ID: 1190306460

View in Genome Browser
Species Human (GRCh38)
Location X:49085576-49085598
Sequence CATAAAAAGAAGCAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 857
Summary {0: 1, 1: 1, 2: 7, 3: 76, 4: 772}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190306456_1190306460 -4 Left 1190306456 X:49085557-49085579 CCAAACAAAGATTACCAGGCATA 0: 1
1: 2
2: 10
3: 67
4: 247
Right 1190306460 X:49085576-49085598 CATAAAAAGAAGCAGGAGGCTGG 0: 1
1: 1
2: 7
3: 76
4: 772
1190306454_1190306460 28 Left 1190306454 X:49085525-49085547 CCTAAAAAGGTAAAGTTGACAAT 0: 1
1: 0
2: 4
3: 101
4: 471
Right 1190306460 X:49085576-49085598 CATAAAAAGAAGCAGGAGGCTGG 0: 1
1: 1
2: 7
3: 76
4: 772

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190306460 Original CRISPR CATAAAAAGAAGCAGGAGGC TGG Intronic
900201472 1:1409150-1409172 CTTAAAAAAAAAGAGGAGGCCGG + Intergenic
901246396 1:7735199-7735221 CTTCAGAAGAAGCAAGAGGCTGG + Intronic
901533762 1:9869619-9869641 TATAAAAAGCAGCAACAGGCCGG - Intronic
901757497 1:11450245-11450267 AGTAAAAAGAAGAAGGAGACAGG + Intergenic
901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG + Intergenic
902542935 1:17167170-17167192 CAAAGACAGAAGCAGCAGGCAGG - Intergenic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
902630912 1:17704038-17704060 TATAAAAAGAAGAAAGAGGCCGG - Intergenic
902831623 1:19017551-19017573 CATAAAAAGAAGAAGAGGCCGGG + Intergenic
902987584 1:20164519-20164541 CCTAGAAGGAATCAGGAGGCAGG + Intronic
903408317 1:23117793-23117815 ATTAAAAACAAACAGGAGGCTGG + Intronic
903506501 1:23839399-23839421 AAAAAAAAAAAGCTGGAGGCCGG - Intergenic
904135672 1:28310581-28310603 CATAGACAGAAGCACCAGGCTGG - Intergenic
904902087 1:33865406-33865428 AAAAAAAAAAAGCAGGGGGCTGG + Intronic
905057206 1:35106310-35106332 CTTAAAAACAAGCAGTTGGCCGG + Intronic
905192726 1:36248174-36248196 TATTAAAAGATGAAGGAGGCTGG - Intronic
905378684 1:37544148-37544170 AAAAAAAAGAAACAAGAGGCCGG + Intronic
905664425 1:39754117-39754139 CATAAAAACAGGCAGTGGGCTGG - Intronic
905847514 1:41244737-41244759 CTAAAAAAGAAGCAGGAGGCTGG - Intergenic
906119418 1:43378678-43378700 CATGACAATAAGAAGGAGGCAGG + Intergenic
906273924 1:44501940-44501962 GAGAAAAAGAAGGAGGAGGAAGG + Intronic
906302670 1:44694810-44694832 CATAAAAAGACTCAATAGGCTGG - Intronic
907513225 1:54977877-54977899 AAAAAAAAGAAGAAGAAGGCAGG + Intergenic
908345767 1:63230933-63230955 CATAACTAGAAGCTGGAGGTTGG + Intergenic
908519103 1:64923833-64923855 TTTAAAAAGCAGCAGGAGTCGGG - Intronic
908615851 1:65921699-65921721 TACAAAAACAAGCAGCAGGCTGG + Intronic
908896253 1:68903644-68903666 CACAGAAAGAAGCAGGTGGAAGG - Intergenic
909420902 1:75463924-75463946 TATAAATAGAAACAAGAGGCCGG + Intronic
909646427 1:77922062-77922084 AATAAAAAGGTCCAGGAGGCTGG - Intronic
910187265 1:84557557-84557579 AAAAAAAAAAAGAAGGAGGCTGG + Intronic
910480544 1:87653938-87653960 AATAAAAAGAAAAAGAAGGCTGG + Intergenic
911229886 1:95349775-95349797 CATAAAAACAAGCAAGTGGAAGG - Intergenic
912102390 1:106226592-106226614 CAAAAGAAGAAGCAAGATGCTGG + Intergenic
912201646 1:107464752-107464774 CATAAAAAGGTGCAGGAGGGTGG - Intronic
912469663 1:109897822-109897844 TATAAAAACAAGCAGGGAGCTGG - Intergenic
912489551 1:110054400-110054422 GATATAATGTAGCAGGAGGCTGG - Exonic
912844203 1:113064400-113064422 CAGAGGCAGAAGCAGGAGGCAGG + Intergenic
912922531 1:113883184-113883206 CATTAAAAGAAACCAGAGGCCGG + Intronic
914787409 1:150847133-150847155 CAGAAAAAGAAGGGGGAGGCTGG + Intronic
915092251 1:153434787-153434809 CATTAACAGAAGCTGGAGACGGG - Intergenic
915615726 1:157036616-157036638 TTTTAAGAGAAGCAGGAGGCTGG - Intronic
915750670 1:158206865-158206887 TAAAAAATGAAACAGGAGGCCGG - Intergenic
915799901 1:158779343-158779365 GATGAAAATAAGCAAGAGGCTGG - Intergenic
917219835 1:172717026-172717048 TAGAAAAACAAGCTGGAGGCCGG + Intergenic
917656284 1:177129413-177129435 CAAGCAAGGAAGCAGGAGGCTGG + Intronic
917697911 1:177546993-177547015 CATAAAAAGAAGCCTGAAGAAGG + Intergenic
917807153 1:178624277-178624299 CATCAAAAGAAACAAGGGGCTGG - Intergenic
918519267 1:185397377-185397399 TATAAAAATAAGCAGTAGCCTGG + Intergenic
918560119 1:185855414-185855436 AATAAAAAGAAGAAGCAGGCAGG - Intronic
918901066 1:190418343-190418365 CATAAAAAGAATAAGAAGGCTGG - Intronic
919536474 1:198794125-198794147 AATAAAAAGAAGGATAAGGCAGG - Intergenic
919567326 1:199205061-199205083 CATAAAAATATGCAGGAGACTGG + Intergenic
919590631 1:199497779-199497801 CAGAAAAAGAAGAACTAGGCCGG + Intergenic
919751871 1:201042803-201042825 CATAAAAAACAGCAGGATGAGGG - Intronic
920381490 1:205536960-205536982 AGTAAAAAGAAGCAGGAAGAAGG - Intergenic
920768712 1:208859100-208859122 CATAAAAAGAAATAGATGGCCGG + Intergenic
920899794 1:210097038-210097060 CACAAAAATAAGCAGGACGGAGG - Intronic
920903499 1:210136288-210136310 GAGAGAGAGAAGCAGGAGGCAGG + Intronic
921340652 1:214130473-214130495 CATAATAAGTTACAGGAGGCAGG + Intergenic
921543050 1:216442371-216442393 GGTAAAAAGAAACGGGAGGCTGG + Intergenic
921861220 1:220044426-220044448 CAAAAAATGTATCAGGAGGCTGG + Intronic
921866100 1:220089118-220089140 AAAAAAAAGAAGGAGGAGGAAGG + Intronic
923071696 1:230571077-230571099 ACTAAAATGGAGCAGGAGGCAGG - Intergenic
923228354 1:231960546-231960568 GATATAAAGAAGGAGGTGGCCGG - Intronic
923462590 1:234219992-234220014 GATCAGAAGAAGCAGGAGGAGGG + Intronic
923488193 1:234457036-234457058 TACAAAAAGAGGGAGGAGGCTGG + Intronic
923585540 1:235266979-235267001 CATAAAAACCATCAGTAGGCTGG + Intronic
923881033 1:238104419-238104441 GATAAAAAGAAAATGGAGGCTGG - Intergenic
924232161 1:241971263-241971285 ATTGAAAAGAAGCAGCAGGCCGG - Intergenic
924583065 1:245338290-245338312 TACAAAAACAAGCAGCAGGCTGG - Intronic
924601614 1:245494740-245494762 CATAAAAAGAAACTGGGGCCAGG + Intronic
924679864 1:246220616-246220638 CATGAACAGCAGCAGGAGGCAGG + Intronic
924815189 1:247435240-247435262 CATTAAAAAAAACAGAAGGCAGG + Intronic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1063547624 10:6997808-6997830 CCTAAAAAGAAGCAGCAGCTGGG - Intergenic
1063656988 10:8000411-8000433 CATAAAAAAAAGAAAAAGGCCGG - Intronic
1064441147 10:15354637-15354659 CATAAAGAGAAGAAACAGGCTGG + Intronic
1064520944 10:16200184-16200206 AATTAAAAGAAAAAGGAGGCTGG + Intergenic
1064614771 10:17141454-17141476 CCTTAAAAGCAGCTGGAGGCTGG - Intergenic
1064828261 10:19430410-19430432 CATAAAGAAAATGAGGAGGCCGG - Intronic
1064972612 10:21081410-21081432 CATAGAAAAAACCAGGAGCCAGG + Intronic
1065830959 10:29613184-29613206 AAAAAAAAGAAGAAGGAGGAGGG + Intronic
1066001885 10:31112252-31112274 CATGACAGGAAGCATGAGGCTGG + Intergenic
1066746508 10:38606836-38606858 AATAAAAAGAAACCTGAGGCTGG - Intergenic
1067254880 10:44627637-44627659 TAGGAAAAGAAGCAGCAGGCAGG + Intergenic
1067572131 10:47379435-47379457 AATAAGAAGGAGCAGGAGGATGG + Intronic
1067614313 10:47748560-47748582 CATTAAAAGCAGCTAGAGGCAGG + Intergenic
1067930100 10:50552073-50552095 TATAAAAACAGGCAGAAGGCTGG + Intronic
1068454661 10:57238882-57238904 CATGAAAAGAACCTGGAGGGGGG + Intergenic
1068784789 10:60959989-60960011 CATAATAATAAACAGTAGGCTGG + Intronic
1068997906 10:63228542-63228564 GATAAAAACAAGAAGCAGGCTGG + Intronic
1069227919 10:65967659-65967681 GATAAAATGATGTAGGAGGCTGG - Intronic
1069476664 10:68739443-68739465 CATAAAAAAAAGAATGAGGCTGG - Intronic
1070086608 10:73244197-73244219 GATAAAAAGGAACATGAGGCCGG + Exonic
1070293831 10:75141839-75141861 AAAAAAAAGAAGCAAAAGGCAGG - Intronic
1070338118 10:75472866-75472888 CCTAACAGGAAGCAGGAGGGTGG + Intronic
1070379553 10:75868350-75868372 CATAAAAAGAAAAAGGAAACAGG - Intronic
