ID: 1190311855

View in Genome Browser
Species Human (GRCh38)
Location X:49122554-49122576
Sequence AGAAGGTGGAAGGATAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 705
Summary {0: 1, 1: 0, 2: 2, 3: 56, 4: 646}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190311855_1190311869 12 Left 1190311855 X:49122554-49122576 CCCACTCTATCCTTCCACCTTCT 0: 1
1: 0
2: 2
3: 56
4: 646
Right 1190311869 X:49122589-49122611 TTCAATGGGGAAGGGTAAAGGGG 0: 1
1: 0
2: 1
3: 17
4: 251
1190311855_1190311868 11 Left 1190311855 X:49122554-49122576 CCCACTCTATCCTTCCACCTTCT 0: 1
1: 0
2: 2
3: 56
4: 646
Right 1190311868 X:49122588-49122610 CTTCAATGGGGAAGGGTAAAGGG 0: 1
1: 0
2: 2
3: 23
4: 255
1190311855_1190311864 3 Left 1190311855 X:49122554-49122576 CCCACTCTATCCTTCCACCTTCT 0: 1
1: 0
2: 2
3: 56
4: 646
Right 1190311864 X:49122580-49122602 TCTTCTTCCTTCAATGGGGAAGG 0: 1
1: 0
2: 0
3: 29
4: 224
1190311855_1190311861 -2 Left 1190311855 X:49122554-49122576 CCCACTCTATCCTTCCACCTTCT 0: 1
1: 0
2: 2
3: 56
4: 646
Right 1190311861 X:49122575-49122597 CTTCCTCTTCTTCCTTCAATGGG 0: 1
1: 0
2: 1
3: 64
4: 460
1190311855_1190311862 -1 Left 1190311855 X:49122554-49122576 CCCACTCTATCCTTCCACCTTCT 0: 1
1: 0
2: 2
3: 56
4: 646
Right 1190311862 X:49122576-49122598 TTCCTCTTCTTCCTTCAATGGGG 0: 1
1: 0
2: 2
3: 53
4: 421
1190311855_1190311865 4 Left 1190311855 X:49122554-49122576 CCCACTCTATCCTTCCACCTTCT 0: 1
1: 0
2: 2
3: 56
4: 646
Right 1190311865 X:49122581-49122603 CTTCTTCCTTCAATGGGGAAGGG 0: 1
1: 0
2: 1
3: 17
4: 249
1190311855_1190311867 10 Left 1190311855 X:49122554-49122576 CCCACTCTATCCTTCCACCTTCT 0: 1
1: 0
2: 2
3: 56
4: 646
Right 1190311867 X:49122587-49122609 CCTTCAATGGGGAAGGGTAAAGG 0: 1
1: 0
2: 0
3: 12
4: 177
1190311855_1190311860 -3 Left 1190311855 X:49122554-49122576 CCCACTCTATCCTTCCACCTTCT 0: 1
1: 0
2: 2
3: 56
4: 646
Right 1190311860 X:49122574-49122596 TCTTCCTCTTCTTCCTTCAATGG 0: 1
1: 0
2: 8
3: 93
4: 677

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190311855 Original CRISPR AGAAGGTGGAAGGATAGAGT GGG (reversed) Intronic
900013119 1:132806-132828 AGAAGGTGGCAGGATCCATTGGG - Intergenic
900043185 1:488793-488815 AGAAGGTGGCAGGATCCATTGGG - Intergenic
900064622 1:723790-723812 AGAAGGTGGCAGGATCCATTGGG - Intergenic
900730694 1:4257343-4257365 AGAAGTTGGATGGATAGACAGGG + Intergenic
900742874 1:4341369-4341391 GAAAGGTGGAAGGAGAGAGCCGG + Intergenic
902305109 1:15531009-15531031 AGAAGATGGAGGCTTAGAGTTGG + Intronic
903675305 1:25060904-25060926 AGAAGGGGGAGGGATAGCATTGG + Intergenic
906791373 1:48661224-48661246 AGCAGGTGGCAGGAGGGAGTGGG + Intronic
906826724 1:48989503-48989525 GGTGGGTGGGAGGATAGAGTGGG - Intronic
907027725 1:51138050-51138072 AGAAGGTGGAGGGTGAGAGAAGG + Intronic
907397631 1:54202597-54202619 CTTAGGTGGAAGGATAGATTAGG - Intronic
908062389 1:60365803-60365825 AGCGGGTGGAAGGCTAGATTTGG - Intergenic
908302302 1:62774074-62774096 AGGAGAGGGAAGAATAGAGTGGG - Intergenic
908605665 1:65793873-65793895 GGAAGATGGAAGAAGAGAGTAGG - Intronic
910727082 1:90350417-90350439 ACAATGTGGCAGGAGAGAGTGGG - Intergenic
911826011 1:102485955-102485977 AGAAGAAGAAAGGAAAGAGTGGG + Intergenic
912124028 1:106510734-106510756 AGAGGGAGGAAGAATAGAGAGGG + Intergenic
912537256 1:110383937-110383959 AGAAGCAGGATGGATGGAGTTGG + Intronic
912963636 1:114217887-114217909 AGCTGATGGAAGGACAGAGTGGG + Intergenic
913096987 1:115527926-115527948 AGATGGTGCAAGGACAGAGCAGG + Intergenic
913190597 1:116409735-116409757 AGAACAGGGAAGGTTAGAGTTGG + Intronic
913474519 1:119224079-119224101 GGAAGCTGGTAGGATGGAGTTGG - Intergenic
913601506 1:120425660-120425682 ATTAGGTGGAAGGAGAGACTTGG - Intergenic
914191430 1:145414914-145414936 ATTAGGTGGAAGGAGAGACTTGG + Intergenic
914330216 1:146662183-146662205 GGAGGGTGGAAGGAGAGAGAAGG - Intergenic
914589362 1:149092918-149092940 ATTAGGTGGAAGGAGAGACTTGG + Intronic
915147700 1:153805083-153805105 TGAAGGTGAAAGGATAGATTGGG - Exonic
915593884 1:156885593-156885615 AGGAGGAGGAAGGATAGGGAGGG - Intergenic
