ID: 1190303391

View in Genome Browser
Species Human (GRCh38)
Location X:49068914-49068936
Sequence CTGTAAACATAAATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190303391_1190303398 30 Left 1190303391 X:49068914-49068936 CCTTCCTCCATTTATGTTTACAG 0: 1
1: 0
2: 1
3: 26
4: 257
Right 1190303398 X:49068967-49068989 AACACTAGGCGTTTTACAAAAGG 0: 1
1: 0
2: 0
3: 12
4: 132
1190303391_1190303395 16 Left 1190303391 X:49068914-49068936 CCTTCCTCCATTTATGTTTACAG 0: 1
1: 0
2: 1
3: 26
4: 257
Right 1190303395 X:49068953-49068975 CACTGTCTTCCTCCAACACTAGG 0: 1
1: 0
2: 3
3: 27
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190303391 Original CRISPR CTGTAAACATAAATGGAGGA AGG (reversed) Intronic
903001785 1:20271393-20271415 ATGTGAAGATAAAAGGAGGAGGG + Intergenic
905779396 1:40694429-40694451 TTGTAAACAAAAATGAGGGAGGG - Intronic
906025209 1:42667642-42667664 CTGTAAAAATAAAAAGAGAAAGG + Intronic
907338409 1:53715865-53715887 CTGCAAACAGAAGTGGAGAATGG + Intronic
907617986 1:55944220-55944242 CTGTAGCCAAAAATGGAGAAAGG + Intergenic
909501664 1:76341202-76341224 CTGTCAACCAAAACGGAGGAGGG - Intronic
909938864 1:81587810-81587832 CTGTGAAAATAAATTAAGGAGGG + Intronic
910008267 1:82427303-82427325 CAATGACCATAAATGGAGGAAGG - Intergenic
912380278 1:109243861-109243883 ATGAATACATGAATGGAGGATGG - Intergenic
912991887 1:114495660-114495682 CATTCAACATAAATTGAGGAAGG + Intronic
914937424 1:151993442-151993464 ACGCAAACATAAAGGGAGGAGGG + Intronic
915255923 1:154628471-154628493 GTGTAAACACAAATTCAGGATGG - Intergenic
915874319 1:159596122-159596144 CTATAAACATATTTGGAGTAGGG - Intergenic
916132614 1:161624469-161624491 CCATAAACTTAAATGGAGAAAGG - Exonic
918109927 1:181446565-181446587 CTGTAAACATGAATTCAGCATGG - Intronic
919002729 1:191854217-191854239 CTGCATACAAAATTGGAGGACGG - Intergenic
920493023 1:206433164-206433186 CTGCAAAAAGAAATGCAGGAAGG + Intronic
921892515 1:220367328-220367350 CTGTAATGATATCTGGAGGAGGG - Intergenic
922647296 1:227301821-227301843 CTGTAACCATATTGGGAGGATGG - Intronic
923967121 1:239154445-239154467 CTGTAATCTTAAATGGCAGAAGG - Intergenic
1063757821 10:9035382-9035404 TTGTCAAAATAAATGGAGGGAGG + Intergenic
1063865180 10:10356731-10356753 GTGTGACCCTAAATGGAGGATGG - Intergenic
1067321124 10:45222267-45222289 CAGTAAAGAAATATGGAGGAAGG + Intergenic
1068314046 10:55319340-55319362 TTGTTAACATAAATGGAACAAGG + Intronic
1070274075 10:74987640-74987662 CTGTAAACAGAAAGGAAAGAAGG + Intronic
1073302569 10:102480010-102480032 CTGTAAACATTAGTGTAGCAAGG + Exonic
1073444846 10:103574524-103574546 GTTTAAACATAAAAGGAGGCAGG + Intronic
1073533047 10:104250601-104250623 ATGTCAACATAAAAGGAAGAGGG + Intronic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1075333844 10:121595294-121595316 CTGAGGACAAAAATGGAGGAGGG + Intronic
1075643394 10:124081695-124081717 CTGGAAACATAAACGCTGGAAGG + Intronic
1075972650 10:126667767-126667789 ATGTAGCCATAACTGGAGGATGG - Intronic