1070471201 10:76781404-76781426 GAAAAGAAGAAGCTGGAGGCCGG - Intergenic
1070490456 10:76970996-76971018 CTTAAAAAGAAGCATGATGCAGG - Intronic
1071629723 10:87208538-87208560 CATTAAAAGCAGCTAGAGGCAGG + Intergenic
1072002376 10:91209458-91209480 ATTAAAAAGAAAAAGGAGGCCGG + Intronic
1072109121 10:92301185-92301207 CATGTAAAGAATTAGGAGGCAGG - Intronic
1072415557 10:95243909-95243931 CATAGAGACAAGCAGGAGGGTGG + Intronic
1072590442 10:96824060-96824082 CATATAAAGACTCAGGAGGCTGG + Intergenic
1072605164 10:96975218-96975240 CAGAAAAAAAAGTAGGAAGCTGG + Intronic
1072606882 10:96991806-96991828 CATAAGCAGAGGCAGGAGGAGGG - Intergenic
1072936799 10:99720890-99720912 AATATAAAGATGCAGGAGGAAGG + Intronic
1073340866 10:102743749-102743771 AATAAAAAGTAGGAGGAAGCCGG - Intergenic
1073476804 10:103759091-103759113 CATAGAAGGAAGCAGGGGGAAGG - Intronic
1073518118 10:104097427-104097449 CATGGTGAGAAGCAGGAGGCTGG - Intergenic
1073649811 10:105346218-105346240 CATCAGGAGAAACAGGAGGCAGG - Intergenic
1074358067 10:112803362-112803384 TCTAAAATGAAGAAGGAGGCTGG - Intronic
1075023990 10:118970375-118970397 CATATAAAGAGGCTGCAGGCTGG - Intergenic
1075154401 10:119962391-119962413 CAAAAAGAGATGCAGCAGGCAGG + Intergenic
1075234206 10:120711831-120711853 TAGGAAAAGATGCAGGAGGCTGG + Intergenic
1075451026 10:122552076-122552098 AAAAAAAAGAAGCAGGACGGGGG + Intergenic
1075708417 10:124517106-124517128 CAAAAAAAGATGAAGGAGCCCGG + Intronic
1075888091 10:125919499-125919521 CAAAAAAAGGAGCAGCAGCCAGG - Intronic
1075970180 10:126645269-126645291 AAAAAAAAAAAGCTGGAGGCTGG + Intronic
1076101881 10:127788334-127788356 CATAAAAAGCAACAAGAGGATGG - Intergenic
1076463509 10:130662397-130662419 CATAAGAAAAAGCTGAAGGCTGG - Intergenic
1076735591 10:132457613-132457635 CATGAAAAGGAGCCAGAGGCTGG - Intergenic
1077857171 11:6139778-6139800 CATAAAAAGAAAAATGAAGCTGG + Intergenic
1078130650 11:8611559-8611581 AATAAAAATAAGAAGCAGGCTGG + Intergenic
1078499090 11:11851530-11851552 GATAAAAAGAAGCTGGATGAAGG - Intronic
1078667979 11:13341778-13341800 AATGAAAAGAAACAGGAGCCAGG + Intronic
1078797785 11:14610434-14610456 AATAGTAGGAAGCAGGAGGCAGG - Intronic
1079018842 11:16892605-16892627 AAAAAAAAGAAGCTGGAAGCTGG - Intronic
1079514219 11:21248046-21248068 TACAAAAAAGAGCAGGAGGCCGG + Intronic
1079996946 11:27305019-27305041 CATGAATAGCAGTAGGAGGCAGG + Intergenic
1080195983 11:29609396-29609418 GGAAAAAAGAAGCAGGGGGCAGG + Intergenic
1080287265 11:30629750-30629772 GATAAGTAGAAGCAGGAGGTTGG - Intergenic
1080501924 11:32879442-32879464 AAAAAAAAAAAGCAGCAGGCTGG + Intergenic
1081086144 11:38803874-38803896 CATTAACACAAGTAGGAGGCGGG - Intergenic
1081327748 11:41766892-41766914 CAAAAAAAGAAGCAGTGGACGGG + Intergenic
1081861980 11:46338545-46338567 TACAAAAACAAGCAGCAGGCTGG + Intronic
1082182216 11:49133480-49133502 AGTAAAAAGGAGCAGGAGGAGGG + Intergenic
1082880219 11:58029832-58029854 AAAAAAAAAAAGGAGGAGGCAGG - Intronic
1082920952 11:58493263-58493285 GAAAAAAAGAAAAAGGAGGCTGG + Intergenic
1083278497 11:61611099-61611121 CATAGAAACAGGCGGGAGGCTGG + Intergenic
1083482395 11:62957992-62958014 AAAAAAAAGAAGAAAGAGGCTGG - Intronic
1083825433 11:65200637-65200659 CAAAAAAAGAACAAGGCGGCCGG - Intronic
1084346295 11:68551781-68551803 TATAAAAATAAAAAGGAGGCCGG - Intronic
1084606703 11:70176693-70176715 CATGACAGGAAGCAGGGGGCGGG - Intronic
1084737256 11:71113581-71113603 CATATAAAGAAACAGGAGCAAGG + Intronic
1085299416 11:75449672-75449694 CATAGGTAGAAGTAGGAGGCTGG - Intronic
1085332984 11:75668386-75668408 CACAAGAAGAAAGAGGAGGCCGG - Exonic
1085952067 11:81344123-81344145 CATATAAAGGACCAGGAGGTGGG - Intergenic
1086560520 11:88163088-88163110 CATAAAAAGCAGTACAAGGCAGG - Intronic
1086683290 11:89701466-89701488 AGTAAAAAGGAGCAGGAGGAGGG - Intergenic
1086760731 11:90627225-90627247 TATAAAAACAAGCAATAGGCTGG + Intergenic
1086846929 11:91761875-91761897 GGAAAAAAGAGGCAGGAGGCAGG + Intergenic
1087079181 11:94153218-94153240 CATACAAAGAAAAAGGAAGCAGG - Intronic
1087144499 11:94798728-94798750 CATAGAGAGAGGCAGGAGCCAGG + Intronic
1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG + Intergenic
1088480307 11:110290833-110290855 TATAAAAACAGGCAGTAGGCTGG + Intronic
1089391719 11:118106778-118106800 TATAAAAAGATGCACGGGGCTGG - Intronic
1089575640 11:119440910-119440932 AAAAAACAGAAGAAGGAGGCCGG - Intergenic
1089957539 11:122585646-122585668 GAGAAAAAGAGGCAGGAGGAAGG + Intergenic
1090186543 11:124742788-124742810 CATAATAACAAGCAGCAAGCAGG + Intronic
1090350136 11:126102736-126102758 CCTAGCAAGGAGCAGGAGGCAGG + Intergenic
1090496114 11:127214365-127214387 CATAAAAAGAAGCCAGAAGTGGG - Intergenic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1092694775 12:11158986-11159008 AATAAAAAAAAGGAGGAGGAAGG + Intronic
1092750689 12:11716458-11716480 CAGAAACAGAAGCAGGATGATGG - Intronic
1092880428 12:12883879-12883901 GATAAAAACAAGATGGAGGCAGG + Intergenic
1092925661 12:13269868-13269890 CATAAAAAGCAGCAGCACCCGGG + Intergenic
1092978400 12:13768737-13768759 ATTAAAAATAAGCAGGTGGCCGG + Intronic
1093778012 12:23099878-23099900 CAGACCAAGAAGCAGGAAGCAGG + Intergenic
1094147508 12:27245154-27245176 TATAAAAAGAAGTGGGAGGTGGG + Intronic
1094449960 12:30573935-30573957 CATAAAAATAGGCAGTAGCCTGG + Intergenic
1094478883 12:30864246-30864268 CAGAAAAAGAAGCTGAGGGCAGG - Intergenic
1094824966 12:34262905-34262927 CAAAAAAAGAAAGATGAGGCCGG - Intergenic
1095086037 12:38058077-38058099 CAAAAAAAGAAAGATGAGGCCGG + Intergenic
1095253655 12:40008245-40008267 CATAAAAAGCAGCAGGGTGGTGG + Intronic
1095772081 12:45971147-45971169 CATTAAATGAAGAAGGAAGCAGG - Intronic
1095936557 12:47689743-47689765 CATAAAACCAAGAAGCAGGCCGG + Intronic
1096776189 12:53965839-53965861 GATAAAAAGAGGCGGGAGGGAGG + Intergenic
1097744092 12:63280576-63280598 GATAAAGAGAAGGAGGAGGCAGG + Intergenic
1098472618 12:70862973-70862995 CATAAAAGGAAGAAGGAAACTGG + Intronic
1098516326 12:71380469-71380491 CATAAAAAGAAGAGAGAGGTTGG - Intronic
1099109320 12:78537683-78537705 CATATAGAGAAGGAGGAGCCTGG - Intergenic
1099182924 12:79488280-79488302 CTTAAAAAGTAGAAGGAGGCCGG + Intergenic
1099398439 12:82170982-82171004 AAGAAAAAGAAGGAGGAGGAGGG + Intergenic
1099472006 12:83062020-83062042 TAGAAAAAGAAGCTTGAGGCCGG - Intronic
1099879883 12:88455220-88455242 TATAAAAAGAAGAAAGAGGCCGG - Intergenic
1101746502 12:107545536-107545558 AATAAAAAGAAGAAGTAGCCTGG - Intronic
1101852709 12:108417063-108417085 CAAAAGCAGGAGCAGGAGGCAGG + Intergenic
1102328090 12:112006235-112006257 AATTAAAAGGAGCAAGAGGCAGG + Intronic
1102808078 12:115799650-115799672 CAAAAAAAGAAGAAGAAGGGGGG + Intergenic
1103020515 12:117530463-117530485 AATAAAAACAAGCAGGAGGTTGG + Intronic
1103478605 12:121236396-121236418 CATGAACACCAGCAGGAGGCTGG + Intergenic
1103714318 12:122935169-122935191 CAAAAAAAAGAGCAGGTGGCAGG + Intronic
1104041873 12:125136040-125136062 CAAAAAAGGAGGCAGGTGGCCGG - Intronic
1104216132 12:126735744-126735766 CCTAACAAGAAGCAGGAGCCAGG - Intergenic
1104577371 12:129980194-129980216 CATTCATAGAATCAGGAGGCTGG + Intergenic
1105220462 13:18321869-18321891 CAAAAAAAGGAGCAGCAGCCAGG + Intergenic
1105559473 13:21477062-21477084 CACAAAAAAAACCAGGAGACTGG + Intergenic
1105983809 13:25545929-25545951 CATAAAAAACAGAAGTAGGCTGG - Intronic
1106365118 13:29071294-29071316 TATAAAAACAAGCAAGATGCTGG - Intronic
1106510638 13:30409480-30409502 CACAAAAAGAACCAGGATACAGG + Intergenic
1106611006 13:31280531-31280553 CATATAATGAAGCAGGAGTGGGG - Intronic
1106887134 13:34199322-34199344 CATAAAAAGAAAGAGTAGACTGG + Intergenic
1107249434 13:38340750-38340772 CATAAAAAGAATCAGTAGGATGG - Intergenic