915797685 1:158754107-158754129 AGAATATGGAAGGACAGAGAAGG - Intergenic
916010355 1:160699953-160699975 ATAAGGTGGAACGAGAGACTTGG - Intronic
917672500 1:177286257-177286279 AGAAGCTTGAAGCACAGAGTAGG + Intergenic
917672550 1:177286715-177286737 TTAAGGAGGAAGGATAGATTGGG + Intergenic
917771481 1:178284328-178284350 AGAAGGCAGAAGAAAAGAGTTGG - Intronic
917791537 1:178502384-178502406 GGAAGGGGGAAGGAGGGAGTGGG + Intergenic
918211850 1:182358227-182358249 AGAAGAGGGAAGAGTAGAGTTGG + Intergenic
918254350 1:182735530-182735552 AGAAGGAAGCAGGAAAGAGTTGG + Intergenic
918274234 1:182936631-182936653 AAAAGATGGGAGGATAGAATTGG - Intronic
918335333 1:183505048-183505070 AGAAGGTGGAAGAAATGAATAGG - Intronic
918407369 1:184224173-184224195 AGAAGGTGGGTGGAGAGAGAGGG - Intergenic
918639114 1:186817139-186817161 AGAAGATGAAAGGAAAGAGAGGG - Intergenic
918825552 1:189319289-189319311 AGAAGATGGAAGAACTGAGTTGG - Intergenic
918830642 1:189392834-189392856 AGAAGGTGGAGGGAGGGGGTGGG + Intergenic
919360854 1:196592344-196592366 AGAGGCTGGGAGGATAGTGTGGG + Intronic
919877765 1:201883082-201883104 AGTAGGTGGAAGGCAAGAGCTGG - Exonic
920026725 1:203004097-203004119 AAAAGGTGGAATGAAAGAGTAGG + Intergenic
920030518 1:203034831-203034853 AGAAGGAGGAAGAAGAGAGAGGG - Intronic
920207323 1:204301968-204301990 TGAAGGTGGCAGGATGGACTAGG - Intronic
920303646 1:205005008-205005030 GGATGGTGGAAGCTTAGAGTGGG + Intronic
921269554 1:213455221-213455243 AGGAGGTGGAGGGAGAGTGTTGG + Intergenic
922099519 1:222469806-222469828 AGAAGGTGGCAGGATCCATTGGG - Intergenic
922261556 1:223949302-223949324 AGAAGGTGGCAGGATCCATTGGG - Intergenic
922735522 1:227976442-227976464 AGAAGGTGGCAGGATCCATTGGG + Intergenic
923220210 1:231886026-231886048 AGAAGGTGGAAAGGCAGAGAGGG + Intronic
923374565 1:233347728-233347750 AGAAGGTGGAGGGAAGGAGCGGG + Intronic
923446291 1:234074513-234074535 AGTAGGTGGAAAGATGAAGTGGG + Intronic
923593645 1:235343031-235343053 TGATGGTAGTAGGATAGAGTTGG - Exonic
924113711 1:240725400-240725422 AGAAGGAGGAAGGAGAGAAGAGG + Intergenic
924299497 1:242623046-242623068 AGAAGGAGGAATGATAGAGGTGG + Intergenic
924342721 1:243051478-243051500 AGAAGGTGGCAGGATCCATTGGG - Intergenic
924948391 1:248861324-248861346 AAAAGGTGGGAGGACAAAGTGGG - Intergenic
1062942651 10:1435612-1435634 AGGAAGTGGAAGGAGAGAGAGGG - Intronic
1063175753 10:3549427-3549449 AGAAGGTGGATGGGTGGAGTTGG + Intergenic
1063242917 10:4189902-4189924 AGAAGGTGGAAGGTGAGAGAAGG - Intergenic
1065338353 10:24678410-24678432 AGGAGGTGGAGGGAGAGAGCAGG - Intronic
1065372263 10:24999244-24999266 AGAAAGTGGAAGTAGAGAATTGG - Intronic
1066045546 10:31592306-31592328 AGAAGGAGGAAAGAAAGAGAGGG - Intergenic
1066084423 10:31962495-31962517 AGAAGGCAGAAGGAGAGACTGGG + Intergenic
1066198993 10:33128005-33128027 AGAAGGGGGAAGGAAAGAAGGGG - Intergenic
1067258232 10:44663859-44663881 AGAATGGGGAAGGATAAAGCAGG + Intergenic
1067514190 10:46922796-46922818 AGAAACTGGAAGGAAAAAGTGGG - Intronic
1067648064 10:48129035-48129057 AGAAACTGGAAGGAAAAAGTGGG + Intergenic
1067807865 10:49405748-49405770 AAAAGGAGGAAGGAGAGAGAGGG - Intergenic
1067923824 10:50487163-50487185 AGAGGGTGGAAGGAGGGAGAGGG + Intronic
1068894283 10:62182257-62182279 AGCAACTGGAAGGATCGAGTTGG + Intergenic
1068960660 10:62863501-62863523 AGAAGGGAGAAAGATAGGGTGGG - Intronic
1069397614 10:68007066-68007088 AGGAGGTAGAAGGAGAGAGAGGG - Intronic
1070264198 10:74886675-74886697 GTAAGGTGGAAGTACAGAGTAGG - Intronic
1070586236 10:77768857-77768879 TGAAGGTGGAAGGGTATGGTAGG + Intergenic
1070593807 10:77818683-77818705 AGAGGGTGGCAAGTTAGAGTGGG - Intronic
1070779062 10:79127070-79127092 AGAAGGAGGAAAGAAGGAGTTGG - Intronic
1071039973 10:81295904-81295926 AGAAGGTGGAAGGAGGGAAAAGG - Intergenic
1072719609 10:97772260-97772282 ATAAGGAGGAAGGATGGAGAAGG - Intergenic
1074837778 10:117315144-117315166 CCAAATTGGAAGGATAGAGTTGG + Intronic
1075288628 10:121209092-121209114 AGCAGGTGGAAGGGGTGAGTAGG + Intergenic
1075500525 10:122969661-122969683 AGAAGGTGGAAGGTGGGAGGAGG + Intronic
