ID: 1190296312

View in Genome Browser
Species Human (GRCh38)
Location X:49029860-49029882
Sequence AGCCTCACCCCTGCCCCTGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 333}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190296312_1190296318 -4 Left 1190296312 X:49029860-49029882 CCCACAGGGGCAGGGGTGAGGCT 0: 1
1: 0
2: 3
3: 31
4: 333
Right 1190296318 X:49029879-49029901 GGCTGTGATCCCCAGGGGGCAGG 0: 1
1: 1
2: 4
3: 38
4: 363
1190296312_1190296315 -10 Left 1190296312 X:49029860-49029882 CCCACAGGGGCAGGGGTGAGGCT 0: 1
1: 0
2: 3
3: 31
4: 333
Right 1190296315 X:49029873-49029895 GGGTGAGGCTGTGATCCCCAGGG 0: 1
1: 0
2: 2
3: 24
4: 234
1190296312_1190296317 -8 Left 1190296312 X:49029860-49029882 CCCACAGGGGCAGGGGTGAGGCT 0: 1
1: 0
2: 3
3: 31
4: 333
Right 1190296317 X:49029875-49029897 GTGAGGCTGTGATCCCCAGGGGG 0: 1
1: 0
2: 2
3: 19
4: 217
1190296312_1190296316 -9 Left 1190296312 X:49029860-49029882 CCCACAGGGGCAGGGGTGAGGCT 0: 1
1: 0
2: 3
3: 31
4: 333
Right 1190296316 X:49029874-49029896 GGTGAGGCTGTGATCCCCAGGGG 0: 1
1: 0
2: 5
3: 23
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190296312 Original CRISPR AGCCTCACCCCTGCCCCTGT GGG (reversed) Exonic
900102376 1:967376-967398 ACCCCCCCCCCAGCCCCTGTGGG + Intronic
900428898 1:2592770-2592792 AGCCCCAGCCCTGGCCCTGAGGG - Intronic
900754783 1:4426029-4426051 AGCCCCACCCCTTCCCGTGCTGG + Intergenic
900970001 1:5986747-5986769 CGCCCCACCCCTACCCCCGTGGG + Intronic
901638401 1:10680860-10680882 GGCCCCAGCCCTGCCCCAGTGGG - Intronic
901824415 1:11851343-11851365 AGGCTCACTCCTGCAGCTGTTGG + Intergenic
902918616 1:19653445-19653467 AGCCTCATCCAGGCCCCTCTAGG + Intronic
903181409 1:21606793-21606815 GGGCTCACCCCTGCCTCAGTTGG - Intronic
903332275 1:22602278-22602300 AGCCTCTCCCCCGCCCCCATGGG - Exonic
903739989 1:25553088-25553110 AGCCTCCCACATGCCCCTGTTGG + Intronic
904022233 1:27475897-27475919 GGCCTCACGCCTCCCCATGTGGG + Intronic
904238862 1:29131232-29131254 AGCATCCCCCCTCCCTCTGTGGG - Intergenic
904363123 1:29991310-29991332 CGCCTGGCCCCTGTCCCTGTCGG + Intergenic
904424610 1:30415395-30415417 GGCCTCACTACTGCCCCTGTGGG - Intergenic
904623536 1:31789470-31789492 GGCCTCACCCTGGCCCCTGCTGG - Intergenic
907593068 1:55694152-55694174 AGCCTCATCCATGCCCTTGCCGG - Intergenic
907815101 1:57910934-57910956 AGCCTCACATCTGCCCCTGTAGG - Intronic
909227686 1:73045713-73045735 AGACTCACTCCTGTCCCAGTTGG - Intergenic
909967274 1:81930773-81930795 ACCCTCACCCCCACACCTGTAGG + Intronic
912379506 1:109239783-109239805 AGCCTTCCTCCTGCCCGTGTAGG + Intergenic
912460986 1:109831378-109831400 AGCCTCAAAGCTGCCCTTGTAGG + Intergenic
912754663 1:112314171-112314193 AGCCTGACCCCAGACCCTGAGGG - Intergenic
913020083 1:114780614-114780636 AGCACCACCCCAGCCCCTGCCGG + Exonic
913077833 1:115356278-115356300 GGCTTCACCCCTGAGCCTGTGGG - Intergenic
913161807 1:116152095-116152117 AGCCTCAGCCCTGCGCGAGTCGG - Intergenic
915722926 1:157997003-157997025 AGCCCCACCTCTGCCCCCCTAGG + Intronic
917390429 1:174530301-174530323 AGCTTCAGCCCTGGCACTGTTGG + Intronic
917853792 1:179085900-179085922 GGCCTCACCCCAGCCCTGGTCGG - Intronic
917978852 1:180256943-180256965 AACCACACACCTGCCCTTGTAGG - Intronic
918417670 1:184328927-184328949 AGCCTCACTCCTGGCTCTGGAGG + Intergenic
919112761 1:193241478-193241500 AGGCTCACCACTGCCACTGCTGG - Intronic
920531536 1:206706198-206706220 AGACTAACTCCTGTCCCTGTGGG - Intronic