1107442126 13:40437418-40437440 TATAAAATTAAACAGGAGGCTGG + Intergenic
1107470676 13:40688377-40688399 CAAAAAAAGAAAAAAGAGGCCGG - Intergenic
1107925198 13:45253777-45253799 GATAAAAAGAAAGAAGAGGCTGG + Intronic
1108730662 13:53232127-53232149 CATAAAGAGAAGAAGGAGGCGGG + Intergenic
1109589154 13:64454124-64454146 CATCAAAAGAGACAGGCGGCAGG + Intergenic
1110144849 13:72178187-72178209 CATAAAAGAAAGCTGGGGGCTGG - Intergenic
1110229997 13:73158006-73158028 CACAAAAATTAGCAGGGGGCCGG - Intergenic
1111298365 13:86314139-86314161 CATAAAAAGAAGCATCACTCAGG - Intergenic
1111372098 13:87332845-87332867 CATGAAAACAACCAGGAGGGAGG - Intergenic
1112451350 13:99513668-99513690 TATAAAAACAAGCAGTAAGCTGG - Intronic
1112722466 13:102260131-102260153 GAAAAAAAGAAGCGGGAGGAGGG + Intronic
1113181737 13:107636143-107636165 CACCAAAAGAAGCATGAAGCAGG + Intronic
1114234775 14:20814230-20814252 GATTAACAGAAGGAGGAGGCAGG - Intergenic
1114411483 14:22504684-22504706 CAAAAAAAGAAGAAGGAAGCTGG + Intergenic
1114420890 14:22581904-22581926 GTTAAAAAGAGGCAGAAGGCCGG + Intronic
1114456520 14:22858272-22858294 CTTAAAAAGAGCCAGGAGGCCGG + Intergenic
1114528516 14:23380909-23380931 GAGAACAGGAAGCAGGAGGCAGG - Intergenic
1115026701 14:28755408-28755430 CAAGAAAAGAAGAAGGGGGCAGG + Intergenic
1115103695 14:29734334-29734356 CATATAAAAAAGCAGGAGGCTGG - Intronic
1115324051 14:32116618-32116640 AATAAAAAGCATCAGTAGGCAGG + Intronic
1115619536 14:35127816-35127838 CATGAAAACAAGCAGTAGGCTGG + Intronic
1115682984 14:35762550-35762572 CTTAAAATGTAGCAAGAGGCTGG - Intronic
1117374327 14:55107175-55107197 CATAAAAATACCAAGGAGGCCGG - Intergenic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1117770692 14:59131247-59131269 CATCAAAAGCAGTAGGTGGCAGG - Intergenic
1118200127 14:63663739-63663761 CATGAACAGTGGCAGGAGGCAGG - Intergenic
1118415350 14:65529527-65529549 TAAAAACAGATGCAGGAGGCCGG - Intronic
1119097045 14:71842696-71842718 CATCAAAAAAAGCTGGAGGCCGG - Intergenic
1119260679 14:73236518-73236540 TAAAAAAAGAAGAAGAAGGCTGG + Intergenic
1120067901 14:80066172-80066194 GTTAAAAAGAAGCAGGAGCTAGG + Intergenic
1120347956 14:83314162-83314184 CAGAAAATGATGCAGAAGGCTGG - Intergenic
1120940076 14:89939488-89939510 CAGCAACAGGAGCAGGAGGCGGG + Intronic
1121055013 14:90845283-90845305 CATAAAATGACACAGTAGGCCGG - Intergenic
1121160451 14:91734425-91734447 CATAAAAAGGATAAGAAGGCTGG - Intronic
1121398653 14:93652056-93652078 AATAAAAAGAAACAAAAGGCGGG - Intronic
1122383424 14:101327051-101327073 CCTTAAATGAAGCAGGAGCCAGG - Intergenic
1122713431 14:103677977-103677999 AAAAAAAAAAAGCATGAGGCTGG + Intronic
1122925409 14:104897303-104897325 CATAAAAATAGGCAGTAAGCAGG + Intergenic
1123197978 14:106635266-106635288 AATAATGAGAAGCAGGAGGAGGG - Intergenic
1202870059 14_GL000225v1_random:154507-154529 CAAAAAAAGAAGCAGCAGCCAGG + Intergenic
1123414699 15:20086809-20086831 CTTAAAAAAAAGAAAGAGGCTGG + Intergenic
1123524041 15:21093923-21093945 CTTAAAAAAAAGAAAGAGGCTGG + Intergenic
1123754438 15:23385986-23386008 AATAAATAGATGCTGGAGGCAGG + Intergenic
1124217438 15:27819250-27819272 CAGAAATAGAAGCAGAAGGAAGG + Intronic
1124992741 15:34692025-34692047 AAGAAAGAGAAGCAGGAGACAGG + Intergenic
1125054926 15:35347446-35347468 AAAAAAAAAAAGGAGGAGGCTGG - Intronic
1125126740 15:36232368-36232390 CCAAGAAAGAAGTAGGAGGCAGG + Intergenic
1125241031 15:37575969-37575991 TAAAAATAGAAGGAGGAGGCCGG - Intergenic
1125855100 15:42940946-42940968 AAAAAAAAAAAGCAGGGGGCAGG - Intergenic
1125928034 15:43579187-43579209 CACAAAAACAAGCAGGCTGCAGG + Intronic
1125941178 15:43678758-43678780 CACAAAAACAAGCAGGCTGCAGG + Intergenic
1126039853 15:44579221-44579243 CATAAGAAAAAGCAGGAAGAGGG + Intronic
1126404998 15:48314536-48314558 CATAAAAAAAAGAGTGAGGCTGG - Intergenic
1126586101 15:50289034-50289056 CTTAAAAAGAAGTTGGAGCCTGG - Intronic
1127087445 15:55437663-55437685 TATAAAAGGTAGAAGGAGGCAGG + Intronic
1127253400 15:57266371-57266393 CATAAAAATAGGCAGCAGCCAGG - Intronic
1127367800 15:58308065-58308087 CATAAAAAGAAACAGGGGGAGGG - Intronic
1127446653 15:59070018-59070040 AAAAAAAAAAAGCAGGAGGTGGG - Intronic
1127782425 15:62328931-62328953 CATAAAAATAATCTGTAGGCCGG - Intergenic
1127853667 15:62937050-62937072 CATTAAAAGAAACAAGAGGCCGG - Intergenic
1128042551 15:64588130-64588152 CTTAAAAAGAAGGGGAAGGCCGG + Intronic
1128472536 15:67967578-67967600 CATAAAAGGCAGCAGGACCCTGG - Intergenic
1128965248 15:72051831-72051853 CATGAACAGCAGGAGGAGGCAGG + Intronic
1129080279 15:73033359-73033381 CATAAAAAGGTGCTGTAGGCCGG + Intergenic
1129377752 15:75144973-75144995 CATGAACAGAGGCAGGAGACAGG - Intergenic
1129589675 15:76904667-76904689 CAGCAACAGAGGCAGGAGGCTGG + Intronic
1130543502 15:84838957-84838979 CTGAGAAAGAAGCAGGAGACTGG - Intronic
1130621909 15:85472209-85472231 CAAAAAACAAAGCAGGAAGCTGG + Intronic
1130730788 15:86489928-86489950 CTTAAAAAGAAACAGCAGGCAGG + Intronic
1131479757 15:92770696-92770718 TATAAAAAGAAGCTTGAGGCTGG - Intronic
1131608464 15:93935221-93935243 GATCAAAAGAAGGAGGAGGCCGG + Intergenic
1132094256 15:98970337-98970359 TAAAAAAAGATGCAGGAGGCGGG - Intronic
1132114578 15:99126144-99126166 GACAAAAAGAAGTAGAAGGCAGG - Intronic
1132701685 16:1224820-1224842 CATAAACGGCAGCTGGAGGCCGG + Intronic
1132823612 16:1891031-1891053 TAAAAAAAGAATCAGGAGGCTGG + Intergenic
1133228923 16:4357163-4357185 CAGCAAAAGAAGGAGGAGGTAGG - Exonic
1133323298 16:4928139-4928161 CAAAAAATGAAAAAGGAGGCTGG - Intronic
1133401995 16:5494873-5494895 CATAAAAAGAAGGAGTAAACAGG - Intergenic
1133850309 16:9497259-9497281 CATAAAAACAACCAGGAAGAGGG - Intergenic
1134398214 16:13884944-13884966 AAAAAAAAGAAGAAGAAGGCCGG - Intergenic
1134640956 16:15828885-15828907 TTTAAAAAGAAGGAAGAGGCCGG + Intronic
1134652253 16:15919110-15919132 TATAAATAGAAACAGCAGGCCGG + Intergenic
1135103378 16:19625968-19625990 AATAAATAGAAGGAGGGGGCCGG - Intronic
1135342435 16:21660690-21660712 AATAAAAACAAGATGGAGGCTGG - Intergenic
1135551364 16:23400671-23400693 CTTAAAAAGCAGCAGATGGCTGG + Intronic
1135553471 16:23416323-23416345 CAGAAAAAGAAACATCAGGCTGG - Intronic
1135595787 16:23741869-23741891 CACAAAAACAGGCAGCAGGCAGG - Intergenic
1135633333 16:24053443-24053465 TACAAAAACAGGCAGGAGGCTGG + Intronic
1135869744 16:26138340-26138362 CATAAAAGGAGGTAGGAGGGAGG - Intergenic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1135936838 16:26787740-26787762 CAGACAAAGAAGCAGGACTCAGG + Intergenic
1136235226 16:28909726-28909748 AAAAAAAAAAAACAGGAGGCCGG + Intronic
1136595682 16:31248124-31248146 AACAAAAAGAAGCAGAAGGATGG + Intergenic
1137310007 16:47245820-47245842 AAAAAAAAAAAGGAGGAGGCAGG - Intronic
1137550865 16:49436698-49436720 GAGAGAAAGAAACAGGAGGCAGG - Intergenic
1137687439 16:50396239-50396261 CAAAAAAGGAAGCAGTGGGCAGG + Intergenic
1138437780 16:57015223-57015245 CACAAGAAGAGGCTGGAGGCCGG - Intronic
1138958099 16:61995671-61995693 CATAAAAAGTAAAAGTAGGCCGG - Intronic
1139533038 16:67552794-67552816 CATTAGAAGAAGCAAGAGTCTGG + Intergenic
1139718591 16:68834376-68834398 CAAAAAAATAAAAAGGAGGCTGG - Exonic
1139808347 16:69589288-69589310 CTAAAAAAGAAGTAGGAGGCTGG - Intronic
1140697382 16:77548515-77548537 CATAAGAAGAAGGAGTTGGCCGG + Intergenic
1140949188 16:79799679-79799701 CAGAGAAAGAACCAAGAGGCTGG - Intergenic
1141505674 16:84476656-84476678 CATAAAGACAAGAGGGAGGCAGG + Exonic
1141507855 16:84491141-84491163 CAAAAACAGAAGTAGGGGGCTGG + Intronic
1141549614 16:84796766-84796788 AAAAAAAAGAAAAAGGAGGCTGG - Intergenic
1142307100 16:89291927-89291949 TTTTAAAAGAGGCAGGAGGCAGG + Intronic
