ID: 1190302205

View in Genome Browser
Species Human (GRCh38)
Location X:49063658-49063680
Sequence GCCCAAACCCCTGGGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 189}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190302205_1190302222 27 Left 1190302205 X:49063658-49063680 CCCACCACCCCAGGGGTTTGGGC 0: 1
1: 0
2: 1
3: 12
4: 189
Right 1190302222 X:49063708-49063730 TGGAGATACTGGTAGGAGGGAGG 0: 1
1: 0
2: 3
3: 41
4: 322
1190302205_1190302218 20 Left 1190302205 X:49063658-49063680 CCCACCACCCCAGGGGTTTGGGC 0: 1
1: 0
2: 1
3: 12
4: 189
Right 1190302218 X:49063701-49063723 TGCCTAGTGGAGATACTGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 96
1190302205_1190302216 16 Left 1190302205 X:49063658-49063680 CCCACCACCCCAGGGGTTTGGGC 0: 1
1: 0
2: 1
3: 12
4: 189
Right 1190302216 X:49063697-49063719 CACCTGCCTAGTGGAGATACTGG 0: 1
1: 0
2: 0
3: 9
4: 97
1190302205_1190302224 29 Left 1190302205 X:49063658-49063680 CCCACCACCCCAGGGGTTTGGGC 0: 1
1: 0
2: 1
3: 12
4: 189
Right 1190302224 X:49063710-49063732 GAGATACTGGTAGGAGGGAGGGG 0: 1
1: 0
2: 3
3: 37
4: 401
1190302205_1190302212 -10 Left 1190302205 X:49063658-49063680 CCCACCACCCCAGGGGTTTGGGC 0: 1
1: 0
2: 1
3: 12
4: 189
Right 1190302212 X:49063671-49063693 GGGTTTGGGCCACTGAGGTTTGG 0: 1
1: 0
2: 2
3: 19
4: 215
1190302205_1190302215 7 Left 1190302205 X:49063658-49063680 CCCACCACCCCAGGGGTTTGGGC 0: 1
1: 0
2: 1
3: 12
4: 189
Right 1190302215 X:49063688-49063710 GTTTGGGCACACCTGCCTAGTGG 0: 1
1: 0
2: 0
3: 7
4: 73
1190302205_1190302220 23 Left 1190302205 X:49063658-49063680 CCCACCACCCCAGGGGTTTGGGC 0: 1
1: 0
2: 1
3: 12
4: 189
Right 1190302220 X:49063704-49063726 CTAGTGGAGATACTGGTAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 104
1190302205_1190302221 24 Left 1190302205 X:49063658-49063680 CCCACCACCCCAGGGGTTTGGGC 0: 1
1: 0
2: 1
3: 12
4: 189
Right 1190302221 X:49063705-49063727 TAGTGGAGATACTGGTAGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 142
1190302205_1190302223 28 Left 1190302205 X:49063658-49063680 CCCACCACCCCAGGGGTTTGGGC 0: 1
1: 0
2: 1
3: 12
4: 189
Right 1190302223 X:49063709-49063731 GGAGATACTGGTAGGAGGGAGGG 0: 1
1: 0
2: 2
3: 40
4: 432
1190302205_1190302213 -9 Left 1190302205 X:49063658-49063680 CCCACCACCCCAGGGGTTTGGGC 0: 1
1: 0
2: 1
3: 12
4: 189
Right 1190302213 X:49063672-49063694 GGTTTGGGCCACTGAGGTTTGGG 0: 1
1: 0
2: 2
3: 32
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190302205 Original CRISPR GCCCAAACCCCTGGGGTGGT GGG (reversed) Intronic
900013101 1:132750-132772 GCCCCAACCCCTGGGGATGGGGG + Intergenic
900043167 1:488737-488759 GCCCCAACCCCTGGGGATGGGGG + Intergenic
900064604 1:723734-723756 GCCCCAACCCCTGGGGATGGGGG + Intergenic
901842562 1:11963356-11963378 TCCCAAACCCCTGGACTGCTGGG - Intronic
