAGAGGAGAGG + Intronic
1036774221 8:11599005-11599027 CAGAACAGTGAGAAGATGAACGG + Intergenic
1037192473 8:16143569-16143591 CAGAAAGGGGAAAAGGGGAGTGG - Exonic
1037210248 8:16377296-16377318 CATAAAAAGCAGAAGAGGAGAGG - Intronic
1037246911 8:16845685-16845707 CCAAAGAGAGAGAAGAGGAGAGG - Intergenic
1037289484 8:17335987-17336009 CAGAGGAGGGAGAAGAGAAGAGG + Intronic
1037520297 8:19674519-19674541 CAGAGGAGGGAGAAGAACAGTGG + Intronic
1037691257 8:21183345-21183367 GGGAAGAGGGAGAGGAGGAGAGG - Intergenic
1037826149 8:22161784-22161806 CACACCTGGGAGAGGAGGAGAGG + Exonic
1037928462 8:22863609-22863631 CAGAGCAGTGAGAAGGGGTGGGG - Intronic
1038125226 8:24665939-24665961 AAGAACAGGGGGACGAGAAGTGG + Intergenic
1038522439 8:28244716-28244738 CTGAGCAGGAAGAGGAGGAGGGG + Intergenic
1038573657 8:28685402-28685424 AGGAAGAGGGAGAAGGGGAGGGG - Intronic
1038609739 8:29049354-29049376 CAGAGAAGGTAGAAGAAGAGAGG + Intronic
1038626547 8:29198914-29198936 CAGAAGAGGGGGAGCAGGAGGGG + Intronic
1038778749 8:30553212-30553234 GGGGGCAGGGAGAAGAGGAGTGG + Intronic
1038846880 8:31238189-31238211 CAGAAGAGGAAGAGGAAGAGGGG - Intergenic
1039039677 8:33395354-33395376 CTGAACATGGAGAGGAGAAGAGG + Intronic
1039127663 8:34221356-34221378 AAGAATAGGGAGAAGAGGAATGG - Intergenic
1039426360 8:37489697-37489719 GAGAACAGGGAAAAGGGAAGGGG - Intergenic
1039437510 8:37570266-37570288 TAGAATAGGTAGTAGAGGAGGGG - Intergenic
1039478074 8:37851741-37851763 AAGAACTGGGAGCAGTGGAGAGG - Intergenic
1039827001 8:41183149-41183171 CAGAAAAAGCAGAAGATGAGTGG - Intergenic
1039905860 8:41785963-41785985 GAGTACAGGGAGAAGAGACGCGG - Intronic
1041026477 8:53691981-53692003 GAGGACAGGCAGAAGAGCAGGGG - Intergenic
1041978542 8:63828285-63828307 CAGAAAAGGGAGATGAAGAAGGG + Intergenic
1042034898 8:64522072-64522094 CAGAAAAGGGAAAAGATAAGAGG - Intergenic
1042397796 8:68311805-68311827 GAGAGAAGGAAGAAGAGGAGGGG - Intronic
1043795609 8:84534706-84534728 GAGAACAGGGAGAAGAAGGAAGG + Intronic
1044130474 8:88517524-88517546 CAGAACAGGGAATAAAGGAAGGG - Intergenic
1044460604 8:92439964-92439986 CAGAAGAGTGAGGAGTGGAGGGG + Intergenic
1044543091 8:93429666-93429688 AAGAGCTGGGAGAGGAGGAGAGG - Intergenic
1045381468 8:101631673-101631695 CAGAACAGGAAGAAAGGGAAAGG + Exonic
1045949021 8:107830539-107830561 CAGAATTGGGAGAAGGGGAAAGG - Intergenic
1046091389 8:109506470-109506492 CAAAAGGGGGAGAAGAGAAGTGG - Intronic
1046637770 8:116691339-116691361 CAAACCTGGGGGAAGAGGAGTGG + Intronic
1047247844 8:123160404-123160426 AAGAAAAGGGAGGAGAGGAGGGG + Intergenic
1047430915 8:124790865-124790887 CAGAAGAGGGAGGAGAGATGAGG - Intergenic
