ID: 1190302561

View in Genome Browser
Species Human (GRCh38)
Location X:49065167-49065189
Sequence CTGATCATGCAGGATGTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190302561 Original CRISPR CTGATCATGCAGGATGTGGT CGG (reversed) Intronic
902045243 1:13519116-13519138 CAGGCCATGCAGGATCTGGTGGG - Intergenic
903690688 1:25171348-25171370 CGGACCATGCAGGATCTTGTAGG - Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
907068824 1:51516365-51516387 CTGAGCATTCAGTATGTGCTAGG - Intronic
909390821 1:75119542-75119564 CTCATCATGCTGAATGTGGCTGG - Intergenic
911209056 1:95120451-95120473 CTGATCAGGCAGGATAAGGCAGG + Intronic
912683513 1:111743868-111743890 ATGATCAGGCAGCATGTGGTGGG - Intronic
915479734 1:156176545-156176567 CTGATAGTGCAGGATGGAGTTGG + Exonic
915900337 1:159842119-159842141 CAGATCATGCAGGGTCTGATAGG + Intronic
917229503 1:172820941-172820963 CTGAGCATGCATTATGTGTTAGG - Intergenic
920290894 1:204922362-204922384 CTGGTCAGGCAGGAGGTGGCAGG - Intronic
922072011 1:222204044-222204066 CTGATCAGGCAGGAGGTGAAAGG + Intergenic
922786062 1:228282865-228282887 CTGGTCATGGTGGAGGTGGTAGG + Intronic
1063964569 10:11337032-11337054 TTGATCATGCAGGATGAGAAGGG + Intergenic
1064436312 10:15314121-15314143 CTGGTCATGCGGTATCTGGTAGG + Intronic
1065599736 10:27356524-27356546 CTGAGCTTGCAGAATGTGCTGGG + Intergenic
1066242246 10:33549593-33549615 GAGATTATGCAGGAAGTGGTGGG - Intergenic
1068813662 10:61285492-61285514 CTGATGGGGCATGATGTGGTGGG - Intergenic
1069046023 10:63744144-63744166 CTGTTTATGCAGAATGTGTTAGG - Intergenic
1074159431 10:110824896-110824918 CTGATCATGCAGGGAGGGGCTGG + Intronic
1074830808 10:117247187-117247209 TTGCTCATGGAGGATGTGATTGG - Intronic
1075272188 10:121061909-121061931 CAGATCATGGAGGATGGGGAAGG + Intergenic
1076609587 10:131713842-131713864 CAGATGATCCAGGATGTGCTGGG - Intergenic
1077036045 11:494972-494994 CAGCTCACGCAGGCTGTGGTTGG + Exonic
1081796661 11:45825260-45825282 CTGATCATGATGGAGGTTGTAGG - Intergenic
1081982671 11:47278516-47278538 CTGCTCTTGGAGGATATGGTGGG - Intronic
1085179596 11:74522234-74522256 CTGAACATGCAGGGTATGGTAGG + Intronic
1088501663 11:110489653-110489675 CTGATCAGGCTGGTGGTGGTTGG + Intergenic
1088794425 11:113255942-113255964 CTGATCAAGCAGGATGACGGCGG + Exonic
1090232857 11:125121321-125121343 ATGATCAGGCAGGAGGTCGTTGG + Intergenic
1091247601 11:134111948-134111970 GTGATTATGGAGGTTGTGGTAGG - Intronic
1091380294 12:53776-53798 CTGATCAGGAATGATGTAGTGGG + Intergenic
1092737353 12:11595093-11595115 CCGATCATGCAGGACATTGTAGG - Intergenic
1094320774 12:29180460-29180482 CTAAACATGAAGGATGTGGATGG - Intronic
1096553514 12:52389598-52389620 CTGATCAGGCTGGGTGGGGTGGG + Intergenic
1096577959 12:52566349-52566371 CTGATAATGAAGGAGGTGGGTGG + Exonic
1096966905 12:55635752-55635774 GAGATCCTGCAGGACGTGGTGGG - Intergenic
1097672490 12:62556759-62556781 CAGATCATGTAGAATGTGTTAGG + Intronic
1099035781 12:77585677-77585699 CTGATCCTACAGGAGGTGATCGG + Intergenic
1099372647 12:81856320-81856342 CTGATCATACAGGAACTTGTAGG + Intergenic