1077730518 11:4724316-4724338 CTGAAAACAGAAGTGGAAGATGG + Intronic
1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG + Intergenic
1078484494 11:11708929-11708951 CTTTAAAAATAAATGGATGAGGG - Intergenic
1078731165 11:13975274-13975296 CAGTAAAGATAAAAGGATGAGGG + Intronic
1079075549 11:17383406-17383428 CTGTAATCTTACATGGTGGAAGG - Intergenic
1079091589 11:17484348-17484370 CTGTAAACTTACATGGTGGAAGG - Intergenic
1079924523 11:26477415-26477437 CTAAAAACATGAATGGAGAAAGG - Intronic
1082954647 11:58857025-58857047 CTTTAAACATATATGCAGTAGGG + Intronic
1082971700 11:59029716-59029738 CTTTAAACATATATGCAGTAGGG + Intronic
1084575921 11:69987883-69987905 CTGTAATCATGGATGGATGACGG + Intergenic
1085164970 11:74390644-74390666 ATGTAAAAAGAACTGGAGGAAGG + Intronic
1089093849 11:115901462-115901484 CTGGAAACAGAAAAGGATGATGG - Intergenic
1089445216 11:118546483-118546505 CTGTAAAAAAAAAGGAAGGAAGG + Intronic
1090139479 11:124239499-124239521 CTGTAAACAGAAATAAAAGATGG + Intergenic
1090445431 11:126761003-126761025 CGTTAAACATAAATGAAAGAGGG + Intronic
1092746327 12:11675812-11675834 CTCTAAACAAAAAGGAAGGAAGG + Intronic
1092931600 12:13320861-13320883 GTGTTAACATAAAGGTAGGAAGG + Intergenic
1093089646 12:14906721-14906743 CTGTAAAGAAAATTAGAGGAGGG - Intergenic
1093703303 12:22247025-22247047 ATATAAATACAAATGGAGGAAGG - Intronic
1094527892 12:31244901-31244923 CTGTGATCCTAAAGGGAGGAAGG + Intergenic
1096880633 12:54666200-54666222 CTGTAAACACAAAAAGGGGAGGG - Intergenic
1097652082 12:62311499-62311521 CCGTAAACATAAATGAATGGGGG + Intronic
1099147350 12:79063553-79063575 ATTTACACATAAGTGGAGGAGGG + Intronic
1099593736 12:84629574-84629596 CAATCAATATAAATGGAGGAGGG + Intergenic
1100986261 12:100204133-100204155 CTTTAAAAAAAAATGGGGGAGGG + Intronic
1101609812 12:106280183-106280205 CTTTAAAAATAAATGGGGTAAGG + Intronic
1104509418 12:129363044-129363066 CAATAAACAAAGATGGAGGAAGG - Intronic
1107854724 13:44603490-44603512 CTATAAAAATAAATTGAGGCCGG + Intergenic
1107931043 13:45307671-45307693 CTGTTGACAGAAATGGAGGGAGG + Intergenic
1111263785 13:85779130-85779152 CTATAAAGATAAAAGGAGGTTGG - Intergenic
1113090166 13:106609766-106609788 ATGTGCACATAAATGGGGGAAGG - Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1115306506 14:31939072-31939094 GTGTATGCATAAATGGTGGATGG - Intergenic
1115344656 14:32329371-32329393 CTGTAAACATCAAAAGAAGACGG + Exonic
1116319130 14:43437119-43437141 CAGTAAAGAAAAATTGAGGAAGG - Intergenic
1118127041 14:62917300-62917322 CTTTAAAGATAAATTGAGTAGGG - Intronic
1118433807 14:65750761-65750783 CTGTAAGGATAAATGGAGTCTGG - Intergenic
1118818836 14:69331577-69331599 CTGTAGACATGAAAGGAGGTAGG + Intronic
1120526422 14:85581978-85582000 CTGTAAACATGAATGCAGTTTGG + Intronic
1120599270 14:86480838-86480860 ATGTAAACAAAAAGGGAAGATGG - Intergenic
1121495334 14:94388292-94388314 CTGTAAGCAGAAGTGGATGAGGG - Intronic