921812318 1:219529195-219529217 TCACTCACCCCTGACCCTGTGGG + Intergenic
922619775 1:226982553-226982575 GGCCTCACCCGTGCTCCTGGTGG + Intronic
922675184 1:227545148-227545170 AGACTCTCCCCTGAGCCTGTGGG + Intergenic
922804239 1:228377424-228377446 AGTCTCAGCCCTGGCCCTGGTGG + Intronic
924607830 1:245550551-245550573 AGCCTAACCACTGCGCCGGTGGG - Intronic
1063958754 10:11288617-11288639 AGCCTCACCCTCGCACCTGGAGG - Intronic
1066165824 10:32787868-32787890 AGCTTCAGGCCTGCCCCTGAAGG + Intronic
1067060420 10:43075466-43075488 AGCCCCACCCCTGCACCTCCCGG - Intergenic
1067064181 10:43094338-43094360 AGCCCCACGCCTGCCCTTGATGG - Intronic
1067427772 10:46222535-46222557 TGCCTCACCCCTTCCACTGTGGG - Intergenic
1067433893 10:46264133-46264155 GGCCCTGCCCCTGCCCCTGTGGG - Intergenic
1067523809 10:47026695-47026717 ATCCTCACTCCGGTCCCTGTGGG - Intergenic
1069798847 10:71070072-71070094 GGCCTGACCCCTGCCTCTGCAGG - Intergenic
1070443088 10:76465816-76465838 GGCCTCTCCCCTCCCCTTGTAGG + Intronic
1070827669 10:79400713-79400735 GGCCACACTCCTGCCCCTGCAGG + Intronic
1070968343 10:80543486-80543508 AGCCTACCCCCTGCCTCCGTGGG + Intronic
1071278084 10:84075083-84075105 AGCTTCACCTCTGCCCCATTTGG + Intergenic
1071562292 10:86653665-86653687 AGCCTCACCCTTGTCACAGTGGG - Intergenic
1072430940 10:95369944-95369966 AGCCTAACCCCTGGCCCTGCTGG + Intronic
1072541615 10:96402603-96402625 ATCCTCCGCCCTGCCACTGTGGG + Intronic
1072936336 10:99717130-99717152 TGCCTCAGCCCAGCCCCCGTTGG + Intronic
1073008544 10:100342539-100342561 AGCCCCACACCTCCCTCTGTTGG - Intergenic
1073183808 10:101603083-101603105 ACCCTCAGCCCTGCCCCTCCAGG - Intronic
1073459824 10:103660212-103660234 AGTCCCAGCCCTGGCCCTGTTGG + Intronic
1074703166 10:116109930-116109952 ATCCTCACCCCTGCCTGTGGAGG - Intronic
1075383782 10:122039972-122039994 AGCCTCAGCCCAGCCCCTTGTGG + Intronic
1075670075 10:124258343-124258365 GGCATCACCCCAGCCACTGTTGG - Intergenic
1075874244 10:125793375-125793397 TGCCTCTCCCCTGGGCCTGTAGG - Intronic
1076058508 10:127394927-127394949 GGCATCACTCCTGCACCTGTGGG - Intronic
1076693335 10:132234867-132234889 AGCTTCCCACCTGCCCCGGTGGG - Intronic
1076917169 10:133430063-133430085 GGCCTCTCCCCTGACCCTCTCGG - Intergenic
1076937264 10:133574822-133574844 GGCCTCTCCCCTGACCCTCTCGG - Intergenic
1077551460 11:3202312-3202334 AGCCCCCCACCTGTCCCTGTAGG - Intergenic
1078091607 11:8267940-8267962 ACCCTCACCCCTGCACCTGCAGG + Intronic
1080707101 11:34706822-34706844 AGGTTCACCCCAGCCCCAGTTGG - Intergenic
1083174675 11:60942149-60942171 AGCCTCACCCCTGTCTCTCTTGG - Intronic
1083901267 11:65644613-65644635 ACCCCCACCCCAGCCCCTGCAGG - Intronic
1083932838 11:65855280-65855302 AGCCCCACACCTGCCCTTGGGGG - Exonic
1084178161 11:67434073-67434095 AGACTCAGCCCTACCCCTGGTGG - Intronic
1084574712 11:69981712-69981734 AGCCCCACCCCAGCCCCTGCAGG + Intergenic
1085410409 11:76287437-76287459 AGCCTCCGCCCTGCCCCAGGAGG - Intergenic
1089050337 11:115540007-115540029 AGCCAAACCTCTGTCCCTGTAGG + Intergenic
1089062083 11:115633980-115634002 AGCCTCCCCCCACCCTCTGTGGG - Intergenic
1089116457 11:116099169-116099191 ATCCTCCCCCCTACCCCAGTAGG + Intergenic
1089255553 11:117192220-117192242 ACCCTCACCGCTGCCCTTGGTGG + Intronic
1089519475 11:119054352-119054374 AGCCTCCTCCCAGCCCCTGTTGG - Intronic
1089648327 11:119894943-119894965 AGCCCCACCCCGACCCTTGTGGG + Intergenic