901900471 1:12357521-12357543 GCCTAAACCATTGGGATGGTGGG - Intronic
902583756 1:17425707-17425729 GATCAGACACCTGGGGTGGTGGG + Intronic
902675847 1:18008088-18008110 CCCCACATCCCTGGGGTTGTGGG - Intergenic
904198659 1:28804865-28804887 GCCCCATCCACTAGGGTGGTGGG + Intergenic
904370754 1:30046053-30046075 GCCCAATCCCCTGGGGTGGCAGG + Intergenic
905401574 1:37707446-37707468 GGCCAAGCCTCTGGAGTGGTGGG + Intronic
905631853 1:39523138-39523160 GCCCAGCCCCCTGGGGTGGGAGG + Intronic
905665907 1:39763049-39763071 GCCCAGCCCCCTGGGGTGGGGGG - Intronic
907732856 1:57084861-57084883 CACCAAACCACTGAGGTGGTGGG + Intronic
916724467 1:167510436-167510458 GCCCAAGCCCCAGGGGTTGCAGG - Intronic
922809524 1:228407845-228407867 ACCTAAACCCCTGGGGGGGCTGG + Intergenic
1063196986 10:3752818-3752840 GGGCACAGCCCTGGGGTGGTGGG + Intergenic
1063971574 10:11384865-11384887 GCCCCAACCCCCTGGCTGGTGGG + Intergenic
1065804310 10:29380800-29380822 GCCCAGACTCCTGGGGAGGAGGG + Intergenic
1065944875 10:30597220-30597242 GCCCAGACTCCTGGGGAGGAGGG - Intergenic
1066362586 10:34745559-34745581 GCCCAAAGCCCTGGAGTGGGAGG - Intronic
1066598473 10:37077936-37077958 GCCTAAGAACCTGGGGTGGTTGG - Intergenic
1068718844 10:60219461-60219483 GCAAAAACCCCTGAGGTGGCGGG - Intronic
1068933029 10:62610878-62610900 CCCCAAACCCCCGGGCTGGCGGG - Intronic
1071564217 10:86663254-86663276 GCCCACATCCCTGGGGTTCTCGG + Intronic
1073115032 10:101087163-101087185 GCCCATTCCTCTGGGCTGGTGGG + Intergenic
1074449760 10:113549587-113549609 GCCCAAAGCCCTGGGATCGCAGG - Intergenic
1076698048 10:132256610-132256632 CCCCAAACCGCTGGAGAGGTGGG + Intronic
1076969438 11:124954-124976 GCCCCAACCCCTGGGGATGGGGG + Intergenic
1077636010 11:3841412-3841434 CCCCAGACCCCTGGGGAGGGTGG + Intergenic
1077848333 11:6049602-6049624 GCCCAAATCTTTGGGGTGGAAGG + Intergenic
1078616456 11:12870559-12870581 GCCCCAACCCCGGGGGGGGCGGG - Intronic
1080380208 11:31761780-31761802 GCCCAAATCCCTGGTCTGGGTGG - Intronic
1081774856 11:45670100-45670122 GCCAAGAACCCTGGGGTGGCTGG - Intergenic
1083160036 11:60849059-60849081 GCCCAGGCCCCTGGGGAGGAAGG - Intronic
1083756155 11:64792632-64792654 ACCCAAACCCCTGGCCTGGATGG - Intronic
1085269637 11:75262727-75262749 GCCCAAGCCCCCCAGGTGGTTGG + Intergenic
1085856557 11:80182017-80182039 CCCCAAAGCCATGGGGTGCTGGG + Intergenic
1086287340 11:85264687-85264709 GACTACACTCCTGGGGTGGTTGG - Intronic
1087789420 11:102391258-102391280 TCCCACACCCCTGAGCTGGTAGG + Intergenic
1088225853 11:107619112-107619134 ACCAAAACCACTGGGGTGGGGGG - Intronic
1088946312 11:114516890-114516912 GCCCCCATCCCTGGGGTGGGTGG + Intergenic
1091833480 12:3567649-3567671 CCCCTAACCCCTGTGGTAGTCGG - Intronic
1092246325 12:6866372-6866394 GCCCAGCCCCCTGGTGTGGAGGG + Exonic
1094589751 12:31809195-31809217 GTCCAGTCCCCTGGGGTTGTAGG - Intergenic