1142309580 16:89304782-89304804 CCTAAAAGTGAGCAGGAGGCAGG - Intronic
1142638044 17:1270105-1270127 AATAAAAAGAGGCAGAGGGCCGG - Intergenic
1142872726 17:2831371-2831393 AAGAAAAAGAAATAGGAGGCTGG - Intronic
1143196071 17:5077416-5077438 AACAAAAACAAGCTGGAGGCCGG + Intergenic
1143349705 17:6278260-6278282 CATAAAAATAAGCTGGAGGCCGG - Intergenic
1143360899 17:6370192-6370214 AATAAAATGAACAAGGAGGCCGG + Intergenic
1143361204 17:6372771-6372793 GAGAAAAAAAAGAAGGAGGCAGG + Intergenic
1143612691 17:8028765-8028787 CATCATAATAGGCAGGAGGCTGG - Intergenic
1143761817 17:9110257-9110279 AAAAAAAAGAGGCAGGAGGTAGG - Intronic
1143877472 17:10003103-10003125 CGTAACATGAAGCAGAAGGCTGG + Intronic
1144140051 17:12339548-12339570 CATAAAGAGATGGAGGAGGCCGG - Intergenic
1144218925 17:13082627-13082649 CATATAAAGAAGGAGGAGGAGGG + Intergenic
1144366497 17:14549822-14549844 CAAAAAAAAAAACAGGAAGCAGG - Intergenic
1144446931 17:15340251-15340273 CTTAAAAAGTAACAGTAGGCCGG + Intronic
1144694458 17:17292606-17292628 AATAAAAAGGAACAGGCGGCCGG - Intergenic
1144712220 17:17409332-17409354 AAAAAAAAGAAGGAGGAGTCAGG - Intergenic
1146086910 17:29838366-29838388 CATGAATGGAAGCAGGAAGCAGG + Intronic
1146174712 17:30658415-30658437 CAAAAAAAAAAGAAAGAGGCTGG + Intergenic
1146206570 17:30910043-30910065 TTTAAAAGGAAACAGGAGGCTGG + Intronic
1146348172 17:32074426-32074448 CAAAAAAAAAAGAAAGAGGCTGG + Intergenic
1146861903 17:36309920-36309942 CATAAAAAGAAACAACAGACTGG - Intronic
1147056690 17:37840235-37840257 TCTAAAAAAAACCAGGAGGCCGG - Intergenic
1147092231 17:38114024-38114046 CATAAAAAGAAACAACAGACTGG - Intergenic
1147104978 17:38206475-38206497 CATAAAAAGAAACAACAGACTGG + Intergenic
1147254320 17:39173150-39173172 AAGAAAAAGAACCAGGAGGGAGG + Intergenic
1147319014 17:39634897-39634919 CAGGAAAAGCAGCAGGTGGCTGG + Intronic
1147411887 17:40259176-40259198 CCTAAAAATCAGCACGAGGCCGG - Intronic
1147684343 17:42277613-42277635 CAGAGAAGGAAGCAGGAAGCAGG + Intergenic
1147694600 17:42341872-42341894 TACAAAAACAAGCAGCAGGCTGG + Intronic
1147744167 17:42684937-42684959 AAAAAAAAGAAGCAGAGGGCAGG + Intronic
1147752697 17:42745939-42745961 CTTAAAAAGAAGAGGGAGGCCGG - Intergenic
1147791053 17:43014502-43014524 CATGGAAAGAGGCAGGGGGCAGG + Intergenic
1148097824 17:45066006-45066028 GAAAAAAAGGGGCAGGAGGCTGG - Intronic
1148424522 17:47581989-47582011 TATAAAAAGAAACAACAGGCTGG - Intronic
1148435253 17:47679220-47679242 GAGAAAAAGAAGCAGAGGGCTGG - Intronic
1148567932 17:48644806-48644828 AAAAAAAAGAAGTTGGAGGCAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149075585 17:52594027-52594049 AATAAACAGAAGCAGTAGCCAGG - Intergenic
1149286925 17:55175611-55175633 CCCAAAAACTAGCAGGAGGCTGG + Intergenic
1149495348 17:57114010-57114032 CCTGAAAATAAGCAGTAGGCAGG - Intronic
1149812789 17:59693691-59693713 AACAAAAAGGAGCAGGGGGCAGG - Intronic
1149818677 17:59752268-59752290 CATAAAAACAGGTAGCAGGCTGG + Intronic
1150070379 17:62145090-62145112 TATAAAAACAAGCAGGAGCCAGG - Intergenic
1150216287 17:63472314-63472336 AATAAAAAGAAAGAAGAGGCTGG + Intergenic
1151383570 17:73741756-73741778 GAGAAAAAGAAAAAGGAGGCAGG - Intergenic
1151819404 17:76489617-76489639 CTTAAAAACAAACAGGCGGCTGG - Intronic
1151895128 17:76974941-76974963 CATGAACAGCAGCAGGAGGCAGG + Intergenic
1152419898 17:80186844-80186866 TCTAAAAGGAGGCAGGAGGCCGG - Intronic
1152690564 17:81715986-81716008 CTGAAACAGAAGCAGGTGGCGGG - Intronic
1152945931 17:83197318-83197340 CAGAAAAAGCAGCAGGCGGTTGG + Intergenic
1153051117 18:904502-904524 GATAAATAGGAGCAGAAGGCCGG + Intergenic
1153118368 18:1688872-1688894 CAGAAAAAGAAATAGGAGACAGG - Intergenic
1153330263 18:3866640-3866662 CATCAATAGAAGCAGGTGTCTGG - Intronic
1153442918 18:5140597-5140619 AATAAAAAAAACCAGGAGGTAGG - Intergenic
1153510899 18:5850996-5851018 CACACAAAGAAGCAGGAATCTGG + Intergenic
1153557351 18:6329447-6329469 TATAAAAAGAAACAGAAGGCTGG - Intronic
1153810059 18:8744536-8744558 CACAAGAAGCAGCAGGAAGCAGG - Intronic
1154470576 18:14696427-14696449 TATAAAAAGTATCAGGTGGCTGG + Intergenic
1155194266 18:23458455-23458477 GAAAGAAAGAACCAGGAGGCTGG + Intronic
1155885854 18:31207150-31207172 CATAAAAAGAGGGAGGTGCCTGG - Intergenic
1155927542 18:31673106-31673128 CACTAAAAGAAGCAAGAGGAAGG + Intronic
1156560062 18:38114729-38114751 CATAAAAAGAAACAGCTGGTAGG - Intergenic
1156748455 18:40421006-40421028 CAGGAACAGAGGCAGGAGGCTGG - Intergenic
1156801870 18:41125044-41125066 CATTAAAAGAGCCAGGAAGCTGG - Intergenic
1157098073 18:44705112-44705134 TACAAAAACAGGCAGGAGGCTGG - Intronic
1157424536 18:47573521-47573543 TATAAAAAGTAGCTGCAGGCCGG + Intergenic
1157684228 18:49629757-49629779 CATAGAAAGAGGCAGGAATCTGG + Intergenic
1158075550 18:53523902-53523924 GAAAAAAAGAAGGGGGAGGCAGG + Intronic
1158701887 18:59755552-59755574 AAAAAAAAGAAGAAGAAGGCTGG + Intergenic
1159247278 18:65823822-65823844 CAGAAGTAGATGCAGGAGGCAGG + Intronic
1159425099 18:68275090-68275112 TCTGAAAAGAACCAGGAGGCAGG + Intergenic
1160696541 19:487672-487694 AATAATAACAAGCATGAGGCAGG + Intergenic
1160755021 19:752523-752545 CAAAAAAAAAAGCGGGGGGCGGG + Intronic
1161236268 19:3199678-3199700 AAAAAAAAAAAGGAGGAGGCAGG - Intronic
1161740488 19:6018264-6018286 CATAAAAAGGAGATGAAGGCCGG - Intronic
1161822259 19:6537066-6537088 CATAAAAAGGAAGAAGAGGCCGG - Intergenic
1162015647 19:7845208-7845230 CAAATAAGGAGGCAGGAGGCAGG + Intronic
1162096383 19:8312259-8312281 CAAGAAAGGAAGCAGGAGGGTGG + Intronic
1162669723 19:12245882-12245904 CAGGAAAACAGGCAGGAGGCCGG - Intronic
1163162120 19:15470938-15470960 CTCGAAAAGAAGAAGGAGGCCGG - Intronic
1163352224 19:16784632-16784654 AATAAAAAGGAGCAGTCGGCTGG + Intronic
1164631764 19:29766507-29766529 CAAAAAAAGAAGAAGGAAGAAGG - Intergenic
1164649867 19:29884011-29884033 TATAAAAATTAGCTGGAGGCTGG - Intergenic
1165277032 19:34763147-34763169 CATCAACAGATGCAGGAAGCAGG + Intronic
1165598306 19:37030455-37030477 CATATAAAGAAATAGAAGGCCGG - Intronic
1165861314 19:38910999-38911021 GATTTCAAGAAGCAGGAGGCTGG - Exonic
1166135802 19:40776448-40776470 CATAAAAAATAGCAGCAGCCGGG + Intronic
1166717491 19:44977707-44977729 CAGAAAAAGCAGCTGGAGACAGG + Intronic
1167234001 19:48302922-48302944 GCTAGGAAGAAGCAGGAGGCAGG + Intronic
1167235054 19:48309200-48309222 CATGAATGGCAGCAGGAGGCAGG + Intronic
1167725021 19:51205594-51205616 CATAAAGTGAAGCACGAGGGAGG - Intergenic
1168236745 19:55068537-55068559 CAAAAAAAGAAAGAGGAGGCCGG + Intronic
1168320249 19:55504791-55504813 CAGAGAAAGAAACAGGTGGCCGG - Intronic
1168616988 19:57846253-57846275 CATCAAAATAAGCATGATGCAGG - Intronic
925481131 2:4275859-4275881 AATAAGAAGAACCTGGAGGCTGG + Intergenic
925841089 2:7993098-7993120 CGTGAAAAGAAGCCAGAGGCAGG - Intergenic
926748417 2:16179354-16179376 CCTTTAAAAAAGCAGGAGGCCGG - Intergenic
926777385 2:16435973-16435995 CAGAAAAACAGGCAGGTGGCTGG - Intergenic
927488384 2:23504662-23504684 CAGAAAAAGAAGCTGGAGCAAGG + Intronic
928330948 2:30357471-30357493 TATAATAAGAAACATGAGGCCGG - Intergenic
928388358 2:30888848-30888870 AATAAAAAGAGGCAGAAAGCAGG + Intergenic
928485727 2:31729173-31729195 AATAAACAGCAGCAGCAGGCAGG + Intergenic
929031959 2:37657641-37657663 TATAAAAACAGGCAGGGGGCCGG - Intronic
929166743 2:38889893-38889915 TATAAAAAGAAGCAGTAGAGAGG - Exonic
929388001 2:41434208-41434230 CATAGAAAGAAGATGTAGGCAGG + Intergenic
929403534 2:41613171-41613193 GATAAAAATAGGCAGGATGCTGG + Intergenic
930235064 2:48880911-48880933 CATAAAAGGCGGGAGGAGGCAGG + Intergenic
930673710 2:54177874-54177896 AAAGAAAAGAAACAGGAGGCCGG - Intronic
930779443 2:55209167-55209189 CATCAAAATAAAGAGGAGGCCGG - Intronic