1089683819 11:120134324-120134346 AGCCTCAGACCTGCCTCGGTTGG - Intronic
1090239320 11:125170957-125170979 AGCCTCCCCCCTCCCCCACTGGG - Intronic
1090255208 11:125279043-125279065 AGCCAGACACATGCCCCTGTTGG - Intronic
1090383526 11:126343405-126343427 AGCCACTCACCTGCCCCTGGTGG - Exonic
1090787052 11:130058676-130058698 TGCCTGATCCCTGCCCCTTTAGG + Intergenic
1090959511 11:131543626-131543648 AGCCTCTCCCCAGCTCATGTGGG - Intronic
1091235422 11:134019099-134019121 AGCCAGGCCCCTTCCCCTGTAGG - Intergenic
1094332800 12:29314604-29314626 AGCCTCACCCCTCCCCTTCCTGG + Intronic
1096558067 12:52415982-52416004 AGCCTCAGCCCTGCTGTTGTTGG + Intergenic
1096560534 12:52433082-52433104 AGCTTCAAGCCTGCCCCTCTCGG + Exonic
1096612065 12:52808707-52808729 AGCCTCAGCCTTGCTCCTCTGGG + Exonic
1097146077 12:56940177-56940199 ACTCACACCCCTGCCCCTGCTGG - Intergenic
1097151794 12:56984654-56984676 ACTCACACCCCTGCCCCTGCTGG - Intergenic
1097170657 12:57110877-57110899 AGCCTCACCCCTGCACCCCCAGG - Intronic
1097233848 12:57527011-57527033 TGCCTCTTTCCTGCCCCTGTTGG + Exonic
1102987243 12:117288259-117288281 AGCCTAACACCTGCCACTCTTGG - Intronic
1103535489 12:121630867-121630889 AGCCTGACCCCGTCCCCTGCAGG + Intronic
1103727435 12:123005054-123005076 AGCCTGGGCCCTGCCCCAGTGGG - Intronic
1104051680 12:125198833-125198855 TGCCTCCCTCCTGCCCCTGGAGG + Intronic
1105923230 13:24984138-24984160 AGACTGAGCCCTCCCCCTGTGGG + Intergenic
1106104238 13:26719728-26719750 AGCCTCAGCTCTGGCCCTGCCGG + Intergenic
1106256595 13:28027815-28027837 AGCCTGGCCACTGCCCCAGTTGG - Intronic
1106992513 13:35439101-35439123 ACTCCTACCCCTGCCCCTGTTGG - Intronic
1107427202 13:40306093-40306115 AGGCTCAAACTTGCCCCTGTTGG + Intergenic
1107482607 13:40797220-40797242 AGCCTCCCCCTTCTCCCTGTTGG + Intronic
1109563358 13:64078675-64078697 AGAATCCCCCCTGCCCCCGTAGG - Intergenic
1110612488 13:77504452-77504474 AGCCTCATACCTGACCCTATGGG - Intergenic
1110730842 13:78877090-78877112 AGCCTCTCTCCTGCACTTGTAGG + Intergenic
1112734408 13:102400720-102400742 ATCCCCACCCCTGGCCCTGTGGG + Intronic
1119663040 14:76465157-76465179 CATCTCACCCCAGCCCCTGTAGG - Intronic
1122308705 14:100781245-100781267 AGCCTCACACCCTCCCCTCTGGG - Intergenic
1122312587 14:100806556-100806578 AGCACCACCCCTGCCCCAGGCGG - Intergenic
1122662604 14:103308035-103308057 AGCGTCACCACTGGCTCTGTGGG - Intergenic
1123039319 14:105483926-105483948 TGCCGCACCCCAGCCCCTGTGGG + Intergenic
1125555667 15:40582690-40582712 TGCCTCACCCCCACCCCTTTGGG - Intergenic
1125647259 15:41283097-41283119 GGCCTGACACCTGCCCCTCTGGG + Intergenic
1125966758 15:43881053-43881075 AGCCTCAGCCCTCCCTCTTTTGG + Intronic
1128812197 15:70580808-70580830 TGCCACACCCCTGCTCCTGGTGG - Intergenic
1129097246 15:73222066-73222088 ATCTTCACTCCTCCCCCTGTTGG + Intronic
1129166416 15:73780743-73780765 AGCTTCCCCCCTGCCTCTGCTGG - Intergenic
1129468528 15:75737853-75737875 AGCCTGGCCTCTGCTCCTGTGGG + Intergenic
1129727052 15:77906654-77906676 AGCCTGGCCTCTGCTCCTGTGGG - Intergenic
1130528219 15:84725156-84725178 AGCCTCACCCCTCACCCTGGAGG + Intergenic
1131087540 15:89589342-89589364 ACCCCCACTCCTGCCCATGTCGG + Intronic
1131262615 15:90895540-90895562 AGCCTCACCGATGCCGCTTTCGG - Exonic
1131494928 15:92900119-92900141 GCCCTCCCCCCTCCCCCTGTTGG + Exonic
1131992355 15:98104353-98104375 AGCCTCCCCCCTCTCTCTGTGGG - Intergenic
