ID: 1190309482

View in Genome Browser
Species Human (GRCh38)
Location X:49106677-49106699
Sequence GGAACTGCACATCTCCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190309482_1190309487 -6 Left 1190309482 X:49106677-49106699 CCCACCTGGAGATGTGCAGTTCC No data
Right 1190309487 X:49106694-49106716 AGTTCCTCCTTCAGGTACCTGGG No data
1190309482_1190309486 -7 Left 1190309482 X:49106677-49106699 CCCACCTGGAGATGTGCAGTTCC No data
Right 1190309486 X:49106693-49106715 CAGTTCCTCCTTCAGGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190309482 Original CRISPR GGAACTGCACATCTCCAGGT GGG (reversed) Intergenic
No off target data available for this crispr