1096514011 12:52146581-52146603 GTCCAAACCCAAAGGGTGGTGGG - Intergenic
1103880516 12:124162622-124162644 ACCCACACATCTGGGGTGGTTGG - Intronic
1105407708 13:20145570-20145592 GCCCAGACGCCTGGGCAGGTAGG - Intronic
1105432570 13:20350555-20350577 GCCCAGACCCCTGGTGTTCTAGG - Intergenic
1109245415 13:59948717-59948739 TCCCAAAGCACTGGGGTTGTAGG + Intronic
1111638382 13:90934775-90934797 GACCAAACTCCTTGGTTGGTTGG - Intergenic
1112289986 13:98137724-98137746 ACCCAAAAGTCTGGGGTGGTTGG + Intergenic
1113694698 13:112336095-112336117 GCCCTGACACCTGGGGTGTTGGG - Intergenic
1116923139 14:50602733-50602755 GCCCAGAGCCCTGAGGTAGTTGG + Intronic
1118221076 14:63854518-63854540 GGCCAGCCCCCTGGGGCGGTGGG + Intronic
1119436433 14:74600614-74600636 GCCCAGACCCCTGGGGCAGCTGG + Intronic
1119638207 14:76293684-76293706 GACCAAATGCCTTGGGTGGTGGG - Intergenic
1119922045 14:78455435-78455457 GCGCAAGCCCCTGGGATGGAGGG - Intronic
1121825481 14:97006903-97006925 TCCCATACCCCTGGCCTGGTAGG - Intergenic
1122771214 14:104098740-104098762 GCCCAGACCCAGGGGGAGGTGGG - Intronic
1122772674 14:104104289-104104311 GCCCGAACCTGTGGGGCGGTGGG - Exonic
1128678213 15:69627374-69627396 GCCCAAAAACCTGGAGGGGTTGG - Intergenic
1129542622 15:76363318-76363340 GCCCAGAGCTCTGGTGTGGTAGG - Intronic
1129688975 15:77702435-77702457 CCCCAGGCCCCTGGGGTGGAGGG - Intronic
1129875614 15:78973603-78973625 GGCCAGTCCTCTGGGGTGGTGGG + Intronic
1132304648 15:100802462-100802484 GCCCTTACCCCCGGGGGGGTGGG - Intergenic
1132666059 16:1081838-1081860 ACCCAAATCCCTGGGGAGGCAGG - Intergenic
1132688842 16:1173305-1173327 GGCCAGAGCCCTGGGGTAGTGGG + Intronic
1135143322 16:19940139-19940161 GCCCAAACCTCCGGTGTGGAAGG + Intergenic
1136934143 16:34443310-34443332 GCCCATAACCCAGGGTTGGTAGG + Intergenic
1136970429 16:34968504-34968526 GCCCATAACCCAGGGTTGGTAGG - Intergenic
1138419385 16:56889381-56889403 GCCCAAACCCCAGTGGTGGGCGG + Intronic
1139413549 16:66786881-66786903 GCCCAAACCCCCAGGGTGTTGGG - Intronic
1140701706 16:77587350-77587372 GCCAGATCCCCTGGGGTGGCGGG - Intergenic
1141630879 16:85287343-85287365 CCACAAAACCCTGGGGTGGCTGG - Intergenic
1141982826 16:87560735-87560757 GCCCCAACCCCAGGGGACGTGGG - Intergenic
1142159297 16:88548331-88548353 GCCCAGACCACAGGGCTGGTGGG - Intergenic
1144163000 17:12580272-12580294 GCCCCAACCCCTGGGCAGGTGGG + Intergenic
1144588302 17:16502429-16502451 GAACAATTCCCTGGGGTGGTTGG - Intergenic
1145007928 17:19347981-19348003 GCTCAAAACTCTGGGGTGGCAGG + Intronic
1146030745 17:29364044-29364066 GCCCTAACCCCTAATGTGGTGGG - Intergenic
1147263099 17:39220060-39220082 GGCCAAAGCCCTGGGGTGTCTGG + Intronic
1148081598 17:44970111-44970133 GCCCAAAGCCCAGGGGTAGGGGG + Intergenic
1148908201 17:50925003-50925025 GCCCAAGTGCCTGGGGTGGCAGG - Intergenic