1132432412 15:101772522-101772544 TGCCCCACCCCTGCCCTTCTTGG + Intergenic
1132597988 16:761948-761970 AGCCCCACCCCTACCCCAGGAGG + Intronic
1132690862 16:1181235-1181257 GGCCTCACCCTTGCCCATCTTGG - Intronic
1133388833 16:5392791-5392813 ACACTCGCCCCTGACCCTGTGGG + Intergenic
1133758345 16:8779122-8779144 AGTCTCACCACGGCCCCAGTGGG + Intronic
1133838500 16:9387498-9387520 AGCCCCACCCCTGAACCTCTAGG + Intergenic
1134446279 16:14333643-14333665 ACACCCACCCCCGCCCCTGTGGG - Intergenic
1134565439 16:15247820-15247842 ATCCTCCTCCCTGCCCCTGCGGG + Intergenic
1134737057 16:16508878-16508900 ATCCTCCTCCCTGCCCCTGCGGG - Intergenic
1134863630 16:17584628-17584650 TGCCTCAGCCCTGCCTGTGTGGG - Intergenic
1134930463 16:18203286-18203308 ATCCTCCTCCCTGCCCCTGCGGG + Intergenic
1136209415 16:28747092-28747114 ACCATCGCCCCTGCCCCTGGCGG - Intergenic
1136508679 16:30722697-30722719 AGCACCACCCCTGCCCCTACTGG + Exonic
1136989068 16:35140926-35140948 AGCCTCAGGCCTGCCCCAGATGG + Intergenic
1137573064 16:49579234-49579256 TGCCCCACCCCAGCCCCTGGTGG + Intronic
1137753833 16:50886120-50886142 CCCCTCACCCTTTCCCCTGTGGG - Intergenic
1137779596 16:51086851-51086873 AGCATCTCCCCTGGGCCTGTCGG + Intergenic
1138807895 16:60112819-60112841 AACCTCACACTTGCCCCTGGTGG - Intergenic
1139381107 16:66531560-66531582 AGCCCCAACCCTGCCTGTGTAGG - Intronic
1140128343 16:72136398-72136420 GGCCTCACACCTGCCCCATTGGG + Intronic
1140545573 16:75805707-75805729 AGCCTCACCCCACCTCCTCTTGG + Intergenic
1140679364 16:77369071-77369093 AGCCTCACCCAGGAACCTGTGGG + Intronic
1141151844 16:81569752-81569774 AGCTTCACCACTGCCCAGGTGGG + Intronic
1141595043 16:85092228-85092250 GGCATCACACCTGCCTCTGTTGG + Exonic
1141672997 16:85502662-85502684 AGCCTTGCCTCTGACCCTGTAGG - Intergenic
1141681475 16:85546818-85546840 ACTGTCACCCCTGGCCCTGTGGG + Intergenic
1143371098 17:6439980-6440002 AGCATCACCCTTGCCTCCGTTGG - Intergenic
1143496948 17:7317835-7317857 AGGCTCCCCTCTGCGCCTGTGGG + Exonic
1143623377 17:8093998-8094020 AGCCTCACCCTCACCCCTGGTGG + Intergenic
1145202269 17:20956976-20956998 AGCCTCAGCCAGGCTCCTGTAGG - Intergenic
1146791108 17:35751065-35751087 AGTCTCACCCCTGCCACCTTTGG + Intronic
1146816281 17:35944598-35944620 AGCCTCCCCTCTGCCCCTGCAGG - Intergenic
1147428301 17:40356629-40356651 AACCTCCCCCCTGCCTCGGTTGG + Exonic
1147551292 17:41444064-41444086 AGCCTCACACCTGCCTCTGATGG + Intergenic
1148480330 17:47955834-47955856 AGCCCCACCACTGCCCATTTGGG + Intronic
1150006805 17:61475103-61475125 TGGCTCCCACCTGCCCCTGTAGG + Intronic
1152855342 17:82662492-82662514 AGCCCAACCCCAGCCCCAGTGGG + Intronic
1152899638 17:82933012-82933034 AGGCCCACCCCTGGCCCGGTGGG - Intronic
1153512836 18:5874079-5874101 AGCCTCATCACAGCCCCTGTGGG - Intergenic
1154024976 18:10698435-10698457 TGCCTCACAGCTGCCCCTCTTGG - Intronic
1154341302 18:13504764-13504786 AGCCACACCCATGCCTCTCTCGG - Intronic
1154502118 18:15002255-15002277 GGCCTCTCCCCAGCCCCTATTGG + Intergenic
1156448430 18:37253534-37253556 TCCCTCACTCCTGCCCCTGGTGG + Intronic
1157200287 18:45653842-45653864 AGCCTGTGCCCTGCCCCTATGGG + Intronic
1157298455 18:46462505-46462527 AGCCTCAACTCTGCCCCAGCTGG + Exonic
1158131126 18:54153696-54153718 ATCCTCACCCCCACCCCAGTTGG + Exonic
1160835736 19:1123701-1123723 AGCCTGGCCCCTGCCCCTGGGGG - Intronic
1160871306 19:1279099-1279121 TGCCTCTCTCCTGCCCCCGTGGG + Exonic
1160919402 19:1512844-1512866 AGGCTCTCCCCTCCCCGTGTGGG + Intronic