1076617031 10:131761914-131761936 AGAAGGAGGAAGGAAAGGGAAGG + Intergenic
1076969456 11:125010-125032 AGAAGGTGGCAGGATCCATTGGG - Intergenic
1077820399 11:5732270-5732292 AGAAGTTGGAAGTTTAGAGTTGG - Intronic
1078443106 11:11383851-11383873 ACAAGGTGGCAGGAGAGAGAGGG - Intronic
1078559392 11:12357339-12357361 AGAAAATGAAAGGACAGAGTAGG - Intronic
1078673657 11:13389020-13389042 AGAAGGAAGAAGGAAAGAGTCGG - Exonic
1078861273 11:15249439-15249461 AGAACCAGGAAGGATGGAGTAGG + Intergenic
1079120433 11:17680288-17680310 AGAAAGAGGAAGGAGTGAGTGGG - Intergenic
1079473165 11:20799850-20799872 AGAAGGAGGAAGGAGAGAGGGGG - Intronic
1079650597 11:22923372-22923394 ATAAGTAGGAAAGATAGAGTGGG + Intergenic
1079727367 11:23892321-23892343 AGGAGGTTGAAGGATAGTGAGGG + Intergenic
1080712865 11:34767597-34767619 AGAAAGTGGAAGGATAGAAAAGG - Intergenic
1080943583 11:36946817-36946839 AAAAGTTGGTAAGATAGAGTAGG + Intergenic
1081769181 11:45636837-45636859 ACAGGGTGGAAGGATGGAGTGGG - Intergenic
1083285328 11:61655054-61655076 ATAAGGTGGAACGAGAGACTTGG + Intergenic
1083969737 11:66067606-66067628 AGAAGCTGGCAAGATAGAGCAGG - Intronic
1084102049 11:66956235-66956257 GGAAGGTGGAAGGAGAATGTGGG - Intronic
1084351745 11:68606291-68606313 AGAAGGAGGAAGGAGGGAGGAGG - Intronic
1084467117 11:69330540-69330562 AGAAGGAGGAGGGAAAGAGAAGG - Intronic
1084919188 11:72455333-72455355 ACAAGATGGAATGCTAGAGTGGG + Intergenic
1085113964 11:73913485-73913507 AGATGGTGGAAGGCTAGATGGGG - Intronic
1085404245 11:76252425-76252447 AAAAGGTGGAAGGAGAGGGGTGG + Intergenic
1085583944 11:77682926-77682948 AGAATGTGATAAGATAGAGTTGG + Intronic
1086902880 11:92387422-92387444 AAAAGGTGGTGGGATAGACTGGG + Intronic
1087005338 11:93465323-93465345 AGCAGGTGGCAGGCTAGATTTGG + Intergenic
1087093656 11:94300082-94300104 AAAAGGAGGAAGAATAGAGGAGG + Intergenic
1088010111 11:104990402-104990424 AGAAGCTGGAAGGGTAGTGGAGG + Intergenic
1089067419 11:115672462-115672484 AGAAGGTGGACGAACAGTGTGGG - Intergenic
1089905613 11:122035157-122035179 AGAAGGTTGAAGGATGGAGCTGG + Intergenic
1090590614 11:128262959-128262981 AGAATGGGGAAGGAGAGAGACGG + Intergenic
1090645813 11:128765682-128765704 AGAAGTTTGAAGGATTAAGTTGG - Intronic
1091090243 11:132764242-132764264 AGAAAGTGGAAGTATAGAGTGGG + Intronic
1091471815 12:735199-735221 AGAAGGGGAAAGAATAGACTAGG + Intergenic
1092488712 12:8925554-8925576 AGAATGTGGAAGGAGAGTGTTGG + Intronic
1092992742 12:13918899-13918921 AGTGGGTGGAAGGATTGAGAAGG - Intronic
1093498666 12:19784710-19784732 AGAAGGGGGAAGGAGGGAGGGGG - Intergenic
1094156190 12:27339103-27339125 GGAAGGTGGAAGGTTGGAGAGGG - Intronic
1094782189 12:33803547-33803569 AGAAGGTGGAGGGTGGGAGTAGG - Intergenic
1095090454 12:38099562-38099584 AGAAGGTGGAAGAGTAGAGATGG - Intergenic
1095200373 12:39377480-39377502 AGAAGGTGGAGAGTTAAAGTAGG - Intronic
1095300955 12:40582899-40582921 ACAGGGTGGCAGGACAGAGTGGG + Intergenic
1095596570 12:43965894-43965916 AGCAGGTGGAGAGATGGAGTGGG - Intronic
1095600768 12:44010469-44010491 GGGAGGTGGAGGGATAGAATGGG - Intronic
1095647762 12:44569025-44569047 GGAAGGTGGAAGGTGGGAGTAGG - Intronic
1095936998 12:47695110-47695132 AGAAGGAGGGAAGAAAGAGTGGG + Intronic
1095943232 12:47739697-47739719 AGAAGAGGCGAGGATAGAGTTGG - Intronic
1096603785 12:52749911-52749933 AGAAGGAGGAAGGAAAGAGTCGG + Intergenic
1096605763 12:52765001-52765023 GAAAGGAAGAAGGATAGAGTTGG - Intergenic
1096811463 12:54173036-54173058 TGAAGGTGGAAGGATGCAGAAGG + Intronic
1097622729 12:61961133-61961155 AGAAGGAGGAAAGAGAGAGAAGG + Intronic
1098544812 12:71700019-71700041 AGAGGTTGGAAGGCTAGAGAAGG + Intronic
1098873687 12:75844741-75844763 AGAAGGTAGAATGGTAGAATCGG + Intergenic
1099134097 12:78872597-78872619 AGAAGGAAGAAGGGCAGAGTAGG - Intronic
1099832260 12:87858660-87858682 AGAGGGTGGGAGGAGAGAATAGG + Intergenic
1101297795 12:103442513-103442535 GGAAGGTGCAATGATAGAATAGG - Intronic
1101407254 12:104439437-104439459 AGAAGGCAGAAGGAGAGACTGGG - Intergenic