1099496889 12:83359310-83359332 CAGATCATGTAGGATGTTGTAGG + Intergenic
1100584007 12:95962457-95962479 CTCAGCATGTAGGCTGTGGTGGG - Exonic
1102520404 12:113474585-113474607 ATGATCATGAAGCACGTGGTGGG - Intergenic
1102599394 12:114017752-114017774 CTGATCCTGCAGGGTGCTGTGGG - Intergenic
1106137831 13:26987508-26987530 CTTATCCTGCAGCATATGGTAGG - Intergenic
1106671529 13:31911253-31911275 CTGAGCTTGAAGGATGGGGTAGG + Intergenic
1106677875 13:31980687-31980709 CTGATCACTCCAGATGTGGTTGG + Intergenic
1108407003 13:50114566-50114588 CTGAGGATGCAGGATATGGAGGG - Intronic
1112609932 13:100946164-100946186 CTGAGCAAGGTGGATGTGGTAGG - Intergenic
1112992224 13:105527681-105527703 TTGATCAGGCAGGCAGTGGTGGG - Intergenic
1114055223 14:18962804-18962826 CTGATGATGCTGGGTTTGGTAGG + Intergenic
1114107320 14:19438972-19438994 CTGATGATGCTGGGTTTGGTAGG - Intergenic
1117479357 14:56128139-56128161 CTGATCATTCAGTTTGTGTTAGG + Intronic
1117484711 14:56182842-56182864 CTGATTTTGTAGGATGTGCTGGG + Intronic
1118320884 14:64752767-64752789 ATGAGCATGCAGGATGTGTCTGG - Intronic
1119501161 14:75128392-75128414 CTGAAAAAGCAGGATGTGATGGG + Intergenic
1121701873 14:95960944-95960966 GTGATCATCCAGGATTAGGTTGG + Intergenic
1123660416 15:22559911-22559933 CTGCTCATGAAGGTTGTGGAAGG + Intergenic
1128446666 15:67768442-67768464 CAGAGCATGCAGCATTTGGTGGG - Intronic
1128672883 15:69587464-69587486 ATGAACATGCAGAATGTGCTTGG + Intergenic
1129449113 15:75640076-75640098 CAGCTCGTGCAGGTTGTGGTCGG + Exonic
1129521564 15:76189674-76189696 CTGGCCATGCAGGATTTGGGAGG - Intronic
1129860205 15:78854777-78854799 TAGACCATGCAAGATGTGGTAGG + Intronic
1130065829 15:80604371-80604393 CTGTTCATGGAGCAGGTGGTGGG - Intergenic
1130982932 15:88825256-88825278 CTGATCCTGCTGGAGGGGGTGGG - Intronic
1132394770 15:101464580-101464602 GTGATCGAGCAGGCTGTGGTGGG + Intronic
1134209924 16:12267591-12267613 CTGCTCCTGCAGGATGAGGGAGG - Intronic
1134819910 16:17238627-17238649 CTGGTCATGCAGGACCTTGTAGG - Intronic
1137515650 16:49141131-49141153 CTGAACAAGAAGGATGTTGTGGG - Intergenic
1138044357 16:53705312-53705334 CAGATCATGCAGGATCTTGTAGG - Intronic
1139607908 16:68033012-68033034 CTGATCATGCAGGGCCTTGTGGG + Intronic
1143092964 17:4460201-4460223 CAGATCATGTAGGATGTTGTGGG + Intronic
1143992628 17:10979567-10979589 CTGACCATTCAGTATTTGGTGGG - Intergenic
1147459209 17:40557806-40557828 CAGATAGGGCAGGATGTGGTGGG - Intronic
1147794219 17:43031207-43031229 CTGATGATCCAGGGAGTGGTGGG - Intergenic
1149165206 17:53743019-53743041 CTGATCCAGCAGGATATGGATGG + Intergenic
1151142186 17:72004287-72004309 ATGATCATGCTGGATGTTGTAGG + Intergenic
1151188447 17:72380541-72380563 CTGAGTATGCATGAAGTGGTGGG + Intergenic
1151597396 17:75086974-75086996 CTGAGTATACAGGGTGTGGTTGG + Intergenic
1152500941 17:80708628-80708650 CTCATCCTCCAGGGTGTGGTGGG + Intronic
1153545618 18:6202329-6202351 TTGATTATGCAGGATCTAGTAGG + Intronic
1155406547 18:25494638-25494660 CTGATAAAGCAGCAGGTGGTAGG + Intergenic
1155450957 18:25962442-25962464 CTGAGAATGCAGGTTGTTGTTGG - Intergenic