1047471083 8:125173131-125173153 CAGAACAGGGACAAAAAGGGAGG - Intronic
1047541880 8:125775696-125775718 CAGAACTAGGTGAAGAAGAGAGG + Intergenic
1047807766 8:128377542-128377564 CAGAAAAAGGAAAAGAGGAGGGG - Intergenic
1048005752 8:130418077-130418099 CAGAAGAGAGAGGAGAGGAAAGG + Intronic
1048263511 8:132965522-132965544 CAGATCAGGGAGATGAGCTGGGG - Intronic
1048285519 8:133138196-133138218 CAGATCAGGGAGATTAGGAGTGG - Intergenic
1048326150 8:133440929-133440951 AAGAAAAGAGAGAAAAGGAGAGG - Intergenic
1048399631 8:134052248-134052270 CAGAAGAGAGAGGAGAGGAGAGG - Intergenic
1048461301 8:134623764-134623786 GAGGGCAGGGAGAAGAGGGGAGG - Intronic
1048473374 8:134722630-134722652 CAGATGAGGAAGCAGAGGAGGGG + Intergenic
1048670218 8:136710740-136710762 CTGAACAGGGTGAGGAGAAGAGG + Intergenic
1049005036 8:139849446-139849468 CAGAACCAGAAGGAGAGGAGAGG - Intronic
1049049559 8:140183875-140183897 AAGAAGAAGAAGAAGAGGAGAGG + Intronic
1049108769 8:140629871-140629893 GGGAGCAGGGGGAAGAGGAGGGG + Intronic
1049121960 8:140747470-140747492 AAGAGGAGGGGGAAGAGGAGGGG + Intronic
1049534518 8:143172125-143172147 TACAAGAGAGAGAAGAGGAGAGG + Intergenic
1049574258 8:143383196-143383218 CAGCACAGGGCGCAGAGGTGGGG - Exonic
1049793398 8:144483896-144483918 CAGAGCAGAGAGATGAGCAGGGG - Intronic
1049803868 8:144530256-144530278 CAGACCAGGCAGAAGACGTGGGG + Exonic
1049989148 9:976287-976309 GAGAAGAGAGAGAAGCGGAGCGG + Intergenic
1049999537 9:1062285-1062307 GAGAACAGGGTGAAGAGAAGGGG - Intergenic
1050140209 9:2509995-2510017 CAGCAAAGGGAGAATAGGGGCGG - Intergenic
1050202639 9:3161957-3161979 GATTACAGAGAGAAGAGGAGGGG - Intergenic
1051095988 9:13465631-13465653 CAGAAGAAGGAGAAGAGTAATGG + Intergenic
1051189118 9:14492559-14492581 CAGAGCAGGAAGAAGAGGGAGGG + Intergenic
1051845935 9:21451217-21451239 AAGGGCAGGCAGAAGAGGAGGGG - Intergenic
1051885899 9:21892443-21892465 AAAAACAGAGAGAAGAGTAGGGG + Intronic
1052050915 9:23849258-23849280 GGGAAGAGGGAGGAGAGGAGAGG + Intergenic
1052109454 9:24562897-24562919 CAGAAAAGGCAGAGGAGGAAAGG + Intergenic
1052127581 9:24796849-24796871 AAGAAGAGGGAGAAGATGTGGGG + Intergenic
1052560166 9:30075328-30075350 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
1053083208 9:35194701-35194723 CAAAACGGTGAGTAGAGGAGTGG - Intronic
1053480787 9:38414839-38414861 CAGAACATGACGGAGAGGAGAGG + Intronic
1053670625 9:40358388-40358410 AGCAACAGGGAGAAGAGGACAGG + Intergenic
1054513988 9:66017912-66017934 AGCAACAGGGAGAAGAGGACAGG - Intergenic
1054750897 9:68905210-68905232 CTCAACAGGGAGGAGAAGAGGGG - Intronic
1054859161 9:69931809-69931831 CATAACAGGAAAAAGATGAGGGG - Intergenic