1101609979 12:106282512-106282534 GTAAGGAGGAAGGATAGGGTAGG - Intronic
1101616441 12:106342499-106342521 AGGAGGAAGAGGGATAGAGTAGG + Intronic
1101969285 12:109301478-109301500 AGAGGATGGAAGGAGAGAGGTGG - Intronic
1102237630 12:111304152-111304174 AGAAGGTGGAAGTGCAGAGTGGG + Intronic
1102244938 12:111349590-111349612 GGAAGGTAGGAGGATAGATTTGG - Exonic
1102775380 12:115514337-115514359 AAAATGTGGAAGGGTAGAATAGG - Intergenic
1103310890 12:120006918-120006940 TGAGGGTGGAGGGATAGAGATGG + Intronic
1103356722 12:120327026-120327048 AGAAAGGGGAAGAATAGAGCAGG + Intronic
1103417968 12:120757259-120757281 AGTAGGTGGCAGGAAAGAGCTGG - Intergenic
1103463399 12:121122915-121122937 AGATGGTGAAAGGGAAGAGTGGG + Intergenic
1103794389 12:123493510-123493532 ATAAGGTGGAACGAGAGACTTGG - Intronic
1104374673 12:128253625-128253647 AGAAGGTAGAAGCAAAGACTGGG + Intergenic
1104650599 12:130529458-130529480 GGAAGGAGGAAGGAAAGAGGAGG + Intronic
1104650988 12:130533868-130533890 AGAAAGTGGAATGATAGGCTGGG + Intronic
1105225885 13:18431194-18431216 AGAATGACTAAGGATAGAGTAGG - Intergenic
1105720243 13:23106681-23106703 GGAACGTGGAAGAATAGAGAAGG + Intergenic
1106108221 13:26753426-26753448 GGAAGGAGTAAGGATATAGTTGG + Intergenic
1106254210 13:28007988-28008010 AGAAGGTGGAGAGAGAGAGGAGG - Intronic
1106384969 13:29275517-29275539 AGAAGCTGGAAGGGTAGTGGTGG - Intronic
1107790646 13:43998808-43998830 ACATGGTGGAAGGAGAGAGATGG - Intergenic
1108162328 13:47653982-47654004 GGAAGGTGGGAGGAGAGAGAAGG - Intergenic
1108426480 13:50306917-50306939 AGAGGGAGGAAGGAGAGAGGCGG - Intronic
1108675997 13:52738806-52738828 AGAAGATTGAAGCGTAGAGTAGG - Intronic
1108679920 13:52771199-52771221 AGAAGGAGGAGGGAGAGAGGAGG - Intergenic
1110424837 13:75355128-75355150 GGAATGTGGAAGGCGAGAGTCGG + Intronic
1110511773 13:76359211-76359233 ATGAGGTGAAAGGAAAGAGTTGG - Intergenic
1111475681 13:88743764-88743786 ACAAGGTGGCAGGAGAGAGAAGG - Intergenic
1112023311 13:95390785-95390807 AGAAGGCGGAAGGGGAGAGGAGG - Intergenic
1112052425 13:95656157-95656179 ACAAGGTGGCAGGAGAGAGAAGG + Intergenic
1112441399 13:99427047-99427069 AGAGGGTGGAAGGGGGGAGTAGG + Intergenic
1113645165 13:111989794-111989816 ACAAGGTGGCAGGAGAGAGAAGG - Intergenic
1113831434 13:113298385-113298407 AGGAGGTGAAAGAATAGTGTTGG - Intronic
1115171036 14:30507378-30507400 AGAAGCTGGAAGGATTGAGGAGG - Intergenic
1115587931 14:34833680-34833702 AGCTGGGGGAAGGATAGAATGGG + Intronic
1115773238 14:36687994-36688016 ATAAGTTGGAAGCATATAGTGGG - Intronic
1116943393 14:50812538-50812560 AGAAAGTGGAAGGGTGGAATGGG + Intronic
1117169150 14:53073458-53073480 GGCAGGTGGAGGGATATAGTGGG - Intronic
1117528694 14:56637865-56637887 AAAAGGTGGCAGGCTAGAGAGGG + Intronic
1118113954 14:62752798-62752820 ACAAGGTGGCAGGAGAGAGAGGG - Intronic
1119090207 14:71773886-71773908 AGAAGGTGGCAGGGTAGGGAGGG + Intergenic
1119095487 14:71826333-71826355 CCAAGGTGGGAGGAAAGAGTAGG - Intergenic
1119109398 14:71957496-71957518 AGGAGATGGAAGGACATAGTGGG + Intronic
1120274418 14:82353417-82353439 GGAAGGGGGAAGGATAGCATTGG + Intergenic
1120289113 14:82544566-82544588 AGTAGATTGAAGGTTAGAGTAGG - Intergenic
1120610572 14:86636441-86636463 AGAAGGTGGAGGGAAGGAGAGGG + Intergenic
1121586925 14:95068934-95068956 TGAAGGAGGAAGGATGGAGCAGG + Intergenic
1121981425 14:98457755-98457777 AGAAGGTAGAAAGGTAGAGAAGG - Intergenic
1122422612 14:101587044-101587066 AGAAGGTGGGGGGATGGAGAGGG + Intergenic
1122686433 14:103510063-103510085 AGATGGTGAAAGGGCAGAGTTGG - Intergenic
1202832683 14_GL000009v2_random:53878-53900 AGAACGGGGAGGGACAGAGTGGG + Intergenic
1124491034 15:30155736-30155758 ACAAGCTGGAAATATAGAGTAGG + Intergenic
1124690727 15:31820055-31820077 AGAATGTTTAAGGATGGAGTGGG - Intronic
1124752503 15:32382595-32382617 ACAAGCTGGAAATATAGAGTAGG - Intergenic
1125283785 15:38071507-38071529 AGAAGTTTGAAGGAAAGGGTAGG - Intergenic
1125891062 15:43267615-43267637 CGCAGGTGGAAGGAGAGAGAGGG + Intergenic
1126145139 15:45466798-45466820 AGAAGATGGAAGGTTAGAAATGG + Intergenic