1155929065 18:31686167-31686189 CTAATCATGCAGGAAGTGGCGGG + Intergenic
1156692246 18:39722263-39722285 CTGATAATTCAGAAGGTGGTGGG + Intergenic
1157493298 18:48138577-48138599 CTGGGCAGCCAGGATGTGGTGGG + Intronic
1157982656 18:52399508-52399530 TGGATCATAAAGGATGTGGTAGG - Intronic
1159076133 18:63683987-63684009 CGGATCATGTAGGAAGTGGTGGG - Intronic
1160622981 18:80183577-80183599 CTGATGAAGCAGGATGAAGTGGG - Intronic
1161605645 19:5213344-5213366 CTGGTCATGCAGGATCCTGTGGG - Intronic
1166722217 19:45003026-45003048 TCGCTCATGCAGGATGAGGTTGG + Intronic
1167012221 19:46816186-46816208 CTGAGCACACAGGAGGTGGTCGG + Intergenic
1167084520 19:47300170-47300192 CTTTTGAGGCAGGATGTGGTGGG - Intronic
1168279955 19:55300199-55300221 GTCAGAATGCAGGATGTGGTGGG + Intronic
1168507927 19:56951844-56951866 ATGATCCTGGAGGATGTGGGTGG + Intergenic
925875666 2:8309309-8309331 CTGAGCATGCCGGATCTTGTTGG - Intergenic
925976721 2:9146858-9146880 CAGATCCTGCAGGCTGTGGGTGG - Intergenic
926922172 2:17949868-17949890 CTGATATTGCAGGCTGTGGGTGG + Intronic
928055583 2:28050850-28050872 ATGATCATGCAGTCAGTGGTGGG + Intronic
928214022 2:29346384-29346406 CTGATTCTGCAGGATGCTGTAGG - Intronic
928368846 2:30724063-30724085 CTTATGATGCAAGATGGGGTGGG + Intronic
935527835 2:104193351-104193373 CTGAACATGCAGGAAGTGAGTGG + Intergenic
938473238 2:131585575-131585597 CTGATGATGCTGGGTCTGGTAGG + Intergenic
941991638 2:171562733-171562755 CGGCTCATGCAGGATTTGGCTGG + Intergenic
942028371 2:171933810-171933832 CTTATCATGTAGGATCTGTTTGG + Intronic
942860352 2:180602155-180602177 CCGATCAGGCAGGATATTGTAGG + Intergenic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
946088163 2:217195406-217195428 GTGATCATGGAGGAGGTGGGTGG - Intergenic
947710143 2:232308900-232308922 TTTATCATGGAGGATGTGATGGG + Intronic
948113241 2:235473833-235473855 CTGATCAGGCAGGATGATGTGGG - Intergenic
948591232 2:239052050-239052072 CTGGTCGTGAAGCATGTGGTAGG - Exonic
948831577 2:240600926-240600948 CTGATGGTGCAGGTTGAGGTGGG + Intronic
1169026555 20:2376356-2376378 CTCATCAAGGAGGCTGTGGTGGG + Intergenic
1169861469 20:10157511-10157533 CTGAAAGTGCAGTATGTGGTGGG + Intergenic
1173114006 20:40223085-40223107 CTGATCACACAGGGTCTGGTGGG + Intergenic
1173115910 20:40242707-40242729 CTGCGCATGCATGATGTGGGAGG - Intergenic
1173410126 20:42802733-42802755 CTGATCATGCAGGAGAAGGGAGG - Intronic
1174422079 20:50405690-50405712 CTGAGCCTAAAGGATGTGGTGGG - Intergenic
1176667641 21:9702222-9702244 CTGGTCTTGCATGATGTTGTAGG + Intergenic
1179444783 21:41423663-41423685 CTGAGCATGTAGGATGTGTTAGG - Intronic
1180473705 22:15685356-15685378 CTGATGATGCTGGGTTTGGTAGG + Intergenic
949478472 3:4471164-4471186 GTGATCCTGCAGGCTGAGGTAGG - Intergenic
949837938 3:8289519-8289541 CTGATCCAGCTGGATTTGGTTGG - Intergenic
949942924 3:9168460-9168482 CTGCTCATGCGTGATGTGCTGGG - Intronic
950440126 3:13005616-13005638 CTGAGCACTCAGGATGTGGCTGG + Intronic
950886241 3:16365504-16365526 ATGATCATGGAGGATATGCTAGG + Intronic