1054991434 9:71331775-71331797 AAGAGGAGGAAGAAGAGGAGAGG + Intronic
1055441938 9:76345122-76345144 AAGAGCAGGGAGAGAAGGAGTGG - Intronic
1055987697 9:82068324-82068346 CAAAAAAGGGAGACAAGGAGTGG + Intergenic
1056047353 9:82732923-82732945 GAGAACAGGGTGAAGAGAATAGG + Intergenic
1056297657 9:85208522-85208544 TAGAACTGAGAGAAGAGTAGGGG - Intergenic
1056331467 9:85524490-85524512 CAGAAAAGGCAGAAGAGAGGTGG - Intergenic
1056614260 9:88149669-88149691 AAGCACAGGAGGAAGAGGAGAGG + Intergenic
1056781481 9:89554385-89554407 CAGAAGAGGGAGCAGAGGCTGGG - Intergenic
1056852874 9:90098689-90098711 CACCACAGGGAGGAGAGGAGCGG - Intergenic
1057254586 9:93534618-93534640 AAAAAGAAGGAGAAGAGGAGAGG - Intronic
1057446733 9:95121320-95121342 CAGAACAGGGACAAGAGGAAAGG + Intronic
1057558323 9:96107349-96107371 CAGAGGAGGGAGAAGAATAGGGG + Exonic
1057641822 9:96831102-96831124 GAGAAAAGGGAGAAAGGGAGGGG + Intronic
1058115293 9:101078171-101078193 AAGAAGAAGAAGAAGAGGAGGGG + Intronic
1058349400 9:104003422-104003444 TGGAAAAGGGAGAAGAGGAAGGG + Intergenic
1058750365 9:108033310-108033332 AAGACCATGGAGAAGAGAAGAGG - Intergenic
1058853042 9:109032059-109032081 CAGAACTGGGAGAGGGAGAGAGG - Intronic
1059034206 9:110735825-110735847 CAGAGCAGGAAGGAGAGGAAAGG + Intronic
1059151880 9:111956415-111956437 GAGATCAGGGAGAAGGAGAGAGG - Intergenic
1059407067 9:114107951-114107973 AAAAACAGGGTGAAGAGGAGAGG - Intergenic
1059712527 9:116882474-116882496 CAGAAAAGGAGGAGGAGGAGAGG + Intronic
1060458980 9:123830566-123830588 CAAAACAGGGAAAAGAGGGCCGG + Intronic
1060763434 9:126275303-126275325 CAGAATAAAGAGAAGAGGAGAGG - Intergenic
1060785308 9:126447998-126448020 CAGAGCAGAGGGAGGAGGAGGGG - Intronic
1060998974 9:127891714-127891736 GAGGAGAGGGAGAAGGGGAGGGG + Intronic
1061176773 9:129002344-129002366 CAGGACTGGGAGAAGGGAAGTGG + Intronic
1061589085 9:131587366-131587388 CAGAACAGTTAGCAAAGGAGTGG - Intronic
1061620072 9:131806239-131806261 AAGAACAGGTGGAAGAGGAAGGG + Intergenic
1061820591 9:133225443-133225465 CAGAACCGGGAGAACGGGAAGGG + Intergenic
1061934481 9:133849784-133849806 AGACACAGGGAGAAGAGGAGAGG - Intronic
1062238673 9:135524615-135524637 CAGAACCGGGAGAACGGGAAGGG - Intronic
1062525217 9:136975536-136975558 TAGAAAATGGGGAAGAGGAGGGG + Intergenic
1203772170 EBV:54959-54981 GAGAACAGGAAGACAAGGAGAGG - Intergenic
1203347092 Un_KI270442v1:42668-42690 CAGAGCAGAGAGGAGTGGAGTGG + Intergenic
1203350608 Un_KI270442v1:78401-78423 TGGAACAGGGAGGAGTGGAGTGG + Intergenic
1185574958 X:1163956-1163978 CAGAACAGAGAAAAGAGGCCAGG + Intergenic