1126540589 15:49818057-49818079 GGAAGGTGGAATGACATAGTGGG + Intergenic
1126704837 15:51397404-51397426 AGAAGGGGGAAGGGGAGAGAGGG - Intronic
1128614045 15:69095579-69095601 GGAAGGTGGAAGGAGGGAGGAGG - Intergenic
1128674524 15:69598830-69598852 AGAAGGAGGAAGAACAGAGTTGG + Intergenic
1129681800 15:77662352-77662374 AGAGGGAGGAAGGATGGGGTTGG + Intronic
1129683437 15:77671301-77671323 AGAAGGTAGAGGGAGAGAGAAGG + Intronic
1129783839 15:78294423-78294445 AGCAGGTGGCAGGTCAGAGTGGG - Intronic
1130129077 15:81121858-81121880 AGAAGGTGGAAGGTGGGAGGAGG - Intronic
1131408960 15:92189897-92189919 AGAAGCTGGAAGAAAAGGGTAGG - Intergenic
1131852117 15:96554595-96554617 AGAAGGAAGAAGGAAAGAGTAGG - Intergenic
1132012916 15:98291911-98291933 AGAAGGTGGAAAGAGAGAGGAGG + Intergenic
1132019330 15:98346743-98346765 ACATGGTGGAAGGAGAGAGAGGG + Intergenic
1132159809 15:99529704-99529726 ACAGGGTGGCAGGATGGAGTGGG - Intergenic
1132567934 16:631694-631716 AGAGGGTGGGAGGAGAGGGTGGG - Intronic
1132568051 16:632138-632160 AGAGGATGGAAGGAGAGGGTGGG - Intronic
1134634023 16:15778675-15778697 AGAGGCTGGAAAGATAGAGGTGG + Intronic
1134768235 16:16781261-16781283 AGAAGGGGGAAGGAGAATGTTGG - Intergenic
1134874177 16:17681939-17681961 AGAAGATGGAAAGAGAGAATAGG - Intergenic
1134894955 16:17877413-17877435 AGGAGGTGGAAGAAAAGAGAGGG - Intergenic
1135006647 16:18829856-18829878 GGAAGGGGGCAGGATAGAGTAGG - Intronic
1136173508 16:28502503-28502525 ACATGGAGGAAGGATGGAGTTGG - Intronic
1136607811 16:31348359-31348381 AGAAGAAAGCAGGATAGAGTGGG - Intergenic
1136769729 16:32825725-32825747 AGAGGGTGGAGGGATAGCATTGG + Intergenic
1137075415 16:35955596-35955618 ATAAGGTGGAACGAGAGACTTGG + Intergenic
1137549730 16:49429209-49429231 AGAAGCTTGAAGGATAGATCTGG - Intergenic
1138580726 16:57939140-57939162 AGAGGCTGGAAGGAAGGAGTTGG + Intronic
1138623935 16:58234227-58234249 AAAAGGTGGAGGGACTGAGTGGG + Intronic
1138854173 16:60667851-60667873 ATAAGGTGTAAGGATCGTGTGGG - Intergenic
1139034199 16:62923510-62923532 AAAAGGTGGAAAGAGAGAGCTGG + Intergenic
1139354958 16:66362022-66362044 AGAAGGAGGAAGGAAAGCATGGG + Intergenic
1139551159 16:67673861-67673883 AGAGGGCGGAAGGTTAGAGAAGG + Intergenic
1140003336 16:71048723-71048745 GGAGGGTGGAAGGAGAGAGAAGG + Intronic
1140275425 16:73504534-73504556 AGAGGGAGGAAGGAAAGAGAAGG + Intergenic
1140676702 16:77339049-77339071 AGAAAGAGGAAGGACAGAGTTGG + Intronic
1140767050 16:78169695-78169717 AGAAGGAGGTAGGGTAGAGTGGG + Intronic
1141165141 16:81655306-81655328 AGAAGGTGGAAGGATCTGGAGGG + Intronic
1142451219 16:90174112-90174134 AGAAGGTGGCAGGATCCATTGGG + Intergenic
1203072146 16_KI270728v1_random:1087830-1087852 AGAGGGTGGAGGGATAGCATTGG + Intergenic
1143273103 17:5690077-5690099 AGAGGGTGGCAGGGTACAGTGGG + Intergenic
1143410365 17:6704840-6704862 AGTAGGGGGAAGGATTGAGAAGG - Intronic
1144192894 17:12862326-12862348 AAAACGTGCAAGGGTAGAGTTGG - Intronic
1145095776 17:20024778-20024800 TGAAGCTGGAAGGATAAAGGAGG - Intronic
1145304690 17:21667026-21667048 AGAATGAGGGAGGATAAAGTTGG - Intergenic
1146147018 17:30427925-30427947 AGGAGGAGGAAGAACAGAGTAGG - Intronic
1146575914 17:33991435-33991457 AGCCGGTGGCAGGATAGATTGGG - Intronic
1146805829 17:35864471-35864493 AGAAGAGGCAAGGATAGAGGAGG - Intronic
1146943876 17:36861336-36861358 AGAAGGTGGAGTGAGAGAGGAGG + Intergenic
1147556336 17:41481531-41481553 AGAAGATGGAAGGGTAAACTTGG + Intergenic
1147584385 17:41645380-41645402 AGGAGGTGGAAGGGTAGAGAGGG - Intergenic
1147862810 17:43533444-43533466 AGGAGAAGGAAGGATAGAGGGGG + Intronic
1147958699 17:44152963-44152985 CCCAGGTGGAAGGAGAGAGTGGG + Intronic
1148792807 17:50183204-50183226 AGAAGGTGAAGGGAAAGAGAAGG + Intergenic
1149120290 17:53155408-53155430 AGAGGGTGGAGGGTTAGAGAAGG - Intergenic
1149299896 17:55295567-55295589 AGATGTTGGAAGGTTAGAGGCGG + Intronic
1149429824 17:56588761-56588783 AGAAAGAGGAGGGAGAGAGTGGG - Intergenic
1150175506 17:63050379-63050401 AGAAAGTGGAAATATAGGGTAGG + Intronic
1150312097 17:64137116-64137138 AGGTGGTGGATGGATAGAGCAGG + Intergenic