1160949062 19:1657105-1657127 AGCCTCACACCTCCTGCTGTAGG + Intergenic
1160988567 19:1851456-1851478 AGCCTCACCCCTCTCTCTGACGG - Intergenic
1161069850 19:2254534-2254556 ACCCTCTCCCCTGGCCCTGCTGG + Intronic
1161621070 19:5297468-5297490 ACCAGCACTCCTGCCCCTGTTGG + Intronic
1162270390 19:9609892-9609914 AGATTGACCCCAGCCCCTGTTGG - Exonic
1162283892 19:9723341-9723363 AGATTGACCCCAGCCCCTGTTGG - Intergenic
1162444230 19:10712614-10712636 AGCCTCACCGCTGTCCGTGTGGG - Exonic
1162736518 19:12750046-12750068 AGCCTGCCCCCAGCCCCTGCGGG + Intergenic
1163221035 19:15921413-15921435 AGCCTCATCCCTGCCCATGTGGG + Intronic
1163725769 19:18922295-18922317 ACCCTCACCCCTGCCCCCATTGG + Intronic
1163763446 19:19149442-19149464 CTTCTCTCCCCTGCCCCTGTGGG - Intronic
1165153636 19:33774810-33774832 AGCCTTCCTCCTGCCCCTTTGGG + Intergenic
1165153666 19:33774919-33774941 AGCCTCTTCCCTGCCCCTCTGGG - Intergenic
1165266958 19:34668424-34668446 AGCCTCTCCCCCTCCTCTGTGGG + Intronic
1165596390 19:37013834-37013856 AAACTCACCCCTGGCCCTGTTGG - Intronic
1167101136 19:47404860-47404882 AGCCTCAGCCCTGCCCTCATGGG - Intronic
1167161017 19:47767102-47767124 CGCCTCACCCCTCCTCTTGTTGG + Intergenic
1167425615 19:49428349-49428371 AGCCCCGCCCCTGCCCCTCCAGG + Intronic
1168414809 19:56161093-56161115 AGCCTCATCCCTGCCTCCGTAGG - Intergenic
925777014 2:7345724-7345746 ATCCTCACCCCTGCCACATTGGG - Intergenic
925969270 2:9095713-9095735 TGCCACCACCCTGCCCCTGTCGG + Intergenic
928945764 2:36770585-36770607 AGCCTCCTTCCTGCACCTGTAGG - Intronic
931516211 2:63051881-63051903 AGCCTCGCCCCCGCCGCTGCCGG - Intronic
932818120 2:74877812-74877834 ATCCTCACTCTTGCCCCTGCTGG - Intronic
934610282 2:95730379-95730401 AACCTCACCCCAGACCCTCTGGG - Intergenic
934935284 2:98460789-98460811 AGCTTCACCCCTGACCCCATGGG - Intronic
934992729 2:98932951-98932973 AGCCCCACCCCTGCTCCTCCAGG - Intronic
936059866 2:109287544-109287566 ACCCTCCCCCTTGACCCTGTTGG + Intronic
936261415 2:110962551-110962573 AGCATCAGTCCTGCTCCTGTGGG - Intronic
936543611 2:113371965-113371987 AACCTCACCCCAGACCCTCTGGG - Intergenic
937365374 2:121257319-121257341 AGCCCCACCCCTCCCCCGGGAGG - Intronic
938501296 2:131832427-131832449 GGCCTCTCCCCAGCCCCTATCGG + Intergenic
939843811 2:147220164-147220186 AGGCTCAAACATGCCCCTGTTGG + Intergenic
940143511 2:150521710-150521732 AGCCTCAACCTTGCCCCGGTGGG - Intronic
942924965 2:181420690-181420712 ATCCTCATCCGGGCCCCTGTAGG + Intergenic
943520587 2:188944522-188944544 AGCCTCGCCCCACCCACTGTGGG - Intergenic
946071027 2:217034578-217034600 ACACTCTCCCCTGCTCCTGTAGG + Intergenic
947852279 2:233298013-233298035 AGTGTCACGCCTGTCCCTGTGGG - Intergenic
947922415 2:233888739-233888761 AGCCTCAACCCTGCCTCCTTTGG - Intergenic
947971559 2:234329200-234329222 AGCCTCAACCCAGGCACTGTAGG + Intergenic
948896283 2:240929307-240929329 AGCCCCACCCCTGCTCCTCCAGG - Intronic
948918779 2:241051867-241051889 GCCCTCCCCCCTGCCCCTGGGGG - Intronic
1169210701 20:3764860-3764882 TGCCTCACCCCTGCCCTGGGGGG + Intronic
1169363111 20:4968333-4968355 AGCCTAACCCCAGCACCTGGAGG + Intronic
1170602321 20:17850226-17850248 GGCCTCACCCCTGCATCTGGAGG + Intergenic
1170823075 20:19770835-19770857 AGACTCAGCCCTCACCCTGTGGG - Intergenic
1170856638 20:20062175-20062197 AGGCACACCCCAGCCCCTTTGGG + Intronic
1171300248 20:24053321-24053343 AGCCCCACCCCTGCCCCAGCAGG - Intergenic