1152181855 17:78827207-78827229 GTCCAAAGCCCTGGGAGGGTGGG + Intronic
1152571762 17:81124149-81124171 GACCAAAGCCCGGGAGTGGTGGG + Intronic
1152778029 17:82214077-82214099 AGCCAAACACATGGGGTGGTGGG - Intergenic
1153139429 18:1954707-1954729 GCCCAAACCCCAGAGGCGGGGGG + Intergenic
1157299102 18:46466931-46466953 TCCCAAAGCCCTGGGGTTATAGG - Intergenic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1159888483 18:73933146-73933168 GCCCAGAGTCCTGGGGTGGGAGG + Intergenic
1160646243 19:194880-194902 GCCCCAACCCCTGGGGATGGGGG + Intergenic
1161153749 19:2721900-2721922 GCCCAGGCCCCTGGGATGGGTGG - Intronic
1161840065 19:6674741-6674763 GCCCATACCCCTGGAGTTGTGGG + Intergenic
1162032538 19:7923688-7923710 CCCCAAACCCCTGGGGGTGCTGG + Intergenic
1162142196 19:8591769-8591791 CCCCAAACCCCTTGAGGGGTGGG - Intronic
1162366979 19:10255656-10255678 GGCCAGACCTCTGGGGTGGATGG - Intronic
1162952834 19:14081999-14082021 GCACAAAATCCTGGGGTGGGGGG + Exonic
1166863461 19:45822700-45822722 GCCCCAGCACCTGGGGTGGGTGG + Intronic
1166998233 19:46729997-46730019 GCCCACACCCTTGGGCTGGCTGG - Intronic
1167119634 19:47508825-47508847 TCCCAAAGCCCTGGGATTGTAGG - Intronic
1167288153 19:48610528-48610550 GCCCACAGCACTGGGGAGGTGGG - Intronic
925442752 2:3902536-3902558 GCCCTCAACCCTGGGGTGTTAGG + Intergenic
927692725 2:25219643-25219665 AGCCAGCCCCCTGGGGTGGTGGG + Intergenic
929704239 2:44193970-44193992 TCCCAAAGCCCTGGGGTTGCAGG + Intronic
929870256 2:45753153-45753175 GCTCACTGCCCTGGGGTGGTAGG - Intronic
931629613 2:64287080-64287102 CCCCAACCCCCTGGGTTAGTGGG + Intergenic
933834270 2:86232691-86232713 GCCCAGACCCCGGTGGTGGGGGG + Exonic
934923868 2:98367667-98367689 GCCCCAACAGCTGGGGTGATGGG - Intronic
936018282 2:108975691-108975713 GGCCAGAGCCCTGTGGTGGTCGG + Intronic
936151394 2:110024124-110024146 GCTCAGACCCTTGGGGGGGTAGG + Intergenic
936193281 2:110347245-110347267 GCTCAGACCCTTGGGGGGGTAGG - Intergenic
938648386 2:133354086-133354108 GCCCAAACCCCTGAGGGGAGGGG - Intronic
946312819 2:218892405-218892427 GCCCCTACCCCAGGGGTGGCAGG + Intronic
946373830 2:219296639-219296661 CACCAACCCCCTGGAGTGGTGGG - Intronic
947834101 2:233162996-233163018 GCCCGAACCCCCGGGCTGGTGGG - Intronic
948248565 2:236507000-236507022 GCTCATCCCCATGGGGTGGTGGG + Intronic
1172216980 20:33242574-33242596 CCCCAAAACCCTGGGGTGTGGGG - Intronic
1172591393 20:36120629-36120651 GGCCCAAGCACTGGGGTGGTCGG - Intronic
1173866202 20:46314035-46314057 GCCCCCTTCCCTGGGGTGGTGGG + Intergenic
1174399342 20:50267594-50267616 GCCCAAGCCCCGGGGGTGGCGGG + Intergenic
1175939626 20:62532039-62532061 GCTCCAACCCCTGGTGTGCTTGG - Intergenic
1176388529 21:6151622-6151644 ACCCCAACACCTGGGGTGGGTGG - Intergenic
1179734943 21:43386626-43386648 ACCCCAACACCTGGGGTGGGTGG + Intergenic