951806794 3:26653658-26653680 TTGATCATGCTGGATGTTTTAGG + Intronic
952071454 3:29642075-29642097 CTGAACATGCACGCTGTGGCAGG + Intronic
952883073 3:37997582-37997604 CAGATCATGGAGGCTGTGCTGGG + Exonic
953296541 3:41723458-41723480 CTGATCATGTGGGTTGAGGTGGG + Intronic
953470874 3:43164747-43164769 CTCTTCATGGGGGATGTGGTGGG + Intergenic
953768590 3:45762129-45762151 CTGATTCAGCAGGATGGGGTGGG + Intronic
954659356 3:52218721-52218743 CAGGTCCTGCAGGAAGTGGTTGG - Intergenic
954964889 3:54601537-54601559 CTGATCCTGCAGGCTTTGGGTGG - Intronic
955102359 3:55862780-55862802 GTGATCCTGCTGCATGTGGTGGG - Intronic
955126300 3:56115847-56115869 CTCCTAATGCAGGAGGTGGTAGG - Intronic
955657193 3:61256902-61256924 CGGATCATGAAGGGTTTGGTAGG + Intergenic
956499292 3:69864695-69864717 CAGACCATGAAGGATCTGGTAGG - Intronic
956907039 3:73777231-73777253 CAGATTATGCAGAAGGTGGTTGG + Intergenic
957849449 3:85787799-85787821 CAGATCATGCAGGACTTGTTAGG - Intronic
957974421 3:87424835-87424857 CTCAGCAGGCAGGATGTGATGGG + Intergenic
960851154 3:122056045-122056067 TTGAACATGCATGATGTGCTGGG + Intronic
961096980 3:124165900-124165922 GTGAACAAGCAGGAAGTGGTAGG - Intronic
961463488 3:127067822-127067844 GTGGGCCTGCAGGATGTGGTGGG + Intergenic
964385586 3:156144513-156144535 CTTCTAAAGCAGGATGTGGTAGG - Intronic
966061890 3:175767915-175767937 GTCATCATGCAGGATTTGGAAGG - Intronic
966261619 3:177985153-177985175 CAGGTCATGCAGGGTGTGGTTGG + Intergenic
967137722 3:186526631-186526653 CTGAGCTTACAGGATGTGTTAGG + Intergenic
970323969 4:14903942-14903964 CTGATTCTGCAGGATCTGCTTGG - Intergenic
970872529 4:20832746-20832768 CTCAGCATGAAGGATTTGGTAGG + Intronic
978257268 4:106707908-106707930 ATGATGAGGAAGGATGTGGTGGG + Intergenic
979071587 4:116214450-116214472 CTGATAGTGAAGGATGTGCTAGG - Intergenic
982809918 4:159812210-159812232 CTGAACTTGCAGAATTTGGTTGG - Intergenic
983235318 4:165172510-165172532 CTGATGATGATGGAGGTGGTTGG - Intronic
984361849 4:178744020-178744042 CTGATGATGCAGAATGTTGGTGG + Intergenic
985407166 4:189649382-189649404 CTGGTCTTGCATGATGTTGTAGG - Intergenic
986575266 5:9205802-9205824 CTGATCCTTCAGGATGAGGGTGG + Intronic
986748619 5:10765221-10765243 CCCATCATGCAGGGTCTGGTAGG - Intergenic
989112939 5:37925115-37925137 CTGAACACACAGGATGTGATTGG - Intergenic
991441799 5:66658594-66658616 ATGAGCTTGCAGGGTGTGGTGGG + Intronic
994751121 5:103738143-103738165 CTTCTCATGCAGAATGTGATTGG + Intergenic
997590212 5:135067771-135067793 CAGATCCTCCAGGCTGTGGTGGG - Intronic
998469714 5:142374339-142374361 CCAATCCTGAAGGATGTGGTGGG - Intergenic
999169546 5:149581649-149581671 CTGGTCAAGCAGGATGGGGCTGG + Intronic
999938217 5:156511794-156511816 CTGATCATGTACTATGTGCTAGG - Intronic
1000248325 5:159468996-159469018 CTGAAATTGCAGGTTGTGGTGGG + Intergenic
1005808751 6:29500503-29500525 CTGAGCTTGCAGGATGTTCTGGG - Intergenic
1006263443 6:32895550-32895572 CCGGTCTTGCAGGATGGGGTGGG - Intergenic
1006321547 6:33322389-33322411 GTGATCATTCAGGATAGGGTGGG - Intronic
1007816490 6:44528869-44528891 CTGACCATGCTGGGTGTTGTGGG - Intergenic