931102733 2:59020563-59020585 AATAAAGAGAAAAAGGAGGCTGG - Intergenic
931607303 2:64065320-64065342 AAAAAAAAAAAGCAGCAGGCAGG + Intergenic
932465181 2:71917120-71917142 CATGAGAAGAAGAAGGAGCCTGG - Intergenic
932674627 2:73768654-73768676 CTTAAAAAGAATAAGGAGTCTGG + Intronic
933014068 2:77102092-77102114 TATAGAAAGAAGCTGCAGGCTGG - Intronic
933674759 2:85044812-85044834 CAGAAATAAAAGCAAGAGGCTGG - Intronic
934308908 2:91846022-91846044 AATAAAAAGAAACCCGAGGCTGG - Intergenic
934512790 2:94960720-94960742 CAGAAAAACACACAGGAGGCTGG - Intergenic
934729785 2:96649345-96649367 CAGAAAAGGATGCAGGAGGGTGG - Intergenic
934844784 2:97655791-97655813 CACAAAAAGCCTCAGGAGGCTGG - Intergenic
934858457 2:97743630-97743652 CATAAACAAGAACAGGAGGCCGG - Intergenic
935143732 2:100379401-100379423 AAAAAAAAAAAGCAGGAAGCAGG + Intergenic
935165374 2:100564590-100564612 CATCAAAAGAAAAATGAGGCCGG - Intronic
935451465 2:103214423-103214445 CCAAAAAAGAAGAAGGATGCTGG - Intergenic
935458761 2:103302639-103302661 AAGAAGAAGAAGCAGAAGGCTGG - Intergenic
935733712 2:106089022-106089044 CATAGAAAGAAGAAAGAGGATGG - Intergenic
936437121 2:112517942-112517964 CCAAAAAAAAAGCAGGAGACAGG - Intronic
937595987 2:123674024-123674046 AGTAAAAAGAAGCAGGGGCCAGG + Intergenic
937854607 2:126663330-126663352 GATAAAAACATGAAGGAGGCTGG - Intronic
938012582 2:127840600-127840622 CACATAAAGAAGCATGAGGCCGG - Intergenic
938295915 2:130179415-130179437 CAAAAAAAGAAAAAAGAGGCTGG - Intronic
940280568 2:151984892-151984914 CATAAGAAGAAACAGGAAGCTGG - Intronic
940597514 2:155814670-155814692 CAAAGAAGGAAGCACGAGGCTGG + Intergenic
940711669 2:157169811-157169833 CATAAAAACAACTAAGAGGCTGG - Intergenic
941970760 2:171348426-171348448 CACAAAAACAGGCAGCAGGCTGG + Intronic
942053512 2:172162496-172162518 CATGAATAGCGGCAGGAGGCAGG - Intergenic
942208304 2:173645874-173645896 AATACAAAGAAGTAGGAGTCAGG + Intergenic
942465441 2:176202985-176203007 CACAAAATGAAGCGGCAGGCTGG + Intergenic
942544928 2:177053687-177053709 CTTAAAAAGAAGCAGGAGGCCGG - Intergenic
942813425 2:180023418-180023440 CAGAAAAAGGAGCATGATGCTGG + Intergenic
942876807 2:180810081-180810103 GCTAAAAATAAGCAGGAGGTGGG - Intergenic
942928622 2:181462345-181462367 TATAATATGAACCAGGAGGCTGG - Intronic
943023512 2:182602048-182602070 CATGAATGGCAGCAGGAGGCAGG - Intergenic
943151829 2:184123380-184123402 AATAAATAGAGGGAGGAGGCAGG - Intergenic
943308127 2:186292529-186292551 CAAAAAAAGAAAAAGGATGCAGG + Intergenic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
943626318 2:190205030-190205052 TATAAAAACAGGCAGCAGGCTGG + Exonic
943746727 2:191469793-191469815 AAAAAAAAGAAGCAGCAGGCCGG - Intergenic
945703617 2:213201648-213201670 CCTATAAAGAAGGAGGAGGAGGG - Intergenic
946142944 2:217706883-217706905 CATAAGATGAAGCTGGAGGTGGG - Intronic
946351315 2:219155951-219155973 AATAAAAATAAGCATCAGGCCGG + Intronic
946496120 2:220197207-220197229 CACCAACAGAAGCAGTAGGCAGG + Intergenic
946896261 2:224327639-224327661 CAGCTATAGAAGCAGGAGGCGGG - Intergenic
947147020 2:227077703-227077725 AAAAAAAAGAAGGAGGAGGGAGG + Intronic
947409535 2:229821685-229821707 TATAAAAACAAGCAGGAGCGTGG + Intronic
947601377 2:231452751-231452773 AAGAAAAAGAATCAGGAGACAGG + Exonic
948570452 2:238914193-238914215 CCTACAGAGAAGCAGGATGCAGG - Intergenic
948654868 2:239470345-239470367 CATAAAGAGCAGAAAGAGGCTGG - Intergenic
948744769 2:240080784-240080806 CAAAAAAAATAACAGGAGGCCGG + Intergenic
948978237 2:241477422-241477444 CACAAAAAGGAACATGAGGCCGG - Intronic
1168937442 20:1678208-1678230 CCTTATAAGAAGGAGGAGGCAGG - Intergenic
1169308836 20:4517980-4518002 CATAAAAAGAAGTTAGGGGCCGG - Intergenic
1170458340 20:16554063-16554085 CATGAACAGCAGCAGGAGACAGG + Intronic
1170658588 20:18314907-18314929 CGTAATAAGTAGCAGTAGGCTGG + Intronic
1171040915 20:21762813-21762835 CACCAAAACAAGCAGCAGGCTGG - Intergenic
1171161081 20:22924413-22924435 GATAAAAGGGAGCAGGAGGTAGG + Intergenic
1172304299 20:33870556-33870578 CTTAAGGGGAAGCAGGAGGCTGG + Intergenic
1172760921 20:37321009-37321031 CAAAAAAAAAAAAAGGAGGCCGG - Intergenic
1172946975 20:38697247-38697269 CAGGAAAAGAAGCAGGAGATGGG + Intergenic
1172981595 20:38946553-38946575 TATATAAAGGAGCAGGAGGAGGG - Intronic
1173135617 20:40436393-40436415 AATAAAAAGAAAAATGAGGCCGG + Intergenic
1173384499 20:42575165-42575187 CATAGAAAGACGCAGGAAGGTGG + Intronic
1173581536 20:44150197-44150219 CATAAAAAAAATGAGGAGGATGG + Intronic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1173902864 20:46603793-46603815 TAAAAAAACAAGCAGTAGGCTGG + Intronic
1173914701 20:46698338-46698360 CCTTAAAAGTAGAAGGAGGCAGG - Intergenic
1174038027 20:47680102-47680124 CAAAAAAAGAAACAGGAGCCAGG - Intronic
1174813315 20:53665829-53665851 CAAAAAAAAAAGGAAGAGGCCGG - Intergenic
1175333602 20:58180803-58180825 CACAGAAAGAAGCAGGAGGGAGG - Intergenic
1175342689 20:58244367-58244389 AATTAATAGAAGCAGGATGCAGG - Intergenic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1175904773 20:62374308-62374330 CATAAAAAGAGGCTGGAGTCTGG - Intergenic
1176803906 21:13461439-13461461 TATAAAAAGTATCAGGTGGCTGG - Intergenic
1176931700 21:14819907-14819929 TAGAAAAACAAGCAGCAGGCCGG - Intergenic
1177916168 21:27090444-27090466 TATAAAAATAGGCAGGAGGCTGG + Intergenic
1178860578 21:36285714-36285736 AATTAAAAGAGGCAGGAGGCTGG + Intronic
1179145840 21:38766618-38766640 TATTAAAAGTAGCTGGAGGCCGG + Intergenic
1179266599 21:39809170-39809192 TATAAAAATAAGCAGCAGGCTGG - Intergenic
1179290227 21:40012074-40012096 TTTAAAAAACAGCAGGAGGCTGG + Exonic
1179625747 21:42648677-42648699 CATAAAAAGAAACAGGTGGAGGG + Intergenic
1180371251 22:12039292-12039314 AATAAAAATAAGAAGGAGGTTGG + Intergenic
1180535990 22:16393117-16393139 AATAAAAAGAAACCCGAGGCTGG - Intergenic
1181449387 22:23008395-23008417 AAGAAAAAAAAGCAAGAGGCAGG + Intergenic
1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG + Intronic
1182678492 22:32059482-32059504 CATAAACAAAAGCAGGAGGCAGG + Intronic
1182768674 22:32777372-32777394 AAAAAAAAGAAGGAGCAGGCTGG - Intronic
1182783096 22:32883361-32883383 CATCAAAAGAAGCAGAGGGTAGG + Intronic
1182903271 22:33916746-33916768 CAGAAGTAGAGGCAGGAGGCTGG - Intronic
1183312203 22:37116442-37116464 CATAAAAAGGATAAGGAGTCTGG + Intergenic
1183772347 22:39938050-39938072 CATAAGAAGAAGGAAGTGGCTGG + Intronic
1183887552 22:40897322-40897344 GATGAAAAGATGAAGGAGGCCGG - Intronic
1184223078 22:43112905-43112927 CAAAAAAAGGAGCATTAGGCTGG + Intronic
1184618044 22:45651455-45651477 TATAAAAAAAAGAAGGAGGAAGG + Intergenic
1184624230 22:45710647-45710669 TATAAAAAGAAGCAGTGGGCCGG - Intronic
1184665662 22:45987624-45987646 CATGAATGGCAGCAGGAGGCAGG + Intergenic
1185096628 22:48810016-48810038 CATCAAAAGACGCAGGAGTCAGG - Intronic
1185311813 22:50160227-50160249 GAAAAAAAGAAACAGGAGGTGGG - Intronic
1185311866 22:50160546-50160568 TTCAAAAAGAAACAGGAGGCCGG - Intronic
949300326 3:2576129-2576151 TATAAAAAGAAGAAAGCGGCTGG - Intronic
949459734 3:4277518-4277540 GAGGAAAAGAAGCAGGAGACAGG + Intronic
949502323 3:4692822-4692844 CATAAAAATAAGATGGAGGCAGG + Intronic
950419389 3:12888885-12888907 CATAAAAAGCATTGGGAGGCAGG + Intergenic
951896144 3:27611647-27611669 CATAGGAAGAGGCAGCAGGCAGG + Intergenic
951897862 3:27627539-27627561 TATTAAAAGAAAAAGGAGGCCGG + Intergenic
952432611 3:33238611-33238633 GATAAAAAGAAGAAGGTGGCCGG + Intergenic
952920962 3:38283532-38283554 CATCAGAAGTAGCAGGAGCCGGG + Intronic
952949925 3:38514767-38514789 CAAAAAAAAAAGCAGGGGGAGGG - Intronic
953306127 3:41831314-41831336 CATAAAAAGAAGAGGGAGCAGGG + Intronic
953977179 3:47390646-47390668 CTAAAAAAGAAGAAAGAGGCTGG - Intronic