1122171163 14:99876768-99876790 CTGTAAGCAAAAAAGGAGGAGGG - Intronic
1124135047 15:27027979-27028001 CTGTAACCATATATCCAGGAAGG - Intronic
1125620661 15:41058782-41058804 CTGTAAATATAAAAGGGGAAGGG + Intronic
1126293208 15:47105993-47106015 CTGGAGACATAAATAGAGGAAGG - Intergenic
1126648953 15:50902691-50902713 CTTTAAACAGAAAAGGAGGAGGG - Intergenic
1127822713 15:62674173-62674195 CTGTTAACATGCATTGAGGAAGG + Intronic
1128350582 15:66885752-66885774 CTGTAACCTCAAATGAAGGAAGG + Intergenic
1130230002 15:82089478-82089500 CTCAAAAAATAAATGGAGGTTGG + Intergenic
1131237181 15:90706705-90706727 CTGTAAATAGAAGTGGAGGGAGG + Intergenic
1131814017 15:96203679-96203701 TTATAAACATAAATGGTGAAAGG + Intergenic
1136090130 16:27912918-27912940 CTGTGAACAGAAATGGATAATGG + Intronic
1136129286 16:28209666-28209688 CTGAAAGAATAAATGAAGGAAGG + Intronic
1138033775 16:53581785-53581807 ATGTACACATAAATGAAAGATGG - Intergenic
1138913905 16:61439401-61439423 ATGTAAAAAGAGATGGAGGATGG + Intergenic
1138942644 16:61808854-61808876 TTGTAAGCATAAAAGGATGACGG + Intronic
1139108912 16:63864604-63864626 CTGTTCACAAAAAGGGAGGAAGG + Intergenic
1139264865 16:65629200-65629222 CTGCAAACAAAAAATGAGGAAGG - Intergenic
1143332089 17:6144953-6144975 CTGGAAACAAGAATGGAAGATGG - Intergenic
1145766233 17:27460011-27460033 CTCTAAATATAAAGGGAGGGAGG + Intronic
1146409140 17:32566984-32567006 CTGTGAACATGGATGGAGCACGG - Intronic
1149187060 17:54010860-54010882 CTTTACACATAAGTGAAGGAAGG - Intergenic
1151340951 17:73470637-73470659 CCGTAATCAAAAGTGGAGGATGG - Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153203098 18:2666587-2666609 GTGTCAACATGAATGGAGAATGG - Intronic
1153482306 18:5559267-5559289 CTTTACAAATAAATGGAGGAGGG + Intronic
1155770153 18:29686797-29686819 TAGTAAAGATAAATGGAAGATGG - Intergenic
1156566325 18:38195656-38195678 CTGTAAACAGAAATCAAGGAAGG - Intergenic
1156999606 18:43509224-43509246 CTGTAAACAAAAATGTAGACTGG - Intergenic
1158098279 18:53800247-53800269 CTCTAAAGATAAATTGAGGATGG + Intergenic
1158179494 18:54697996-54698018 TTGTAAAAATAAATGTAGAAAGG + Intergenic
1158947462 18:62459465-62459487 CTGTCAACAAAAGTGGAAGAAGG - Intergenic
1159137011 18:64348314-64348336 GGGTGAACATAAATGGAAGATGG + Intergenic
1159712144 18:71774059-71774081 CTGGAAACTAAAATGGGGGAGGG - Intronic
1161920046 19:7259191-7259213 CTGTAAAAAGAAAGGAAGGAAGG - Intronic
1162270675 19:9612512-9612534 CTATAAAAATAAATTGAGGCTGG - Intronic
1162275903 19:9654741-9654763 CTATAAAAATAAATTGAGGCCGG - Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
925213889 2:2075588-2075610 CTGTAAGAATCATTGGAGGAGGG + Intronic
925988591 2:9235576-9235598 AAGTAAAGAGAAATGGAGGAGGG + Intronic
927039695 2:19215983-19216005 CTGTGACCACAAATGGAAGAAGG - Intergenic
928346681 2:30504486-30504508 CTGAAAACATAAATTGAGATAGG - Intronic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
932123665 2:69124358-69124380 CTCTAAACTTTAAAGGAGGATGG + Intronic