1151032171 17:70754200-70754222 AGATGGTGGAAAGAAAGAGATGG + Intergenic
1151100519 17:71550844-71550866 AGGAGGGGGAAGGAAAGAGAGGG + Intergenic
1151105414 17:71610643-71610665 AGAAGGGGGAGGGAGAGAGGAGG + Intergenic
1151105603 17:71612868-71612890 AGAAGGGGGAGGGAGAGAGGAGG + Intergenic
1151617313 17:75221955-75221977 AGAATGTGGGAGGATAAGGTTGG + Intronic
1151937332 17:77270608-77270630 AGTAGGTGCAAGGAGAGAGCAGG - Intergenic
1151966108 17:77432626-77432648 AGCGGGAGGAAGGATGGAGTGGG + Intronic
1152024018 17:77797031-77797053 ACTAGGTGGGGGGATAGAGTAGG + Intergenic
1153850068 18:9085691-9085713 GTAAGGTGGAAGGATTGCGTGGG - Intergenic
1154055829 18:11013247-11013269 AGAAGGAGGCAGGAGAGAGGTGG + Intronic
1154465613 18:14641095-14641117 AGAGGGAGGAGGGAAAGAGTTGG - Intergenic
1155199557 18:23504985-23505007 AGAAGGTGAAAGTATAATGTAGG + Intronic
1155532087 18:26777518-26777540 AGAAGGTGGGAGGAGAGCGGAGG - Intergenic
1156569209 18:38233514-38233536 AGAAGATGGTGGGACAGAGTTGG + Intergenic
1157446913 18:47753120-47753142 GGCAGGTGGAGGGATAGAGGCGG - Intergenic
1157523697 18:48362800-48362822 AGAAGGTGCTAGTTTAGAGTAGG - Intronic
1158341302 18:56469380-56469402 AGAAGGAGAAAGGAGAGATTTGG + Intergenic
1159211082 18:65322984-65323006 ACAAGGTGGCAGGAGAGAGAAGG + Intergenic
1159484856 18:69042893-69042915 ATAAGGTGGAACGAGAGACTTGG + Intronic
1160325843 18:77947634-77947656 AGGAGGTGGATGACTAGAGTGGG + Intergenic
1160345494 18:78128678-78128700 AGCAGGGGACAGGATAGAGTGGG - Intergenic
1160646261 19:194936-194958 AGAAGGTGGCAGGATCCATTGGG - Intergenic
1160905933 19:1451798-1451820 CGCAGGTGGGAGGATGGAGTCGG - Exonic
1160965703 19:1746112-1746134 AGAAGGGGGAAGGATGGGGAGGG + Intergenic
1163046855 19:14649442-14649464 AAAAGGTGGAAAGAGAGAGATGG - Intronic
1163575628 19:18109602-18109624 AGAGGGAGGAAGGACAGAGCTGG + Intronic
1164209309 19:23084604-23084626 AGAGGGTGGAAGGTTGGAGGAGG - Intronic
1164292496 19:23880603-23880625 AGAAGGTGGAGGAAAAGAGGAGG + Intergenic
1164534109 19:29071988-29072010 AAATGGTGGAGGGATAGATTGGG + Intergenic
1164926881 19:32137626-32137648 AGAAAGTGGAAGGAGAAAGGAGG + Intergenic
1164933124 19:32190524-32190546 AGAAGGGGGAAAGAGAGAGGAGG - Intergenic
1167474185 19:49690717-49690739 GGAAGGTGCATGGATTGAGTTGG - Intergenic
1167622831 19:50568534-50568556 AGAGGGAGGAAGGAAAGAGGGGG + Intergenic
1168259538 19:55185767-55185789 AGTGGGTGGAAGGTTGGAGTTGG + Intronic
1168450845 19:56465589-56465611 GGAAGGTGGAAGCACAGAGAGGG + Intronic
1202639998 1_KI270706v1_random:73853-73875 AGAACGGGGAGGGACAGAGTGGG - Intergenic
925480194 2:4261921-4261943 AGAAGAGGGAAGGAGAGAGAAGG + Intergenic
925746213 2:7045770-7045792 AGAAGGTGGACGGGTACAGCAGG + Intronic
926638356 2:15207712-15207734 AAAAGGTGGCAGGAGAGAGAAGG - Intronic
926689164 2:15721029-15721051 ACAAGGCGGCAGGAGAGAGTGGG - Intronic
926829523 2:16945991-16946013 AGAAGTTGGAAGAAATGAGTTGG - Intergenic
926873016 2:17444233-17444255 AGAATGAGGAAGGAGAGAGGAGG + Intergenic
927982366 2:27381983-27382005 AGAAGGTGGAACTTTGGAGTCGG + Intronic
928626968 2:33149625-33149647 AGAGGGTGCAAGGATTGAGATGG + Intronic
928808291 2:35189321-35189343 AGAAGGTGGAAGGTGAGAGGAGG - Intergenic
929535709 2:42783123-42783145 TGATGGTGGAGGGGTAGAGTGGG - Intronic
929781727 2:44961482-44961504 AGAAGGTGGAGGCAGAGAGAGGG + Intergenic
929885299 2:45872717-45872739 AGCAACTGGAAGGACAGAGTTGG + Intronic
930002308 2:46869646-46869668 AGTAGGGGCAAGGAAAGAGTAGG - Intergenic
931266300 2:60663368-60663390 AGGAGGTGGATGGAAAAAGTTGG - Intergenic
931859722 2:66342154-66342176 CAAAGGAGGAAGGAGAGAGTAGG - Intergenic
931920482 2:67009777-67009799 ACAAGGTGGCAGGAGAGAGAAGG + Intergenic
932413002 2:71558353-71558375 TGGAGGTGGGAGGACAGAGTGGG + Intronic
932751876 2:74376375-74376397 CGACTGTGGAAGGATAGACTGGG - Intronic
932817666 2:74874715-74874737 AGAAGGTGGAAAGAAAGAGCAGG - Intronic
933209606 2:79551777-79551799 AGAAGGAGGAAGAAGGGAGTGGG + Intronic
934069962 2:88374675-88374697 AGAAGATGGAAGAAGAGAGAAGG + Intergenic