1185662026 X:1735587-1735609 AAGTGGAGGGAGAAGAGGAGGGG - Intergenic
1185829705 X:3288919-3288941 CAAAAAAGGCAGAAGTGGAGGGG + Intergenic
1185872508 X:3675698-3675720 ATGAAGAGGAAGAAGAGGAGAGG - Intronic
1186029767 X:5354922-5354944 CAGAGAAGGAGGAAGAGGAGAGG + Intergenic
1186391532 X:9164643-9164665 CAGAGCAGGGGCAAGGGGAGTGG + Intergenic
1186459961 X:9740081-9740103 CAGCAGTGGGAGAAGGGGAGAGG + Intronic
1186650720 X:11557086-11557108 ATGAAGAGGAAGAAGAGGAGAGG + Intronic
1186829604 X:13377650-13377672 CAGAGAAGGGATAAGTGGAGAGG + Intergenic
1186871975 X:13782343-13782365 CAGTACATGGTGGAGAGGAGAGG - Intronic
1187492035 X:19761135-19761157 CAGGAGAGGGAGAAGGAGAGAGG + Intronic
1187509100 X:19901519-19901541 CAGGACAAGGAGAACAGGAGAGG + Intergenic
1187536805 X:20148427-20148449 TGGAAGAGGCAGAAGAGGAGGGG + Intergenic
1187909348 X:24096482-24096504 CAAAAAAAGAAGAAGAGGAGAGG - Intergenic
1188217843 X:27501237-27501259 GAGAAGAGGGGGAGGAGGAGGGG - Intergenic
1188256462 X:27966991-27967013 AGGAAGAGGAAGAAGAGGAGGGG - Intergenic
1188661524 X:32765365-32765387 CAGAACAGGAGCAAGAGGGGTGG - Intronic
1189021820 X:37349365-37349387 CAGAACGGCGAGTAGCGGAGCGG + Exonic
1189615463 X:42778689-42778711 CAAGACAGGGAGAAGAGAGGAGG - Intergenic
1190291771 X:48997730-48997752 CAGAACAGGGAGAAGAGGAGGGG + Intronic
1190300597 X:49054824-49054846 CAGAACAGGAAGGAGTGTAGGGG - Intronic
1190590997 X:52000977-52000999 CAGAAGAGGGAGCATGGGAGGGG + Intergenic
1192232729 X:69277275-69277297 CAGTGTAAGGAGAAGAGGAGAGG + Intergenic
1192274429 X:69615789-69615811 CAGTACGGGGAGGAAAGGAGGGG - Intergenic
1192311716 X:70021643-70021665 AAGAACTGGGAGGAGAGGAGAGG + Intronic
1192359826 X:70432476-70432498 CAGGGATGGGAGAAGAGGAGAGG - Intronic
1193600490 X:83504254-83504276 CAGGACAGGGAGTAGCGGTGGGG - Intergenic
1194192675 X:90857176-90857198 CAGAGCAGGAGGAAGAGAAGGGG - Intergenic
1194192915 X:90858817-90858839 CAGAACAGGAGGAAGAAAAGGGG - Intergenic
1194468988 X:94268902-94268924 AAGAACAGTAACAAGAGGAGAGG - Intergenic
1194746736 X:97636461-97636483 CAGAAGAGAGAGGAGGGGAGGGG + Intergenic
1195234081 X:102879720-102879742 CAGAGAAGGGAGAAGAAGAGAGG - Intergenic
1195285887 X:103383303-103383325 CAGAACTGGGAGAAGTGGGTGGG - Intergenic
1195321052 X:103722358-103722380 CAGAACAGGCAGGAGAGAACAGG + Intronic
1195785086 X:108510633-108510655 TAGAACAGAGAGAAAAGGGGAGG + Intronic
1195814087 X:108866774-108866796 CAGAACAGGAGCAAGAGGTGAGG + Intergenic
1195930058 X:110065424-110065446 CAGTACACAGAGAAGAGGAAGGG - Intronic
1195938585 X:110147898-110147920 CTGAATAGGAAGAAGAGGAAAGG - Intronic