940062613 2:149588998-149589020 CAATAAACATAAAACGAGGAGGG - Intergenic
940776494 2:157889954-157889976 ATGTAAACAAATATGGAAGAAGG - Intronic
943738834 2:191388876-191388898 CTGTAAAAATAAAAAAAGGAGGG - Intronic
943763892 2:191639475-191639497 CTGGAATCATACATGGAGGATGG + Intergenic
943984866 2:194605817-194605839 CTTTAAAAAAAAATGGGGGAAGG + Intergenic
944676904 2:202041158-202041180 CTGTCAACATAGTTGGAGTAAGG + Intergenic
946166999 2:217870356-217870378 CTGGAAACAGAAAGGAAGGAAGG + Intronic
946643840 2:221812943-221812965 CTGAACACATAAATGCATGATGG - Intergenic
946783909 2:223222198-223222220 GTCTAAACATAAAGGGAGGGGGG + Intergenic
947632678 2:231664083-231664105 CCGTAACCATAAACAGAGGACGG - Intergenic
948626264 2:239270235-239270257 GTGTAAAAATGAATGGATGACGG + Intronic
1168937270 20:1676171-1676193 CCTTAAACATAGATGGAGAAGGG - Intergenic
1169294573 20:4383010-4383032 CTGTCAACATAAAGGTAGTATGG + Intergenic
1169507470 20:6227513-6227535 TTTTAAAAATAAATGGTGGAGGG + Intergenic
1170086554 20:12539178-12539200 GTTTAATCATAAAAGGAGGAGGG - Intergenic
1170308745 20:14969847-14969869 CTTTAAACATAAATGAATTATGG + Intronic
1171536162 20:25892577-25892599 CTGGAGACAGAAATAGAGGAAGG + Intergenic
1171804936 20:29668581-29668603 CTGGAGACATAAATAGAGGAAGG - Intergenic
1171839123 20:30187847-30187869 CTGGAGACATAAATAGAGGAAGG + Intergenic
1172168399 20:32913308-32913330 CTGTAAACTTACATGGTGGAAGG + Intronic
1173125872 20:40335562-40335584 CTGTAAATTTAAGTGGAGAATGG - Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1177621698 21:23603675-23603697 TTGTAACCCTAAATGGAAGAAGG + Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178686803 21:34718274-34718296 CTTGAAACCTAAATGGAGAATGG - Intergenic
1179314007 21:40225238-40225260 TTGTAAACAGAAATGAAGGCAGG - Intronic
949916117 3:8965894-8965916 TTGTTAAAATGAATGGAGGAAGG - Intergenic
950383527 3:12637573-12637595 CTTAAAACACAAATGGAGGCCGG + Intronic
950954015 3:17031415-17031437 CTGCAGACATGAAAGGAGGAAGG - Intronic
951157898 3:19376985-19377007 CCATAAACATACATGGAAGAGGG + Intronic
953488683 3:43328207-43328229 CTGAAACCGTAAATGGGGGATGG - Intronic
953837035 3:46355784-46355806 CTGTGAAGATCAATGGAGTAAGG - Intronic
957436586 3:80185154-80185176 ATGTAAACCTAAATGGCTGAAGG + Intergenic
957480452 3:80786409-80786431 GTGTTAAGATAAATGGAAGAGGG - Intergenic
958491460 3:94779469-94779491 GTGTAGCCACAAATGGAGGATGG + Intergenic
958741475 3:98078795-98078817 CTGAAAACATCCATGGAGCAGGG - Intergenic
960247411 3:115414712-115414734 ATGTTCACAGAAATGGAGGAAGG - Intergenic
960421007 3:117445150-117445172 CTGTAAAAATAGATTAAGGATGG - Intergenic
962015544 3:131436181-131436203 CTCAAAAAATAAGTGGAGGAAGG + Intergenic
962451987 3:135527476-135527498 CTGTAACCTTACATGGTGGAAGG - Intergenic
962935168 3:140074048-140074070 CAGTAGCCATAAGTGGAGGAGGG - Intronic
963380407 3:144522853-144522875 CTGAAAACAAAAATGGTGAAAGG + Intergenic
964794313 3:160480982-160481004 ATGTGAACGTAAATGGAGGTTGG + Intronic