934819074 2:97356326-97356348 AGAAGGTGGAACGTGAGAGAGGG - Intergenic
935095628 2:99941691-99941713 AGAAGGAGGAAGGACAGAAGAGG - Intronic
935684297 2:105669978-105670000 AGCAGGTGGGAGGAGAGAGAAGG - Intergenic
936673367 2:114685211-114685233 ACAAGTTGGAAGGAGTGAGTTGG - Intronic
936996137 2:118416305-118416327 AGAAGGTGGGAGTACAGAGAAGG - Intergenic
937443587 2:121937642-121937664 AGCACCTGGAAGGATTGAGTTGG + Intergenic
937492290 2:122382657-122382679 AGAAGGTGGAAGCAGAAAGAGGG + Intergenic
937786468 2:125905036-125905058 ATAGGGTGGCAGGACAGAGTGGG - Intergenic
938647975 2:133350886-133350908 TGAAGGGGGAAGGAGAGAGAGGG - Intronic
939071116 2:137544437-137544459 AGAAGGGGGAAGAATATAATGGG + Intronic
939143755 2:138388193-138388215 TGAAGCTGGAAGGATAAAGAGGG + Intergenic
939160414 2:138582405-138582427 ACAAGAGGGAAGGAGAGAGTAGG + Intergenic
939640336 2:144633380-144633402 AGAAGGTGGGAGGCTAGGGGAGG - Intergenic
940058305 2:149536629-149536651 AGAAGTTGGGTAGATAGAGTGGG + Intergenic
940831689 2:158473658-158473680 AGAGGGTGGGAGGAGAGAGGGGG + Intronic
941065952 2:160903005-160903027 AGAGGGTGTCAGGGTAGAGTAGG + Intergenic
941234118 2:162947674-162947696 AGAAGGGGAAGAGATAGAGTGGG + Intergenic
942825853 2:180175218-180175240 AGAAGCTGGAAGAGTTGAGTAGG + Intergenic
942879776 2:180845217-180845239 AGAAGGAGAATGGATAAAGTAGG + Intergenic
943046671 2:182868156-182868178 ATAAGCTGAAAGGGTAGAGTGGG - Intergenic
943312283 2:186341123-186341145 AGAAGGTGCAGGGATTGACTGGG + Intergenic
943823021 2:192351751-192351773 ACAAGGTGGCAGGAAAGAGAGGG + Intergenic
944794011 2:203163563-203163585 TGAAGGAGGAAGGATTGATTGGG - Intronic
945482081 2:210356614-210356636 GGAGGGGGGAAGGATAGAATTGG + Intergenic
945786787 2:214249427-214249449 AGAAGGAGGAAAGATAGGGATGG + Intronic
945809164 2:214527244-214527266 AGAGGGTGGAGGGAAGGAGTGGG + Intronic
946029032 2:216690747-216690769 AGAAGGTCGGAGGGAAGAGTAGG + Intronic
946193399 2:218019601-218019623 AGAAGGAGGAAGTTTAGGGTGGG - Intergenic
946410743 2:219514043-219514065 AGGAGGTGGGGGGATAGAGTTGG + Intergenic
946494788 2:220184916-220184938 AGAAAATAGAAGAATAGAGTTGG + Intergenic
946645249 2:221826369-221826391 GGAAAGTGGATGGATAGGGTGGG - Intergenic
947083381 2:226423572-226423594 AGAAGGAGGAAGCACAGACTGGG - Intergenic
948222659 2:236285322-236285344 AGAAGGTGGAAGGACAAAAAGGG - Intergenic
948545446 2:238725369-238725391 GGAAGGTAGGAGGACAGAGTAGG + Intergenic
1169464717 20:5827295-5827317 AGGAGGTGGAAGGAGGGAGGAGG - Intronic
1169765470 20:9143563-9143585 GGATGGTGGAAGGATAGTTTTGG + Intronic
1173123885 20:40318946-40318968 ACAAGATGGCAGGATAGAGATGG + Intergenic
1173257591 20:41405780-41405802 AGAAGCTGGCAGAAGAGAGTGGG + Intronic
1173402979 20:42741068-42741090 AGAAGGTGTAAGGAGTGAGAGGG + Intronic
1173444846 20:43108397-43108419 AGAATATGGAAGGATAGCATTGG - Intronic
1173649400 20:44653376-44653398 ACAAGGGGGAAAGAGAGAGTGGG + Intergenic
1174727139 20:52874842-52874864 AGAAGGTGGTGGGCTAGAATTGG + Intergenic
1175532423 20:59683084-59683106 AGAAGGTAGAATGATGCAGTTGG + Intronic
1175651283 20:60726168-60726190 TGAAGGTGACTGGATAGAGTAGG - Intergenic
1175656909 20:60779000-60779022 AGAAGTTGGAAGTCAAGAGTTGG - Intergenic
1176279247 20:64291280-64291302 AGAAGGTGGCAGGATCCATTGGG + Intergenic
1176769939 21:13060218-13060240 AGAATGGCTAAGGATAGAGTAGG - Intergenic
1176808944 21:13517387-13517409 AGAGGGAGGAGGGAAAGAGTTGG + Intergenic
1176915451 21:14620369-14620391 ACATGGTGGCAGGAGAGAGTAGG - Intronic
1177380202 21:20330859-20330881 ACATGGTGAAAGGGTAGAGTGGG + Intergenic
1178252498 21:31017710-31017732 AGAATGTTGAATGATGGAGTTGG + Intergenic
1178512587 21:33218257-33218279 AGAAGATGGAAGGACAGAAGAGG - Intergenic
1178575015 21:33779024-33779046 AGAAGGAGGAGAGATAGAGTAGG - Intronic
1178581971 21:33845398-33845420 GGAAGCTGGAAGGAGAGAGTGGG - Intronic
1178787074 21:35663669-35663691 AGAAGGTGGAAAGATAGGGCAGG + Intronic
1179010200 21:37550796-37550818 AGAAGGTGGGAGGACTGAGAGGG + Intergenic
1179158441 21:38872471-38872493 ACAAGGTGGCAGGAGAGAGGGGG - Intergenic