954951135 3:54474708-54474730 AACAAACAGAAGAAGGAGGCTGG + Intronic
955002778 3:54942591-54942613 AAGAAAAAGAAGCAGGAGCCAGG + Intronic
955185217 3:56708822-56708844 AAAAAAAAAAAGCAAGAGGCTGG + Intergenic
955542416 3:59991687-59991709 CATAAAAAGATTCAGGAGCCAGG - Intronic
956058224 3:65323000-65323022 TAGAAAAAGAAAAAGGAGGCCGG - Intergenic
956546859 3:70413557-70413579 CATAAAAAGAAACTGAAGGCTGG + Intergenic
956855901 3:73274413-73274435 TATAAAAAGAAACAGCAGGCTGG - Intergenic
957114133 3:76002958-76002980 CATAAACAGAAACAAGAGCCAGG + Intronic
957883084 3:86247995-86248017 AAAAAAAAAAAGGAGGAGGCCGG + Intergenic
958481670 3:94652108-94652130 CATAAAAACAAGTGGGAGGTAGG + Intergenic
958579035 3:95991925-95991947 AATAAAAAGATGTAGGAGGGAGG + Intergenic
958931634 3:100213819-100213841 CAACAACAGAAGCAGGAGGTTGG + Intergenic
959262234 3:104097629-104097651 CATGTAAAGAAGAAAGAGGCTGG + Intergenic
959401039 3:105902601-105902623 CTTAAAAAGAAACTTGAGGCCGG - Intergenic
959658832 3:108842529-108842551 CATTGAAACAAACAGGAGGCTGG - Intronic
959932087 3:111996172-111996194 CATAGAAAGAAAAATGAGGCTGG - Intergenic
960235440 3:115276786-115276808 CTTAAAGAGAACCAGGATGCTGG + Intergenic
962010095 3:131383569-131383591 CATATAAACAGGGAGGAGGCAGG - Intronic
962272270 3:133986593-133986615 CATATAAAGAGGAAGGAAGCGGG + Intronic
962644966 3:137429284-137429306 TATGAAAGAAAGCAGGAGGCAGG - Intergenic
962659799 3:137589826-137589848 GATAAAAACAGACAGGAGGCTGG - Intergenic
962785056 3:138760608-138760630 TATCAAAAGAGACAGGAGGCCGG + Intronic
962834221 3:139172601-139172623 CAAAAAAAAAAGAAAGAGGCCGG - Intronic
963235580 3:142952790-142952812 AACAAAAAGCAGCAGAAGGCAGG - Intronic
964123019 3:153206221-153206243 CAAAAAAAAAAACAGGAGGTGGG + Intergenic
964589461 3:158343978-158344000 CAAAAAAAGATGAATGAGGCTGG + Intronic
964736183 3:159920974-159920996 CAAAAATAGAAGGAGGAGGAAGG + Intergenic
964993952 3:162851002-162851024 CATAGAAAGAAGAGGGAGGCCGG - Intergenic
965616554 3:170599414-170599436 CAGAAAAAGAAGTTGAAGGCAGG - Intronic
966503915 3:180678138-180678160 CAAAAAAAGAAGCAGGATTAGGG + Intronic
966508668 3:180736069-180736091 CAAAAGAGGAAGCAGGTGGCTGG - Intronic
967066351 3:185920440-185920462 CAAAAAATGAGGCAGGAAGCCGG - Intronic
967332316 3:188303268-188303290 CACAAAAACATGCAGTAGGCTGG + Intronic
967910975 3:194542193-194542215 GATGAAAAGATGCATGAGGCCGG - Intergenic
968167042 3:196474857-196474879 TACAAAAACAGGCAGGAGGCTGG - Intronic
968167567 3:196479595-196479617 CAAAAAAAAAAGCGTGAGGCTGG - Intronic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
968193926 3:196691387-196691409 GATAAAAAGAATAAGGAGGTGGG - Intronic
968210619 3:196845648-196845670 AAAAAAAAGAAGAAGAAGGCCGG - Intergenic
968782746 4:2595343-2595365 CAGAAAAAGAAACTGAAGGCTGG - Intronic
969328312 4:6456910-6456932 CATAAAAATGAGCATGAGCCAGG + Intronic
969575164 4:8032473-8032495 CATAAAAATAACCAGCAGCCAGG + Intronic
970388054 4:15576558-15576580 AAGAAAAAGAAACAAGAGGCAGG - Intronic
970563851 4:17311594-17311616 CATGAAAAGAAACAGGAAGCAGG + Intergenic
970593592 4:17579670-17579692 CAAAAAAAGAAGCAGGTGCTGGG - Intronic
970596701 4:17606632-17606654 TATAAAAGAAACCAGGAGGCTGG - Intronic
971115441 4:23640867-23640889 CCTAAAAAGAAGCAGCTGGTAGG + Intergenic
971400923 4:26274637-26274659 AAAAAAAAGAAGAAGAAGGCTGG + Intronic
971527852 4:27643957-27643979 CATAAAAAGACACAGGAGGCCGG - Intergenic
971707529 4:30065208-30065230 CCTTAAAAGATGCAGTAGGCTGG - Intergenic
971891550 4:32529886-32529908 CATAAACATAAGCAGAAGCCAGG + Intergenic
972037176 4:34539618-34539640 CACAAAGAGAAGGAGGAGGTGGG - Intergenic
972610593 4:40652172-40652194 CACAAAAAGAAAAAAGAGGCCGG + Intergenic
972632317 4:40853148-40853170 CATGAAGAGAAGCAGGTGGGTGG - Intronic
972787821 4:42344144-42344166 TATAAAAAGTAGCAGGATGTGGG + Intergenic
973092082 4:46149006-46149028 CATAAAAATAACCATCAGGCCGG - Intergenic
973599791 4:52530914-52530936 CACAAAAAGAGACTGGAGGCAGG - Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
975176292 4:71293265-71293287 CATAAAATCCAGAAGGAGGCTGG + Intronic
975289706 4:72663390-72663412 TATAAAAACAAGCACGAGCCTGG + Intergenic
975699302 4:77047258-77047280 CATTAAAAGAAACATAAGGCTGG + Exonic
976199598 4:82564986-82565008 TATAAAAAGGAGTAAGAGGCCGG - Intergenic
977530198 4:98192181-98192203 TATAAAAAGAAACAGGTGGCCGG - Intergenic
977731901 4:100363729-100363751 CAAAAACAAAAGCAGGTGGCAGG + Intergenic
977927324 4:102716011-102716033 ATTAAAAAGAATGAGGAGGCCGG + Intronic
978374028 4:108056683-108056705 CATAAAAAGAAGGAAGACACAGG + Intronic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
979003840 4:115262587-115262609 CATGGAAAAAATCAGGAGGCTGG + Intergenic
979357753 4:119725479-119725501 CACAAAAACAGGCAGCAGGCTGG - Intergenic
980387687 4:132107592-132107614 CAAAAAAAGTAGGAGGTGGCGGG + Intergenic
980831573 4:138134710-138134732 GATAAAAATAAGCAAAAGGCAGG - Intergenic
980841061 4:138261916-138261938 GATAAGAAGAAACAGGAGGAGGG - Intergenic
981588058 4:146325958-146325980 CACAAAAAGCAGCAGGAGCAGGG + Exonic
982668326 4:158292343-158292365 CAAAACCAGAAGCAGGGGGCAGG - Intergenic
984245566 4:177271558-177271580 CTTTAATAGAAGCAGCAGGCCGG + Intergenic
986056644 5:4143821-4143843 CATAAAATGAAAAAGAAGGCCGG + Intergenic
986824070 5:11501711-11501733 CATAAGAAGGGGCAGGAGGCTGG + Intronic
986908902 5:12530205-12530227 CTTATAAGGAAGCAGAAGGCAGG + Intergenic
987585310 5:19847440-19847462 TATAAAAAGAAGCAAGAGTTTGG - Intronic
987904667 5:24060448-24060470 CATAAAAAGAACCTGGGGCCGGG + Intronic
988565947 5:32320249-32320271 CATGAACAGCAGCAGGAGGCAGG - Intergenic
988798874 5:34677983-34678005 GATAGGAAGATGCAGGAGGCCGG - Intronic
988880915 5:35501071-35501093 CTGAAAAAGAGGCAGCAGGCAGG - Intergenic
988961479 5:36375653-36375675 GTTAAAAAGAATTAGGAGGCCGG + Intergenic
989422956 5:41261569-41261591 GATAAAAATAAGCAGGAGATGGG - Intergenic
989501101 5:42169225-42169247 CTTAAAAAGAAGCAGGGGAAGGG - Intergenic
990291958 5:54361099-54361121 TACAAAAACAAGCAGCAGGCTGG - Intergenic
990322182 5:54640761-54640783 TAAAAAAAAAATCAGGAGGCTGG + Intergenic
991258997 5:64646490-64646512 CATGCAAAGCAGCAGGAGGAGGG + Intergenic
991680348 5:69133720-69133742 AAAAAAAAGAAGCAAGAGGCCGG + Intergenic
992539804 5:77752852-77752874 ATTAAAAATAAGCCGGAGGCCGG - Intronic
993651988 5:90533137-90533159 CACGAAAACAAGCAGGATGCAGG - Intronic
993873723 5:93281610-93281632 CAAAAATAGAAGCAGGAGCATGG + Intergenic
993885171 5:93407600-93407622 CATAAGAAGATGCATGTGGCAGG - Intergenic
994357502 5:98810436-98810458 CAAAGAAAGTCGCAGGAGGCTGG + Intergenic
994801262 5:104380196-104380218 AATAAAACTGAGCAGGAGGCAGG + Intergenic
995823162 5:116261615-116261637 GATAAAAAGAAAGAAGAGGCAGG - Intronic
995962930 5:117866582-117866604 GAAAAAAAAAAGCAGAAGGCAGG - Intergenic
996039159 5:118791266-118791288 CACAAAAATAGGCAGCAGGCTGG - Intergenic
996227963 5:121024615-121024637 TATAAAAACAAGCAGTGGGCTGG + Intergenic
996841685 5:127853474-127853496 CATCAAAAGCACCTGGAGGCTGG + Intergenic
998326179 5:141281834-141281856 CATATAAAGAGACAAGAGGCTGG - Intergenic
998662755 5:144258960-144258982 CATAAAAAAAGGGATGAGGCCGG + Intronic
998960384 5:147480221-147480243 CGCAAAAAGAAGCTGGAGGCCGG - Intronic
999232045 5:150067264-150067286 CCTCACAAGAAGCTGGAGGCAGG - Intronic
999674780 5:153987986-153988008 AAGAAAAGGAAGGAGGAGGCAGG - Intergenic
999708835 5:154298261-154298283 CCTGAAAAGAGGAAGGAGGCTGG - Intronic
1000074654 5:157773670-157773692 AAAAACAAGAAACAGGAGGCTGG + Intergenic
1000341453 5:160280126-160280148 CATACCAGGAAGCAGGAGACAGG + Intronic