1171420785 20:25016127-25016149 AGACTCACCAGTGCCGCTGTGGG - Intronic
1172096065 20:32461071-32461093 AGCAGCACCTCTGCCCCTGTTGG - Intronic
1172835249 20:37869265-37869287 AGCCCCACCCCTGCCAATGCTGG - Intronic
1173637832 20:44576575-44576597 AGCCTCAAACCTTCTCCTGTTGG + Intronic
1175392290 20:58635106-58635128 TGCCTCACACCTGCTGCTGTGGG + Intergenic
1175653917 20:60752376-60752398 AGGCTCAGTCTTGCCCCTGTGGG - Intergenic
1175739675 20:61411900-61411922 GGCCTCACCCAGTCCCCTGTTGG - Intronic
1175784444 20:61703713-61703735 AGCCTCAACCCTGCCCCGAGTGG - Intronic
1179354788 21:40649253-40649275 AGCCTCAGCCCCCACCCTGTTGG + Intronic
1179791186 21:43756991-43757013 TGCCTGCCCCCTGCCCCTGCTGG + Exonic
1180157897 21:45986860-45986882 AGCCTCCCCTCTGGCCCTGTGGG + Intronic
1181050172 22:20234597-20234619 AGCCACAGCCCTACCCCTCTAGG - Intergenic
1181084007 22:20430946-20430968 CGCCTCACCCCTGTCCCCATCGG + Intronic
1181162427 22:20966433-20966455 TGCCTGGCCCCTGCGCCTGTCGG - Intronic
1181560579 22:23697357-23697379 AGCCTCACAGCTGCTCCTGTGGG + Intronic
1181769820 22:25117287-25117309 AACCACACAGCTGCCCCTGTGGG + Intronic
1182441397 22:30366325-30366347 AACATCACCCCTGCCTCTGGAGG - Intronic
1182453620 22:30435673-30435695 AGTCTCCTCCCTGCCCCTGCTGG + Intergenic
1182479417 22:30597137-30597159 AGTCTCCTCCCTGCCGCTGTGGG + Intronic
1183187239 22:36299268-36299290 AGCCCTTCCCCTTCCCCTGTGGG + Intronic
1183361349 22:37384794-37384816 CGCCTCCCCCCGGCCCCTGCTGG + Intronic
1183964072 22:41430889-41430911 AGCCTCTTCCCTGACCCTGACGG + Intergenic
1184564797 22:45285470-45285492 AGCCTCACCCCTTCCCCCACAGG - Intronic
1184646248 22:45896994-45897016 TGCCTCACCCCAGCCCCTGATGG + Intergenic
1185089530 22:48757896-48757918 AGCCTGACCCCAGCCCCACTGGG + Intronic
950189917 3:10969577-10969599 AACCTCAGCCCTGCCCATATGGG + Intergenic
950450127 3:13060703-13060725 AGCATCAGCCCTGCCCCCGGCGG + Intronic
950641466 3:14351230-14351252 AGCCACAGCCCTAGCCCTGTGGG - Intergenic
953177773 3:40567513-40567535 AGGCTCAAACTTGCCCCTGTTGG + Intronic
953533034 3:43755378-43755400 AGCCTCACCCCTGCACAGGGAGG - Intergenic
954137308 3:48587936-48587958 ACCCTCACGCCTGCCCCAGGTGG - Exonic
954163589 3:48739141-48739163 AGCCCCACCTCTGCCCGAGTGGG - Intronic
954378869 3:50209093-50209115 AGGGTCTCCCCTGCCCCTGGGGG + Intronic
954701153 3:52451574-52451596 AGCCCCACCCATGCCCCAGGAGG + Intronic
960421146 3:117447157-117447179 AGCCTTGACACTGCCCCTGTTGG + Intergenic
961377532 3:126476271-126476293 AGCCTCACCCCGTCCCCTGTCGG - Intergenic
961482414 3:127192736-127192758 GGCCTCCCCTCTGGCCCTGTGGG + Intergenic
961571783 3:127804459-127804481 AGGCTCACTCATTCCCCTGTAGG - Intronic
962350415 3:134651837-134651859 AGCCAAACCCCTGCTGCTGTTGG - Intronic
963106158 3:141648912-141648934 GGCTTCATCCCAGCCCCTGTTGG - Intergenic
966028718 3:175319082-175319104 ATCCTCACCCCCACCCATGTGGG - Intronic
967828951 3:193902469-193902491 AGCCTCCCTCCTGCTCCTGCTGG + Intergenic
967929879 3:194683229-194683251 AGACTCCTCCCTGCCTCTGTGGG + Intergenic
969316532 4:6384754-6384776 AACCTCACGCCAGCCCCTGCGGG + Intronic
972557194 4:40193430-40193452 CCCCTCACCACTACCCCTGTCGG + Intronic
975609094 4:76186259-76186281 CGCCCCACCGCTGCCTCTGTTGG - Intronic
977658023 4:99546076-99546098 AGCCTTGCCACTGCCACTGTTGG - Intergenic
979349517 4:119628271-119628293 ACCCTCACCCCCGACCCTCTTGG - Intronic