965514716 3:169608548-169608570 CTGGAAACACAAATGGAGGGAGG - Intronic
966625294 3:182009239-182009261 CTGGAAACATAAAAGGAAAAAGG + Intergenic
971501766 4:27326043-27326065 CTTTAAACTAAATTGGAGGAAGG - Intergenic
971769237 4:30874980-30875002 CTGTAACAATAAATGGGTGAAGG - Intronic
973036983 4:45419376-45419398 CTTTAAACATAAATTGATGCTGG + Intergenic
973802001 4:54487430-54487452 CTGTGAACTTACATGGTGGAAGG - Intergenic
974728034 4:65822019-65822041 CTTAAAAAATAAAAGGAGGAAGG - Intergenic
976930555 4:90561889-90561911 CTGTAAAGATAAATTTAGGCCGG + Intronic
977162036 4:93646857-93646879 CTGAACAAATAAATGGATGATGG + Intronic
979784475 4:124698281-124698303 ATGTAGATATAAATGCAGGAGGG + Intronic
980236542 4:130114454-130114476 CTGGAAAGATAATTGGAAGAGGG - Intergenic
980478885 4:133358610-133358632 CTGTAAAAAATAATGGAAGATGG + Intergenic
982862536 4:160471155-160471177 CTGTAAACGTATCTGGAAGAGGG + Intergenic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
984661654 4:182381316-182381338 CTGTCAACATGTAAGGAGGAGGG + Intronic
988026114 5:25692512-25692534 CTGCAAGCATAAATGGACCATGG + Intergenic
988821230 5:34888129-34888151 CTGTAAACTCACATGGTGGAAGG - Intronic
988838670 5:35061195-35061217 CTTTAAAAAAAAATAGAGGAAGG + Exonic
989329796 5:40243557-40243579 CTGTAAACATATATTGAACAAGG + Intergenic
992656725 5:78917807-78917829 CTTTAAACATAACTGCAGGCTGG - Intronic
994327994 5:98471475-98471497 CTTTCAACTTAAATGTAGGAAGG + Intergenic
996625438 5:125564805-125564827 CTGAAAACATCATTGGAGCAGGG - Intergenic
996984288 5:129539871-129539893 CTGGAAACAAATATGGAGAAAGG - Intronic
999551723 5:152694886-152694908 CTTTTAACAAAAATGGAGAAGGG - Intergenic
1000700168 5:164439608-164439630 ATGAAAACCTAAATGGAGGGGGG + Intergenic
1000763416 5:165254814-165254836 CTGAAATAATAAAGGGAGGAAGG - Intergenic
1001170081 5:169410960-169410982 CTGAAAACAAGAGTGGAGGAAGG - Intergenic
1001848772 5:174944541-174944563 CAGTAAAAAGACATGGAGGATGG + Intergenic
1002829312 6:804803-804825 CTGTTAACAAAGAAGGAGGAAGG - Intergenic
1003804585 6:9712900-9712922 CTTTAAAAAAAAATGGAAGAAGG + Intronic
1003991382 6:11490062-11490084 CAGTAATCATCAGTGGAGGAGGG + Intergenic
1004549773 6:16635787-16635809 CTGAAAACATGAGTGGAGGAAGG + Intronic
1004782991 6:18933002-18933024 CTTTAAACATAAATTCAGGAGGG + Intergenic
1005414162 6:25583546-25583568 CTGGAGACATAGATGGATGAAGG + Intronic
1005735837 6:28745000-28745022 CTGAAGAAATGAATGGAGGAGGG + Intergenic
1006233085 6:32602157-32602179 CTGAAAGCAAAAATGGAGGCTGG + Intergenic
1006620514 6:35360777-35360799 CTCTAAAAATAAATCGGGGATGG - Intronic
1007645588 6:43378058-43378080 CTGTAAACATTACTGGTGTAAGG + Intergenic
1008090184 6:47285946-47285968 TTGGGAACATAAGTGGAGGAAGG + Exonic
1009422346 6:63477839-63477861 CTGCAAACAAAAAGGGATGAAGG - Intergenic
1009766330 6:68080407-68080429 ATGTAAACATAAATTAAGAAAGG - Intergenic
1009992924 6:70865655-70865677 CAGTAATCATATATGGAGGTAGG - Intronic