1000571136 5:162915298-162915320 CAAAAAAACAAACACGAGGCTGG - Intergenic
1000882311 5:166712428-166712450 AATAAAAAGAAGCACCAGGTGGG - Intergenic
1000898827 5:166889093-166889115 CAAAAACAGAACCAGGAGGAGGG + Intergenic
1001079410 5:168656112-168656134 AATAAAAAGGAGGAGGAGGGAGG - Intergenic
1001635310 5:173205956-173205978 CATAAAAAGGAGCAAGTGTCTGG + Intergenic
1001719974 5:173848796-173848818 AAGAAGAAGAAGCTGGAGGCAGG - Intergenic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002373591 5:178773250-178773272 AAAAAAAGGAAGCAGGTGGCTGG + Intergenic
1002462099 5:179379071-179379093 CAGAACAAGAACCAGGATGCAGG - Intergenic
1002606081 5:180383534-180383556 GATAGAAAGAGGAAGGAGGCCGG + Intergenic
1003766430 6:9242275-9242297 CATGAACAAAAGCATGAGGCAGG + Intergenic
1004387211 6:15183534-15183556 AAAAAGAAGAAGAAGGAGGCTGG - Intergenic
1005083625 6:21981564-21981586 CAGAACAAGAAAGAGGAGGCAGG - Intergenic
1005159222 6:22838835-22838857 CATACAAAGGAGGAAGAGGCAGG + Intergenic
1005290108 6:24371305-24371327 AAAAAAAAGAACTAGGAGGCTGG + Intergenic
1005492461 6:26359408-26359430 CAATAAAAGAAGAAAGAGGCTGG - Intergenic
1005681399 6:28212165-28212187 CAAGAAAAGAAGCCTGAGGCTGG - Intergenic
1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG + Intronic
1006031293 6:31178469-31178491 CATTCTGAGAAGCAGGAGGCAGG + Intronic
1006399171 6:33806206-33806228 TATAAAAAGAAGTGGCAGGCCGG - Intergenic
1006466734 6:34199799-34199821 CAAAAAAAAAAGAAAGAGGCCGG - Intergenic
1006941073 6:37752829-37752851 CAGAAAAACAAGCAGGAGCTGGG + Intergenic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1008018486 6:46548357-46548379 GATAAGAAGAAGCAGTAGGAGGG - Intergenic
1008046284 6:46854541-46854563 CCAGAAAAGAAGCAGGAGTCAGG + Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010203831 6:73306172-73306194 TATAAGTAGGAGCAGGAGGCAGG - Intronic
1011000453 6:82582696-82582718 CATGTAAAGAAGCAGCAGGAAGG + Intergenic
1011179077 6:84598851-84598873 CATAACAAGGAGCAGGAGCTGGG - Intergenic
1011440955 6:87386722-87386744 AAGAAAAAAAAGCAGGGGGCGGG + Intronic
1011679585 6:89770107-89770129 CAAAAAAAGAATTAAGAGGCCGG + Intronic
1011749274 6:90438947-90438969 AAAAAAAAGAAGCAGGATGAGGG - Intergenic
1012116816 6:95310320-95310342 CCTAAAAAGAATCAGGAGTCAGG - Intergenic
1012889906 6:104885888-104885910 CATGAACGGCAGCAGGAGGCAGG + Intergenic
1013637652 6:112044469-112044491 CATAAGCAAAAGCAAGAGGCTGG + Intergenic
1013639141 6:112056428-112056450 CATCAAAAGAAGGAGGAGGAGGG - Intronic
1014729546 6:125016631-125016653 CATAAAAAAAAGGATGAAGCTGG + Intronic
1015528568 6:134197527-134197549 CATAAAAAGCAAAAGTAGGCCGG + Intronic
1015540205 6:134306121-134306143 CATAAAAAATAGCACAAGGCCGG + Intronic
1015616237 6:135078301-135078323 AAAAAAAAGATGCTGGAGGCAGG + Intronic
1016032224 6:139349850-139349872 CATAAAAAGAAGCCACAGGGGGG - Intergenic
1016142499 6:140629627-140629649 CTTAAAAACAATTAGGAGGCCGG - Intergenic
1016234531 6:141847205-141847227 CAGAAACAGAAACAGGAGGAAGG - Intergenic
1016305293 6:142677823-142677845 CATAAAAAGGAGAGGCAGGCAGG - Intergenic
1016382923 6:143503522-143503544 GATAAAAAGAAGCAGTCTGCGGG + Intronic
1016691987 6:146948744-146948766 TATAAATAGAAGAGGGAGGCAGG - Intergenic
1017459002 6:154631283-154631305 CATAAAGAAAAGGAAGAGGCCGG - Intergenic
1017757920 6:157545378-157545400 AAAAAAAAGGAGGAGGAGGCCGG + Intronic
1017789992 6:157789483-157789505 TACAAAAAGAGGCAGCAGGCTGG + Intronic
1017897405 6:158692635-158692657 AATTAAAAGAAGCAGGTGCCAGG + Intronic
1018248286 6:161842842-161842864 AATAAAGAGAAGGAAGAGGCGGG - Intronic
1018627551 6:165794072-165794094 CATCACAATAAACAGGAGGCTGG - Intronic
1018790077 6:167141635-167141657 GACAACAAGAAGCAGGATGCGGG + Intergenic
1019034819 6:169045565-169045587 CACCAAAAAAAGCAAGAGGCCGG - Intergenic
1019034826 6:169045616-169045638 CACCAAAAAAAGCAAGAGGCCGG - Intergenic
1019204350 6:170346771-170346793 CATAAAAACAGGCAGGAGCTGGG + Intronic
1019946195 7:4331197-4331219 CATAAATAGAAGTCAGAGGCTGG + Intergenic
1020214857 7:6182344-6182366 TTAAAAAAGAAGCAGGAGGCTGG - Intronic
1020431362 7:8119547-8119569 CTTTAAAAGAAGCCAGAGGCCGG + Intronic
1021065546 7:16167993-16168015 CATAAAAAGAAGAAAGGGGAAGG - Intronic
1021602548 7:22378700-22378722 TAAAAAAAAAAGCAGCAGGCTGG - Intergenic
1021603454 7:22387794-22387816 TATAACAAGAAGCAGGAGGATGG - Intergenic
1021620294 7:22544606-22544628 TAAATGAAGAAGCAGGAGGCAGG - Intronic
1022834079 7:34097178-34097200 CAAAAAGAGGAGCAGGAGGCTGG + Intronic
1023130995 7:37003123-37003145 AATAAAGGGAAGAAGGAGGCGGG + Intronic
1023272810 7:38483428-38483450 CATAGATAGAAGCAGGAAACTGG - Intronic
1023884667 7:44345201-44345223 CATCCAAAGCAGCATGAGGCAGG + Intergenic
1023981111 7:45070650-45070672 CATAAAAAGCTGTTGGAGGCTGG + Intronic
1025602346 7:63012599-63012621 CAAAAAAAAAAAAAGGAGGCTGG + Intergenic
1025962345 7:66233853-66233875 AAAAAAAAGAAGCAGGAAGTAGG - Intronic
1025995324 7:66524056-66524078 CTTAAAAAGGGTCAGGAGGCCGG - Intergenic
1026076712 7:67178168-67178190 CAGAAAAAAAAACAGGAGGTGGG + Intronic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026556172 7:71410540-71410562 TATAAAATTAATCAGGAGGCTGG - Intronic
1026687687 7:72525404-72525426 CAAAAAAACAAACACGAGGCTGG + Intergenic
1026716652 7:72795114-72795136 GATAAACAGAAGTAGGAGGCCGG - Intronic
1027808105 7:82855878-82855900 AATATAAACAAGCAGGATGCTGG - Intronic
1028136066 7:87224073-87224095 CATAAGAAGAAGCCAGAGGTGGG - Intergenic
1028328416 7:89557740-89557762 AAAAAAATGAAGCAGCAGGCTGG + Intergenic
1028442070 7:90874822-90874844 CATTAAAAAAAGGATGAGGCCGG - Intronic
1028629439 7:92918585-92918607 AATAAAAAGAATCAGGTGGAAGG - Intergenic
1028633901 7:92965942-92965964 CATAAAATGTAGAAAGAGGCTGG + Intergenic
1028984908 7:97002134-97002156 GAGACAAAGAAGCAGGAGCCAGG + Intergenic
1029112255 7:98218310-98218332 CAGAAAGAGGATCAGGAGGCCGG - Intronic
1029422082 7:100477099-100477121 CAGAAAATGAAGTAGGAGGAAGG + Intronic
1029539752 7:101175629-101175651 AAAAAAAAGAAGAAGAAGGCTGG + Intronic
1029940588 7:104476758-104476780 AATAAAAAAAAGCAGGAAGCTGG - Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030892189 7:115012679-115012701 CATAAATAGTAGAATGAGGCTGG + Intronic
1031337957 7:120560679-120560701 CATCGAATGAAGCAGCAGGCAGG + Intronic
1031350816 7:120728584-120728606 CAAAAACATAAGAAGGAGGCTGG - Intronic
1031424701 7:121591212-121591234 CATAAAAAGCACCCGGAGGCAGG - Intergenic
1031749394 7:125552639-125552661 AATAAAAAGTAACAGGAAGCTGG - Intergenic
1032065362 7:128765204-128765226 AAAAAAAAGAAACAGGAGGTCGG - Intronic
1032666216 7:134039063-134039085 CATACACAGAAGCAGGAGAGGGG - Intronic
1032814335 7:135456283-135456305 CACAAAAACAAGCAGCAGGAAGG + Intronic
1032814558 7:135459313-135459335 CACAAAAACAAGCAGCAGGAAGG + Intronic
1032880809 7:136088675-136088697 TGCCAAAAGAAGCAGGAGGCTGG - Intergenic
1032912767 7:136452473-136452495 TAAAAAAAGAAGCAGGGGCCGGG - Intergenic
1032963760 7:137071682-137071704 CTCAAAATGAAGCAAGAGGCTGG + Intergenic
1035116141 7:156525855-156525877 CAGAAAAAGAATTATGAGGCTGG + Intergenic
1035705140 8:1669507-1669529 GGTAAAAGGAAGCAGGAGGTGGG - Intronic
1036558728 8:9883854-9883876 CCTAATCAGCAGCAGGAGGCAGG + Intergenic
1036804581 8:11821294-11821316 AATAATAAGAAACATGAGGCCGG + Intronic
1036933056 8:12974737-12974759 CATGAAAAGGGACAGGAGGCGGG + Intronic
1038002629 8:23404217-23404239 CAACAAAAGAGGCCGGAGGCCGG - Exonic
1038178435 8:25202990-25203012 CACACATAGAAGCAGTAGGCAGG + Intronic
1039050814 8:33491616-33491638 AAAAAAAAAAAGCAGGGGGCAGG - Intronic
1040425245 8:47278818-47278840 CATAAAAATAAGCAACAGGAAGG - Intronic
1040614676 8:49022367-49022389 AATTGAGAGAAGCAGGAGGCAGG - Intergenic