983562664 4:169116543-169116565 GGCCTCAGCCCTGCATCTGTGGG - Exonic
984791571 4:183619584-183619606 AACCTCCCCCCTCCCCCTGCAGG - Intergenic
984908288 4:184649492-184649514 CGCCTCCCGCCCGCCCCTGTCGG + Intronic
985122776 4:186660615-186660637 AGCCACACCCCAGCCCCGGCGGG - Intronic
985571123 5:645874-645896 AGCGTCACTCCTGCTCCCGTCGG + Intronic
985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG + Intronic
985630743 5:1012745-1012767 AGCCCCACCCCTGCCTCTGGGGG - Intronic
985725550 5:1514122-1514144 AGCCTCTCCCCAGCCGCTGGTGG - Intronic
985819546 5:2150274-2150296 GCCCTCACCACTACCCCTGTGGG + Intergenic
985941302 5:3138527-3138549 AGCCTCACATCCGCCTCTGTGGG - Intergenic
987090305 5:14503953-14503975 TGCCTCAGCCTCGCCCCTGTGGG - Intronic
991621748 5:68551906-68551928 TGACTCACCCCTCCACCTGTGGG + Intergenic
993375902 5:87149385-87149407 AGCTTCCCCCCTCCCCCTGGGGG + Intergenic
993877688 5:93327385-93327407 AGCCTCCTCCCTTTCCCTGTAGG - Intergenic
994450095 5:99930098-99930120 AGCCTCACCCCTTCCCAATTGGG - Intergenic
995625896 5:114076254-114076276 AGCAGCACACCTGCCCCTTTGGG - Intergenic
996112893 5:119585742-119585764 AGTTTCAATCCTGCCCCTGTGGG - Intronic
996195850 5:120606000-120606022 TGCATCCCCCCTGCCTCTGTTGG - Intronic
997739141 5:136238473-136238495 TGCCTCAGACCTGCCCCTGCTGG + Intronic
997891855 5:137683995-137684017 TGCCTCACTCCTGCCTCTCTTGG - Intronic
999286916 5:150399609-150399631 AGCCTCACCACTGGCCCAGGAGG - Intronic
999758440 5:154682582-154682604 GGACCCACCCCTGCCTCTGTGGG - Intergenic
1001092731 5:168753098-168753120 ATCCCCACCCCTCTCCCTGTAGG - Exonic
1001242387 5:170080486-170080508 GGCCTCTCCCCTGTCCCTGCTGG - Intronic
1002102978 5:176866487-176866509 AGCCTCACCCATGGCCCAGGCGG - Intronic
1002312043 5:178320708-178320730 GGCCTCAGCCCTGGCCCTGGGGG - Intronic
1002397717 5:178971141-178971163 AGCCTCTCCTCTGCCTCTTTTGG - Intergenic
1002758056 6:179868-179890 AGCCTCCCCCCAGCCGCCGTGGG + Intergenic
1003224202 6:4189906-4189928 CTCCTCAGCCCTGCACCTGTCGG + Intergenic
1003604672 6:7548371-7548393 AGCCTCACCTCAGCCCCAGGAGG + Intronic
1004694295 6:18019762-18019784 AGCCTCCCCCCCGCCGCCGTGGG - Intergenic
1006937070 6:37725896-37725918 AGCCTCATTCCTGTCCCTGCAGG + Intergenic
1007271171 6:40638354-40638376 ACCCTGACCACTGCACCTGTTGG - Intergenic
1007593254 6:43036127-43036149 AGCCTCTGCCCTGCTGCTGTTGG - Intergenic
1008301375 6:49844625-49844647 AGCATCACCCATGGCTCTGTGGG - Intronic
1010029254 6:71256152-71256174 AGCCCCACCCCTATCCCTGTTGG - Intergenic
1010986842 6:82434622-82434644 AGGCTCATGCCTGGCCCTGTGGG - Intergenic
1011363972 6:86560154-86560176 ATCCTCACCACTGCCACAGTAGG + Intergenic
1017051547 6:150398289-150398311 AGCCTCTCGCCTGCTCCTCTTGG + Exonic
1018716067 6:166533522-166533544 AGGCACACCCCTGCCCTTGCTGG - Intronic
1018733335 6:166669454-166669476 TGCCTCACCCTCGCCTCTGTTGG + Intronic
1018935026 6:168268736-168268758 AGCCTAAGCCCTGCCCTTCTAGG - Intergenic
1019293622 7:262329-262351 CGCCTCCTCCCTGCCCCTCTGGG - Intergenic
1019448646 7:1084574-1084596 CGCCCCACCCTTGCCCCTGGTGG + Intronic
1019500139 7:1360624-1360646 GGCCTCAGCCCTGCACCTGCTGG + Intergenic
1019689845 7:2404246-2404268 AGCCGCAGCCCTGCCCCTCTGGG + Intronic
1020625495 7:10573686-10573708 AGCCTCAATCCTGAGCCTGTGGG + Intergenic
1021545398 7:21807558-21807580 AGTCTCTCCCCTGTCCCTCTGGG - Intronic
1021841203 7:24723187-24723209 AGCTTCCCCGCTGTCCCTGTGGG - Intronic