1010658305 6:78538805-78538827 CTGGGAACAAAAATGGAGGCAGG + Intergenic
1011055666 6:83200909-83200931 CTGGAAAAATAAGTGGGGGATGG + Intergenic
1012432178 6:99175450-99175472 CTGTCATCATTGATGGAGGATGG + Intergenic
1012536238 6:100300543-100300565 CTAAAAACATGATTGGAGGATGG - Intergenic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1013665366 6:112342271-112342293 CTGATAACTTACATGGAGGAAGG + Intergenic
1013680249 6:112517380-112517402 ATTTGAACATAAATGGGGGAAGG + Intergenic
1014505057 6:122244974-122244996 CTGTAAACATAAATGTAAATGGG + Intergenic
1015255128 6:131170467-131170489 CAGTGAACTTAATTGGAGGAAGG - Intronic
1017296887 6:152807937-152807959 CTGGAAATGAAAATGGAGGAAGG - Intergenic
1017376239 6:153772530-153772552 ATGTGAAGATAAATGGAGAAGGG - Intergenic
1019169297 6:170122843-170122865 CTTTGAAGATAAAGGGAGGAGGG + Intergenic
1021482526 7:21133326-21133348 CTATAAACATAAGAGGAGAAGGG + Intergenic
1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG + Intronic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1024482781 7:49882457-49882479 CTGTAAAGAGAAAGAGAGGAAGG + Intronic
1025240122 7:57264779-57264801 CTGTAAACATACATTCAGGATGG - Intergenic
1025287636 7:57679285-57679307 CTGGAGACATAAATAGAGGAAGG + Intergenic
1026497727 7:70918317-70918339 CAGTATAGATAAGTGGAGGATGG + Intergenic
1027619404 7:80464992-80465014 CTTGCAAAATAAATGGAGGAAGG + Intronic
1028926367 7:96360924-96360946 CTATACACATAAATGGAGCAGGG + Intergenic
1029853152 7:103485768-103485790 CAATAAATAGAAATGGAGGATGG - Intronic
1030092027 7:105866180-105866202 CTGTGAACATTAATGGTGTAAGG - Intronic
1030478075 7:110062867-110062889 CAGTAAAAATACATGGAGCAAGG - Intergenic
1031492963 7:122411559-122411581 CTTAAAACAAAAAAGGAGGATGG + Intronic
1031540360 7:122987972-122987994 CTGGTAACATAAATGCAGAAAGG - Intergenic
1031971590 7:128068649-128068671 CTGAAATCAAACATGGAGGAAGG - Intronic
1032381617 7:131489680-131489702 CTGTAAAAATAAATGGTGGAGGG - Exonic
1032531822 7:132627196-132627218 ATGTAAAAATAAATGGCAGAAGG - Intronic
1032851552 7:135799545-135799567 CTGAAAACAGGAGTGGAGGATGG - Intergenic
1033352267 7:140571108-140571130 CAGTAAACAAAAATATAGGATGG + Intronic
1033937081 7:146599493-146599515 GTATAGACATAAAAGGAGGAAGG - Intronic
1034025318 7:147697174-147697196 CTGTTAACAGAAATGAAGAATGG - Intronic
1034724633 7:153324176-153324198 CCGTAAAAATATATGGTGGATGG - Intergenic
1035929409 8:3764165-3764187 GTGCAAATCTAAATGGAGGAGGG - Intronic
1041123971 8:54615813-54615835 CTGTTAACATAAATAAATGAGGG + Intergenic
1043062631 8:75524606-75524628 CAGTACACAGAAATGGATGAGGG + Intronic
1044541941 8:93418181-93418203 CTAAAAATATAAATGTAGGAAGG - Intergenic
1044657035 8:94559086-94559108 TTCTAATCATAAATGGAGGCTGG + Intergenic
1044845337 8:96374759-96374781 CAGTAGACTTAAATGCAGGATGG + Intergenic
1044900310 8:96937015-96937037 CTGGAAAGAAAAAGGGAGGAAGG - Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1046906972 8:119583856-119583878 CAGTATTCATAAATAGAGGAAGG - Intronic