1179978143 21:44882414-44882436 CCCCAAGCCCCTCGGGAGGTGGG - Intergenic
1180339448 22:11606264-11606286 GCCCCGACTCCTGGAGTGGTTGG + Intergenic
1180578490 22:16804749-16804771 GCTCAAAACAGTGGGGTGGTTGG - Intronic
1181013883 22:20057356-20057378 ACCCGAACCCCTGGGCTAGTTGG + Intronic
1181732563 22:24858236-24858258 TCCCAAACCTCTGGGATTGTAGG + Intronic
1184092284 22:42299082-42299104 GCCCAGACCCCTGCTGTGGAGGG + Intronic
1184269986 22:43374789-43374811 GCCCAAAGCACTGGGGTTATAGG - Intergenic
1184743586 22:46443313-46443335 GCCCTGACTCCTGGGGTGGAGGG - Intronic
1185014304 22:48334326-48334348 GCCCACGCCCCTCGGGAGGTGGG - Intergenic
1185097972 22:48821971-48821993 CCCCATCCTCCTGGGGTGGTGGG + Intronic
954872286 3:53776905-53776927 TCCCAAACCCCAGGGGAGGCTGG - Exonic
956651514 3:71508747-71508769 GCCCTAAGCCCTTGGGAGGTTGG - Intronic
959613993 3:108326642-108326664 CCCAAAACCCCTGGAGTGCTTGG + Intronic
961205145 3:125075928-125075950 GCCCAGACCCCTGGAGGGGCAGG - Intergenic
962501227 3:135995155-135995177 GACCAAAAGCCTGGGGGGGTGGG + Intronic
964635162 3:158850438-158850460 GCCCAAATCACTGTTGTGGTTGG - Intergenic
966224990 3:177588643-177588665 GCACATTCCACTGGGGTGGTAGG + Intergenic
968371438 3:198224646-198224668 GCCCCAACCCCTGGGGATGGGGG - Intergenic
969675127 4:8610335-8610357 CCCCAAAACCCTGGGGTGCAGGG - Intronic
972702079 4:41503861-41503883 GCCCAAACCCCTAGAGAGGGAGG - Intronic
975826672 4:78327096-78327118 TCCCAAACCACTGGGATTGTAGG - Intronic
980291118 4:130848129-130848151 GCCCAAAGCCCTGTTGGGGTGGG - Intergenic
982721826 4:158867879-158867901 TCCCACACACCAGGGGTGGTGGG + Intronic
986743561 5:10724997-10725019 GGCCAAGCCCATGGGGTGTTGGG - Intronic
990148315 5:52787925-52787947 GCCAAATCCCCTAAGGTGGTAGG - Exonic
992808238 5:80359866-80359888 CCCAAAGCCCCTGGGGTGCTTGG + Intergenic
993129288 5:83875278-83875300 GCCCATACCCTTGTGGTGTTGGG - Intergenic
993902419 5:93593652-93593674 GCCAAAACGGCTGGGCTGGTTGG - Exonic
994055198 5:95406696-95406718 TGAAAAACCCCTGGGGTGGTGGG - Intronic
996948709 5:129099331-129099353 GTCCTCACCCCTGGGGTGGGTGG + Intronic
998166247 5:139846053-139846075 ACCCAAACAGCTGAGGTGGTTGG - Intergenic
998371918 5:141667262-141667284 CCCCAGCCCCCTAGGGTGGTGGG - Intronic
999247263 5:150161804-150161826 GCCCCAGCCCCTGGAGGGGTAGG + Intergenic
999281967 5:150372081-150372103 GCCCCAGCCCCTGGGAAGGTGGG + Exonic
1000353779 5:160373633-160373655 GCCACATCCCTTGGGGTGGTGGG + Intergenic
1002730676 5:181330192-181330214 GCCCCAACCCCTGGGGATGGGGG - Intergenic
1002753854 6:143912-143934 GCCCCAACCCCTGGGGATGGGGG + Intergenic
1003004764 6:2370343-2370365 TCCCACACCCCTGGGTTGCTGGG + Intergenic
1004292624 6:14382350-14382372 GCACAAACTGCTGGGGTGGGTGG + Intergenic
1006316239 6:33293515-33293537 GCCCAAAACCCTGCAGTGGCAGG + Exonic