1195993906 X:110712294-110712316 GCGAATAGGTAGAAGAGGAGCGG + Intronic
1196237583 X:113300069-113300091 AAGTACAGAGAGAGGAGGAGGGG - Intergenic
1196324906 X:114391202-114391224 CAGAAGTTGGAGAAGAAGAGAGG + Intergenic
1196387434 X:115173795-115173817 CTGAAGAGGAGGAAGAGGAGGGG - Intronic
1196498098 X:116346425-116346447 CAGAGAAGGGGGAAGAGTAGGGG - Intergenic
1196684580 X:118499596-118499618 GGGAAGAGGGAGCAGAGGAGTGG - Intronic
1196693312 X:118583606-118583628 TAAAAATGGGAGAAGAGGAGGGG + Intronic
1196934205 X:120713423-120713445 CAGAACAGGAAGAAGAGAGAAGG - Intergenic
1196938439 X:120752483-120752505 TAGAACAGGGAGTTGAGGAAGGG + Intergenic
1197158965 X:123302415-123302437 AAGACCAGGGAGGAGAGAAGTGG - Intronic
1197250284 X:124208932-124208954 TAAAGGAGGGAGAAGAGGAGGGG + Intronic
1197297690 X:124739100-124739122 CAGCACAGTGGAAAGAGGAGAGG + Intronic
1197524649 X:127546667-127546689 CAGATAAGGAGGAAGAGGAGAGG - Intergenic
1197761365 X:130030688-130030710 AGGAACAGGGGGAAGGGGAGGGG - Intronic
1197972348 X:132128578-132128600 CAGAAAAGAGGGAACAGGAGTGG - Intergenic
1198242067 X:134796720-134796742 GAGAGGAGGGAGAAGAGGAGGGG + Intronic
1198467552 X:136917123-136917145 GAGGAGAAGGAGAAGAGGAGGGG - Intergenic
1199345541 X:146734410-146734432 CACAAAAGGGAGCAGAGAAGTGG + Intergenic
1199435133 X:147804552-147804574 CAGAAGAGGGAGGAGAAAAGGGG + Intergenic
1199714390 X:150495956-150495978 CAGGATAGAGAGAATAGGAGAGG - Intronic
1199795308 X:151190284-151190306 CAGAAAAGGCAGAAAAAGAGTGG + Intergenic
1200539303 Y:4439625-4439647 CAGAGCAGGAGGAAGAGAAGGGG - Intergenic
1200539539 Y:4441265-4441287 CAGAACAGGAGGAAGAAAAGGGG - Intergenic
1200734828 Y:6782916-6782938 CAGCACTGGGAGGAGAGCAGAGG + Intergenic
1200812712 Y:7502010-7502032 CAGCCCAGGGACAAGGGGAGAGG - Intergenic
1201065172 Y:10089825-10089847 CAGAAGAGCGAGAGGTGGAGGGG + Intergenic
1201110547 Y:10796201-10796223 CAGAATGGGGAGCAGTGGAGTGG - Intergenic
1201112183 Y:10807614-10807636 TGGAACAGGAAGAAAAGGAGTGG - Intergenic
1201114947 Y:10828321-10828343 TAGAACAGAGTGGAGAGGAGTGG - Intergenic
1201117420 Y:10845302-10845324 CAGATCAGAGTGAAGTGGAGAGG - Intergenic
1201117940 Y:10848851-10848873 CAAAACAGAGTGGAGAGGAGTGG - Intergenic
1201121970 Y:10880196-10880218 CAGAACAGAGCTGAGAGGAGTGG - Intergenic
1201122843 Y:10886340-10886362 CGGACCAGAGTGAAGAGGAGTGG - Intergenic
1201127683 Y:10929431-10929453 CAGAACAGGGTGGAGTGGAGTGG - Intergenic
1201224733 Y:11807871-11807893 GAGAAGATGGAGAGGAGGAGGGG - Intergenic
1201424069 Y:13830370-13830392 CAGAAAAAGGGAAAGAGGAGGGG - Intergenic
1201917899 Y:19202574-19202596 AAGAGAAGAGAGAAGAGGAGAGG - Intergenic