1012839585 6:104312640-104312662 CTCATGATTTAGGATGTGGTAGG + Intergenic
1016492007 6:144615898-144615920 CTGATCATGTAGGACCTGGTAGG - Intronic
1017969575 6:159299842-159299864 CTGATCATAGAGGATGGGGAAGG - Intergenic
1018871480 6:167786925-167786947 CTCATCATTTAGGACGTGGTTGG + Intronic
1020153844 7:5705481-5705503 CTTATCAGTCAGGATGTGCTAGG + Intronic
1021805204 7:24348661-24348683 CTGATGAGGCATGATGTGGAAGG + Intergenic
1022378734 7:29840233-29840255 CAGACCATGCAGGATGGAGTGGG - Intronic
1025248757 7:57337754-57337776 CTGAGCCTAAAGGATGTGGTGGG + Intergenic
1027810891 7:82895943-82895965 CTGACCATGTAGAATGTGTTGGG - Intronic
1029420616 7:100469942-100469964 CTGAGCGAGCAGGATGGGGTGGG + Intronic
1029438286 7:100574318-100574340 CTCCTCTTCCAGGATGTGGTGGG + Intronic
1029532919 7:101137333-101137355 CTCATCAGGCTGGATGTGGGTGG - Intronic
1030487526 7:110189091-110189113 CAGATCATGCAGGACTTTGTAGG + Intergenic
1032471550 7:132182616-132182638 CAGCCCCTGCAGGATGTGGTGGG - Intronic
1035096136 7:156357417-156357439 GTGATGATCCAGGATGTGGATGG + Intergenic
1039093983 8:33863712-33863734 GTGTTGAGGCAGGATGTGGTTGG - Intergenic
1044489387 8:92793995-92794017 TAGATCATGGAGGATGTGGTTGG + Intergenic
1044989558 8:97783563-97783585 CTGAACATGGGGGATGGGGTGGG - Intronic
1046758457 8:117995497-117995519 CTGAAAATGAAGGACGTGGTTGG + Intronic
1046796119 8:118374288-118374310 TTTATCATGCAGCATGTGGTCGG + Intronic
1046814417 8:118568383-118568405 CAGATCATGCAGGATCTGGTAGG + Intronic
1046970058 8:120212968-120212990 ATAATCTTGCAGCATGTGGTTGG + Intronic
1048619177 8:136113065-136113087 AGGATCATGCATGATGTGATTGG + Intergenic
1048817324 8:138345793-138345815 ATCATCATGCAGGATGTTATGGG - Intronic
1049600137 8:143503814-143503836 CTGAACATGGAGGAGGCGGTGGG - Intronic
1049858060 8:144876119-144876141 CCAATCAAGCAGGATGTGGGTGG + Intergenic
1051409230 9:16771549-16771571 CTATTCATGCAGGATATGCTAGG - Intronic
1051564829 9:18485759-18485781 CAGATCATGCAGGGTGTTGCAGG + Intronic
1052837988 9:33265459-33265481 GGGATCAGGCAGGATGAGGTGGG - Intronic
1053413273 9:37929253-37929275 CCGAGTATGCAGGATGTCGTTGG + Intronic
1055129712 9:72760965-72760987 CTGATCATGCATGTTGTGTATGG - Intronic
1056822223 9:89851293-89851315 CAGATCATGGGGGGTGTGGTGGG + Intergenic
1058565977 9:106285843-106285865 CTGAGCATGCTTGATTTGGTAGG - Intergenic
1061707655 9:132465380-132465402 CTGGTCATGAAGGTTGTGTTGGG + Intronic
1203658174 Un_KI270753v1:18477-18499 CTGGTCTTGCATGATGTTGTAGG - Intergenic
1186610147 X:11130977-11130999 CTGCTCATGCAGTCTGTGGAAGG - Intergenic
1189078278 X:37941252-37941274 CTGCACAAGCTGGATGTGGTGGG - Intronic
1190302561 X:49065167-49065189 CTGATCATGCAGGATGTGGTCGG - Intronic
1190489342 X:50965394-50965416 CAGATCATGTAGGATTTTGTAGG - Intergenic
1192596001 X:72408850-72408872 CAGATCATGTAGGGTGTTGTAGG + Intronic
1194917674 X:99724289-99724311 GTGATGATTCAGGATGTGGGAGG - Intergenic
1195432444 X:104804368-104804390 TTGACAATGCAGGATGCGGTGGG - Intronic
1198973838 X:142312499-142312521 ATGATCATGAAAGATGAGGTTGG + Intergenic