1040898590 8:52393583-52393605 GAAAAAAAAACGCAGGAGGCTGG + Intronic
1041135813 8:54757639-54757661 CAGACACAGAAGCAGGAGACAGG + Intergenic
1041242318 8:55858558-55858580 CATAAGAAGAAGCATCAGACAGG - Intergenic
1041311173 8:56518108-56518130 CAGAAAAAGAAAATGGAGGCCGG - Intergenic
1041952543 8:63520079-63520101 AATAAGAAGAAGCAGAAGGATGG + Intergenic
1042632927 8:70840588-70840610 CATAAAAAGAAGTCTGAGGATGG - Intergenic
1042936047 8:74059403-74059425 CTAAAAAAGAAGCAGGAGGTGGG + Intergenic
1043195491 8:77287378-77287400 CATAAACACCAGAAGGAGGCAGG + Intergenic
1043528334 8:81120855-81120877 AATAAAAAGATGTAGGAGGCCGG - Intergenic
1044339819 8:91033939-91033961 TTTAAAAACAAGGAGGAGGCTGG - Intronic
1045179069 8:99760277-99760299 AATAAAAAGAGGCAAGTGGCCGG - Intronic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1045865468 8:106860517-106860539 AATAAAAAAGAGAAGGAGGCCGG + Intergenic
1045973176 8:108102647-108102669 CATGAAAAGAAGCTGGAGGCTGG + Intergenic
1046546072 8:115651651-115651673 CATAAACAGGAGCACAAGGCGGG + Intronic
1046953610 8:120041487-120041509 GTTAACAGGAAGCAGGAGGCAGG - Intronic
1047529504 8:125662396-125662418 TCTAAAAAGAAGCAGTGGGCTGG - Intergenic
1047723436 8:127664176-127664198 CATAACAAGTAGCAGGAGAGAGG + Intergenic
1048062090 8:130930545-130930567 AAAAAATAGAAGCAAGAGGCTGG - Intronic
1048085819 8:131178332-131178354 TAAAAAAAGTAGAAGGAGGCTGG + Intergenic
1048106221 8:131413198-131413220 AAGAAAGGGAAGCAGGAGGCAGG + Intergenic
1048413802 8:134203866-134203888 AATAAAAAGTGGAAGGAGGCTGG - Intergenic
1049980905 9:902783-902805 CATAAAAAGGAGCGGAAAGCTGG - Intronic
1050112535 9:2231696-2231718 CATGAACAGAAGGAGGAGGAAGG + Intergenic
1050264007 9:3871225-3871247 CATGAAAGCAACCAGGAGGCAGG - Intronic
1050538246 9:6648462-6648484 CATACAAAAAGGCAGGAGTCTGG - Intergenic
1051306070 9:15710891-15710913 GATAAAAAGAGACAGAAGGCCGG - Intronic
1051487686 9:17626202-17626224 CAATAAAAGAAGCAGGTGCCAGG - Intronic
1051594363 9:18809491-18809513 CATGAAAAGGAGCTTGAGGCCGG + Intronic
1051638747 9:19204856-19204878 AATAAAAAAAATAAGGAGGCTGG - Intergenic
1052372798 9:27684808-27684830 TGTAAGAAGAAGCAGCAGGCTGG - Intergenic
1052707532 9:32011031-32011053 CATAAACAGCATCAGGAGGTAGG + Intergenic
1052788181 9:32849483-32849505 AATAAAAGGAAGCAGAAGGATGG + Intergenic
1053263058 9:36687606-36687628 CACAAAAAGAAGCCACAGGCTGG - Intergenic
1053460184 9:38262681-38262703 CAGCAAAAGAAACAGGTGGCAGG + Intergenic
1053533398 9:38903789-38903811 CAGAAAAAGATGCATGAGGAAGG - Intergenic
1053651114 9:40170758-40170780 CCAGAAAAGAAGCAGGAGTCAGG - Intergenic
1053901499 9:42800106-42800128 CCAGAAAAGAAGCAGGAGTCAGG - Intergenic
1054205625 9:62128218-62128240 CAGAAAAAGATGCATGAGGAAGG - Intergenic
1054533466 9:66205445-66205467 CCAGAAAAGAAGCAGGAGTCAGG + Intergenic
1054632737 9:67460152-67460174 CAGAAAAAGATGCATGAGGAAGG + Intergenic
1054728429 9:68676317-68676339 CATCAAAAGAAGCAGGGAGAAGG - Intergenic
1054981282 9:71209671-71209693 GACAAAAAGAGGCAGCAGGCTGG - Intronic
1054998087 9:71415503-71415525 CATAAATAAAAGCAGTACGCTGG + Intronic
1055962347 9:81832662-81832684 GATAAACAGAGGGAGGAGGCCGG - Intergenic
1056851103 9:90084918-90084940 GTTATAAAGCAGCAGGAGGCAGG - Intergenic
1056958657 9:91102515-91102537 CAGAAAAAGATGCTGGAGGGTGG + Intergenic
1057043122 9:91862025-91862047 TATAAGAAGAAGAAGAAGGCCGG + Intronic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1057622741 9:96650992-96651014 AATAAAAAGCAGCCTGAGGCTGG + Intronic
1057842978 9:98501139-98501161 AAAAAAAAGGAGCAGGGGGCGGG - Intronic
1058111091 9:101030943-101030965 GAAAAAAAGAAGCAGGGGGTGGG + Intronic
1058411221 9:104734274-104734296 TATAAAAATAAAAAGGAGGCTGG - Intergenic
1060093927 9:120770078-120770100 CATAAAAACAATGAAGAGGCCGG + Intronic
1060264520 9:122102814-122102836 TACAAAAACAAGCAGGAGGCTGG + Intergenic
1060414527 9:123421032-123421054 CCCAGACAGAAGCAGGAGGCAGG + Intronic
1060431689 9:123556270-123556292 GATAAAAAGGAGTAGGAGGGTGG + Intronic
1060623012 9:125084464-125084486 CTTAAAAAGCAGCAGCCGGCCGG - Intronic
1060677107 9:125525375-125525397 TAGAAAAAGTAACAGGAGGCCGG + Intronic
1060982510 9:127801962-127801984 CATAAAAATAATCAAGAGACTGG - Intronic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1061784869 9:133021587-133021609 CATAGAAAGAGACAGCAGGCTGG + Intergenic
1061832649 9:133305225-133305247 AAAAAAAACAAGAAGGAGGCCGG + Intergenic
1203733091 Un_GL000216v2:108855-108877 CAAAAAAAGCAGCAGCAGCCAGG + Intergenic
1203734396 Un_GL000216v2:122036-122058 CAAAAAAAGCAGCAGCAGCCAGG - Intergenic
1185509070 X:649332-649354 CAGAAAAAGAGAGAGGAGGCCGG - Intronic
1185633184 X:1531585-1531607 CACAGACAGAAGCAGGTGGCAGG - Intronic
1185834515 X:3332538-3332560 CTTAAAAAGAAGAATGTGGCCGG - Intronic
1186413258 X:9361978-9362000 TTCAAAGAGAAGCAGGAGGCTGG + Intergenic
1186554862 X:10547274-10547296 CAAAAAAGAAAGAAGGAGGCCGG + Intronic
1187049680 X:15683557-15683579 CATAAAAAGATTTAGGTGGCCGG + Intergenic
1187413716 X:19074030-19074052 CAGAAAAAGAATCAGGAAACTGG + Intronic
1187812115 X:23190772-23190794 CATAAAGAGAACCAGCTGGCCGG - Intergenic
1188461782 X:30435516-30435538 CATAAGAGGGAGCAGGAGGAGGG - Intergenic
1188559173 X:31448273-31448295 GATAAAAAGGAAAAGGAGGCAGG + Intronic
1189605483 X:42673252-42673274 CATGAAAACATGCAGCAGGCTGG - Intergenic
1189774179 X:44455440-44455462 AAAAAAAAAAAGCCGGAGGCTGG - Intergenic
1190087122 X:47405089-47405111 CACAAGAAGAAGGGGGAGGCCGG + Intronic
1190087689 X:47409943-47409965 TAAAAAATGAAGAAGGAGGCTGG - Intronic
1190301774 X:49061136-49061158 CAGAGAAGGAGGCAGGAGGCAGG + Intronic
1190306460 X:49085576-49085598 CATAAAAAGAAGCAGGAGGCTGG + Intronic
1190706814 X:53035688-53035710 AATAAAAAGAAGGAAGAGGAGGG + Intergenic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1191086846 X:56577420-56577442 CATAAGAAGAAGGATGAGACTGG - Intergenic
1191137053 X:57076104-57076126 CAAAAAAACAAACTGGAGGCCGG - Intergenic
1192538157 X:71946184-71946206 CACAGACAGGAGCAGGAGGCAGG + Intergenic
1193044254 X:77034699-77034721 CATGAAAACACCCAGGAGGCAGG + Intergenic
1194250109 X:91563808-91563830 CACTAAAAGAAGCAGGAGAGAGG + Intergenic
1194456843 X:94115249-94115271 TATAAAAAGAATAAGGCGGCTGG - Intergenic
1195935757 X:110124352-110124374 CATAAAAAGAATCGGGGGGTAGG + Intronic
1196342339 X:114609901-114609923 ACTACAAAGAAGCAGGAGGATGG + Intronic
1196349544 X:114710021-114710043 CTGGAAAAGAAGCAGGAGACTGG + Intronic
1196786115 X:119422917-119422939 CATACAAAGCGCCAGGAGGCTGG - Intronic
1197603164 X:128554842-128554864 AAAAAAAAAAAGCTGGAGGCTGG + Intergenic
1197695829 X:129548772-129548794 CCTAAGAAAAAGCAGGTGGCTGG + Intronic
1198014221 X:132592207-132592229 CATTAAATGCATCAGGAGGCAGG - Intergenic
1198304213 X:135364729-135364751 CTATAAAAGAAGCAGGGGGCTGG - Intergenic
1199417307 X:147599952-147599974 CAGTAAGAGTAGCAGGAGGCTGG + Intergenic
1199497022 X:148464019-148464041 CATGAACAGAAGCAGAAGGAGGG - Intergenic
1199850527 X:151722473-151722495 CCTAGTGAGAAGCAGGAGGCTGG - Intronic
1200112158 X:153745988-153746010 AATAAAAAGAAACCCGAGGCTGG - Intergenic
1200128357 X:153828793-153828815 CCGAAAAGGAAGCAGGAGGATGG + Intronic
1200569071 Y:4805057-4805079 CACTAAAAGAAGCAGGAGAGAGG + Intergenic
1201169725 Y:11246207-11246229 GTAAAAAAGAAGCAGGAAGCTGG - Intergenic
1201291363 Y:12423532-12423554 CCTAGAAGGAGGCAGGAGGCAGG - Intergenic
1201300204 Y:12498611-12498633 AATAAGAAGAAGGAGGAGGAGGG - Intergenic
1201671844 Y:16530635-16530657 AAAGAAAAGAAGCAGTAGGCTGG + Intergenic
1202626637 Y:56866569-56866591 CAAAAAAAGGAGCAGCAGCCAGG + Intergenic