1022089997 7:27101962-27101984 TGCCTTGTCCCTGCCCCTGTGGG - Intronic
1028479251 7:91286660-91286682 AGCCCCTCTGCTGCCCCTGTTGG - Intergenic
1029311878 7:99674915-99674937 AGTTTCACCCCTGCCCTTGCAGG - Intronic
1031056500 7:116998083-116998105 AGCCTCCCCCCTGCCTCCATGGG - Intronic
1031327851 7:120424221-120424243 AGTCTCAACACTGCCACTGTTGG + Intronic
1032512341 7:132481868-132481890 TTCCTCACCCCTGGTCCTGTGGG + Intronic
1033121667 7:138671909-138671931 TGTCTCACCACTGCCACTGTTGG - Intronic
1035185816 7:157125315-157125337 ACTCTCACCCCTGCCCCTCCAGG + Intergenic
1036081331 8:5559665-5559687 TTTCTCACCCCTTCCCCTGTGGG - Intergenic
1037950276 8:23014981-23015003 AGCCTCATCCCTTCCCCACTTGG - Intronic
1038168506 8:25107570-25107592 AGCCTCATTCTTGCCCCTCTTGG - Intergenic
1038257642 8:25965410-25965432 AGACTCAGCCTTGCCCTTGTTGG - Intronic
1038804660 8:30779067-30779089 GCCCTCACCCCTTCCCCAGTTGG - Intronic
1040029875 8:42814501-42814523 ATCCCCACCCCTTCCCCTGCAGG - Intergenic
1040284149 8:46091526-46091548 AGCTTCACCCTTGCCCATGGAGG - Intergenic
1040567310 8:48579328-48579350 ACCATCAGCCCTGCCCATGTGGG - Intergenic
1040817451 8:51523768-51523790 AGGCTCACCCCTGGGCCTGAGGG - Intronic
1041049033 8:53915245-53915267 CTCCTCTCCCCTGCCACTGTTGG - Intronic
1041207532 8:55513409-55513431 AGCCTCACCCCTGACCATGCTGG - Intronic
1043572932 8:81625822-81625844 AGCCTCACTCCTGACTCTGATGG - Intergenic
1048469918 8:134696624-134696646 AGCCACAGCCCTGCCCAGGTGGG + Intronic
1049203671 8:141353585-141353607 GATCTCACCTCTGCCCCTGTGGG + Intergenic
1049368610 8:142252890-142252912 AGCCTCATACCTGCCCCACTAGG - Intronic
1049544151 8:143221722-143221744 GGCCTAACCCCTGCCCCAGGTGG - Intergenic
1049726069 8:144147150-144147172 AGACTCAGGCCTGCCCCTGGCGG + Intergenic
1049729365 8:144167964-144167986 AGCCTCATGCCTGCCTGTGTGGG + Intronic
1053512843 9:38703582-38703604 AGCTTCCCCTCTGGCCCTGTGGG + Intergenic
1057744018 9:97737358-97737380 AACCCCACCCCTGCCCTTCTTGG - Intergenic
1060794272 9:126503890-126503912 AGCAGCACCCCTGCCCCCGGTGG + Exonic
1061061271 9:128251456-128251478 AGCCTGGCCTCTGCTCCTGTGGG - Intronic
1061091430 9:128428659-128428681 AGCCTCATTCCTGCCCCCTTTGG - Intronic
1061176153 9:128998609-128998631 AGCCTCACCTCTTCCACTGCCGG - Exonic
1061888722 9:133606451-133606473 AGCCCCACCCTGGCCTCTGTAGG + Intergenic
1061893403 9:133634540-133634562 ACCCTCACCTCTGCCTCTGCTGG + Intergenic
1062027071 9:134345471-134345493 AGCCTCAGCCCTGGCCTTGGTGG + Intronic
1185642156 X:1594304-1594326 AGCCACACCCCTGAGGCTGTGGG + Intronic
1188943407 X:36266540-36266562 AACCTCACCACTGTCCCTATGGG - Intronic
1189700836 X:43715444-43715466 TGTCTCACCCCTGACCCTTTGGG - Intronic
1190296312 X:49029860-49029882 AGCCTCACCCCTGCCCCTGTGGG - Exonic
1190597182 X:52061685-52061707 AGCATCCCACCTGTCCCTGTGGG + Intergenic
1190611642 X:52192388-52192410 AGCATCCCACCTGTCCCTGTGGG - Intergenic
1192705544 X:73526082-73526104 AGCCTCACCCCGGGACCTGTAGG - Intergenic
1192727674 X:73769195-73769217 AGCCCCTCCCCTCCCTCTGTGGG - Intergenic
1195259341 X:103117197-103117219 AGCCTCACCCCCACCTCCGTGGG - Intergenic
1198522204 X:137464490-137464512 AACCTCTCCCCAGCCCCTGAGGG - Intergenic
1200009236 X:153108854-153108876 AGCATCGTCCCTGCCCCTGGGGG + Intergenic
1200030364 X:153291068-153291090 AGCATCGTCCCTGCCCCTGGGGG - Intergenic
1200038280 X:153347149-153347171 AGCCCCAGCCCGGCCCCAGTAGG + Exonic