1047757684 8:127931266-127931288 CTGGAAACATAAATGGAAAAGGG - Intergenic
1047822985 8:128541792-128541814 CTTTAAACATAAGTGAATGATGG - Intergenic
1048841687 8:138572348-138572370 CTGTAACCTCATATGGAGGAGGG + Intergenic
1048880133 8:138864995-138865017 ATGTGAACATAAATGGCTGAAGG - Intronic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1049538746 8:143195786-143195808 CTGTTGACTTAAATGTAGGAGGG - Intergenic
1051021685 9:12552581-12552603 CTGTAACCTTAAATGGAAGAAGG + Intergenic
1052741261 9:32395177-32395199 CTTAAAACATAAATGCAGGCTGG + Intronic
1052837040 9:33258604-33258626 CTGTGAGCATAAATGGATGCTGG + Intronic
1055739803 9:79375183-79375205 CTATAAAGATAAATCCAGGAGGG + Intergenic
1058092630 9:100822864-100822886 CTGTAACAATAAATGGAGAATGG - Intergenic
1059254955 9:112921446-112921468 TTCAAAGCATAAATGGAGGATGG + Intergenic
1185872969 X:3679945-3679967 CTGTAAACATTAATGCGGGGTGG + Intronic
1186902877 X:14076876-14076898 GAGAAAACATAAATGGATGATGG - Intergenic
1187071099 X:15889223-15889245 CTGTAAGAACAAATGGAGGAGGG + Intergenic
1187626930 X:21125367-21125389 CACTAAACATCAAAGGAGGATGG - Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1191894625 X:65979028-65979050 CTGTAAACAAAAGGGCAGGATGG - Intergenic
1192147522 X:68691738-68691760 CAGGAAACAAAAAAGGAGGAGGG - Intronic
1192298395 X:69874437-69874459 TTTTAAACATAAAGGGATGATGG - Intronic
1193590046 X:83377945-83377967 TTTTAATCATAAATGGATGACGG + Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194013820 X:88594758-88594780 TTGGAAAAATAAATGGGGGAAGG + Intergenic
1195051955 X:101105221-101105243 CTTAAAACATATATGGAGTAGGG + Intronic
1195506341 X:105661632-105661654 CTATAAAAATACATGGAGGCTGG + Intronic
1195879767 X:109580407-109580429 ATGGAAACAGAAATGCAGGAAGG - Intergenic
1196065618 X:111461095-111461117 CTCTAAACATCAAGAGAGGAAGG + Intergenic
1196199745 X:112872102-112872124 CTGTTTACACAAAAGGAGGAGGG - Intergenic
1196253557 X:113489466-113489488 CTGGAAATACAAATGAAGGAAGG + Intergenic
1197504262 X:127282105-127282127 CTTTAATCATAAATGGATGCTGG - Intergenic
1198282196 X:135153415-135153437 ATGTGATCATATATGGAGGAGGG - Intergenic
1198288763 X:135219107-135219129 ATGTGATCATATATGGAGGAGGG + Intergenic
1198504741 X:137290336-137290358 CTGTAAAAGGAAATGGAGGAGGG + Intergenic
1199012793 X:142777293-142777315 CTGTAGACATGAATGGAACATGG + Intergenic
1199101467 X:143805577-143805599 CTGTAAACCTCTATGGAGTAGGG + Intergenic
1199195514 X:145025055-145025077 CTGTAAAAGTAAATGAAAGAAGG + Intergenic
1201427554 Y:13870047-13870069 CTATAGACATAAATGTGGGAAGG - Intergenic
1201704529 Y:16921616-16921638 CTTTGAACATGAATGGGGGATGG - Intergenic
1202266565 Y:23025635-23025657 ATTTAAACATCTATGGAGGAAGG + Intergenic
1202419558 Y:24659378-24659400 ATTTAAACATCTATGGAGGAAGG + Intergenic
1202451228 Y:25010706-25010728 ATTTAAACATCTATGGAGGAAGG - Intergenic