1006422713 6:33945286-33945308 GCCCACACCCCCGGTCTGGTGGG + Intergenic
1006832405 6:36976778-36976800 CCCCAAGCCCATGGGGTGGATGG + Intronic
1007221580 6:40283052-40283074 GCACAAACCCCTTGGAAGGTGGG - Intergenic
1007245465 6:40458820-40458842 GTTCAAACCCCTTGGGTGCTGGG - Intronic
1007777222 6:44230502-44230524 GCCCAGTGCCCTGGTGTGGTGGG + Intronic
1013651078 6:112195150-112195172 GCCCAAACTCCTGGGCTAGGTGG + Intronic
1019526286 7:1481878-1481900 GCCCCATCCCCAGGGGTGGGTGG + Intronic
1022504708 7:30902939-30902961 TCACAAACACCTGGAGTGGTGGG - Intergenic
1023987520 7:45105388-45105410 GCCCAAAGCCCAGGGGAGGCAGG + Intronic
1025694830 7:63769407-63769429 GCCCCAACCCCTGGGGATGGGGG - Intergenic
1029286431 7:99468894-99468916 GCCCGATCCCCTGGGGTGGATGG + Intergenic
1030874136 7:114792429-114792451 TGCCAGACCCCTGGAGTGGTGGG - Intergenic
1032540494 7:132699126-132699148 TCCCAAACAGCAGGGGTGGTGGG - Intronic
1033601362 7:142891289-142891311 GCCCCCATCCCTGGGGTGGGAGG - Intergenic
1034163808 7:149010930-149010952 GCCCATAACCCTGGGTGGGTTGG + Intronic
1035099405 7:156384052-156384074 GCCCAGACCACTGGGGTTGTGGG - Intergenic
1036131224 8:6115638-6115660 GGCCAAACCCCAGGAGTGATTGG + Intergenic
1037860087 8:22398899-22398921 GACCCAACCCTTGGGGAGGTGGG - Intronic
1038532758 8:28331744-28331766 GCCCACTCCACTGGGGTGGGTGG - Intronic
1048540980 8:135341958-135341980 TCCCAATCCCCTTGGGTGGGAGG - Intergenic
1053222094 9:36320631-36320653 CACCACACCCCTGGGGAGGTGGG - Intergenic
1058121649 9:101145759-101145781 TCCCAAAGCGCTGGGATGGTAGG - Intronic
1062432278 9:136531549-136531571 ACACAAAACCCTAGGGTGGTGGG + Intronic
1062443926 9:136585520-136585542 GACCAGAACCCTGGGGTGGCTGG + Intergenic
1062755085 9:138282702-138282724 GCCCCAACCCCTGGGGATGGGGG - Intergenic
1203578993 Un_KI270745v1:26871-26893 GCCCCAACCCCTGGGGATGGGGG - Intergenic
1187570514 X:20496223-20496245 ACCCATAGCACTGGGGTGGTGGG + Intergenic
1187755558 X:22521688-22521710 GACCAAAGCCCAGGGCTGGTTGG - Intergenic
1189495692 X:41506283-41506305 CCCCCAACCCCTGTGCTGGTCGG + Intergenic
1190063785 X:47226799-47226821 GCCCACACCCCTGGGCAGGGAGG - Exonic
1190302205 X:49063658-49063680 GCCCAAACCCCTGGGGTGGTGGG - Intronic
1190759557 X:53428167-53428189 GCCTGAGGCCCTGGGGTGGTGGG + Intronic
1192046347 X:67678127-67678149 CCACAAAGCCCTGGGGTGGGGGG + Intronic
1192239648 X:69319145-69319167 GCCCAGAGCCCTGGGGTTGTGGG - Intergenic
1196662202 X:118280836-118280858 GCCCAAAGCCCTGCTGTAGTGGG - Intergenic
1199824769 X:151488153-151488175 GCTCAAATCCCAGGGATGGTGGG - Intergenic
1202272319 Y:23083839-23083861 GCCCAAAGCCCTGTCGTAGTGGG - Intergenic
1202293707 Y:23336843-23336865 GCCCAAAGCCCTGTCGTAGTGGG + Intergenic
1202425316 Y:24717583-24717605 GCCCAAAGCCCTGTCGTAGTGGG - Intergenic
1202445473 Y:24952502-24952524 GCCCAAAGCCCTGTCGTAGTGGG + Intergenic