1179791632 21:43759310-43759332 GGAAGGTGGACGGGCAGAGTGGG - Exonic
1180246138 21:46548615-46548637 AGAAGGTGGAAAGTCAGATTAGG + Intronic
1180324515 22:11357304-11357326 AGAAGGAGAAAAGTTAGAGTAGG + Intergenic
1182448201 22:30402128-30402150 AGATGGTGGAGGGGTAGTGTGGG + Intronic
1182448219 22:30402220-30402242 AGCAGGTGGGTGGAGAGAGTGGG + Intronic
1182794472 22:32980814-32980836 TGAAGGTGGGAGGAGACAGTAGG - Intronic
1182902541 22:33910424-33910446 AGGAGATGGGAGGATAGGGTAGG - Intronic
1183176975 22:36231487-36231509 ATAAGGTTGGAGGATAGTGTAGG + Intronic
1184196445 22:42932337-42932359 AGAAGGTAACAGGCTAGAGTTGG - Intronic
1185063854 22:48621018-48621040 GGAGGGTGGATGGATAGTGTGGG - Intronic
1185117984 22:48948977-48948999 AGTAGGGGGAAGGCTGGAGTGGG - Intergenic
1185268969 22:49919477-49919499 AGAAGCTGGAAGGCCAGAGAGGG - Intronic
1185393657 22:50576118-50576140 GGGAGGTGGAAGGTTAGAGCTGG + Intronic
949174743 3:1046650-1046672 AATAGTTGGATGGATAGAGTTGG + Intergenic
949491210 3:4590864-4590886 GGAGGGTGGAAGGAGAGAGAGGG - Intronic
950555520 3:13693522-13693544 AGAAGATGGGAGGGTAGAGAGGG - Intergenic
951578014 3:24133402-24133424 AGAAGGTGGAAAGGTTGACTTGG - Exonic
951818051 3:26777407-26777429 AGAAGGTGGGAGGATAGTGAAGG + Intergenic
951830666 3:26923051-26923073 AGAAGTTGGAAGGTAAAAGTTGG - Intergenic
952125448 3:30294505-30294527 AAATGCTTGAAGGATAGAGTTGG + Intergenic
952559480 3:34573946-34573968 AGAAGGAGGAAGGAAGGAGGAGG - Intergenic
952859425 3:37800647-37800669 AGGAGGTGGTAGGACAGAGTGGG - Intronic
952937780 3:38413616-38413638 AGATGGTGAAAGGAGAGAATGGG - Exonic
953436615 3:42882228-42882250 AGAGGGTGGAGGGATAGGGTGGG + Intronic
953807592 3:46084791-46084813 AGAGGGTGGAAGAAAGGAGTGGG + Intergenic
954191304 3:48963915-48963937 AGAAGGGGGAAGGATCCATTTGG - Intronic
954213664 3:49112240-49112262 GGAAGGTGGAAAGAAAGGGTAGG + Intronic
954360890 3:50122269-50122291 AGAAGGTGGCAGGAGGGAGGTGG + Intergenic
955019721 3:55107521-55107543 AGTTGGTGGATGGATGGAGTGGG + Intergenic
955566227 3:60249725-60249747 AGAAGGGGGAAGGAAAAAGAGGG + Intronic
955858540 3:63300806-63300828 AGAGGGAAGAAGGATAGAGCAGG - Intronic
957086437 3:75683500-75683522 AGAAGGAGAAAAGTTAGAGTAGG - Intergenic
957354410 3:79062831-79062853 AGCAGGTGGAAGGCTGGAGGAGG + Intronic
957846670 3:85745407-85745429 GGAAGGGGGAAGGCTAAAGTTGG + Intronic
958062561 3:88503227-88503249 GGAAGGGGGAAGGATAGCATCGG - Intergenic
958657974 3:97027287-97027309 AGAGGGTGGAGGGTTAGAGGAGG + Intronic
959300462 3:104593050-104593072 AAAAGGAGGAAGGACAGTGTTGG + Intergenic
959310770 3:104734018-104734040 AGAAGGTGAAATGATTGAGGTGG - Intergenic
959369468 3:105504866-105504888 AGAAGGGGGAAGGGAAGAGCTGG - Intronic
959481604 3:106879487-106879509 AAAAAGTGGAAGTAGAGAGTAGG + Intergenic
959632415 3:108522179-108522201 AGATGGTGGAAAGACAGAGGGGG + Intronic
960163551 3:114376565-114376587 GGAAGGTGGATGGCAAGAGTTGG + Intronic
960221316 3:115112460-115112482 AGAGGCTGGGAGGATTGAGTGGG - Intronic
960471002 3:118065143-118065165 AGAAGGTGGAAGGACAAAAAGGG + Intergenic
960542144 3:118872628-118872650 AGTAGATAGAAGGATAGACTGGG + Intergenic
961048677 3:123727664-123727686 AGAGAGTGGAGGGATAGAGTAGG + Intronic
961584025 3:127907479-127907501 AGCAGGTGGAAGGAAAGGGCTGG + Intergenic
962591562 3:136894729-136894751 AGCAGGTGGCAGGATGGAATTGG - Intronic
962731677 3:138289421-138289443 AGAAGGTGAGAGGAGAGAGTGGG + Intronic
964324874 3:155534833-155534855 ACAAGGTGGCAGGAGAGAGAAGG - Intronic
964417307 3:156460978-156461000 AGAAGGGAGAAGGAGAAAGTAGG - Intronic
964428110 3:156574492-156574514 GGTAGGTGGAGGGATAGATTAGG - Intergenic
965021140 3:163233070-163233092 AGAAGGAGGAGGAAGAGAGTTGG - Intergenic
967229565 3:187324633-187324655 AGATCCTGGAAGGATGGAGTTGG + Intergenic
968289789 3:197529912-197529934 AGAAGGATGAAGGGAAGAGTGGG - Intronic
968371420 3:198224590-198224612 AGAAGGTGGCAGGATCCATTGGG + Intergenic
1202738553 3_GL000221v1_random:33539-33561 AGAATGGGGAGGGACAGAGTGGG + Intergenic
968629362 4:1642176-1642198 AGGAGGTGCAAGGACAGAGAAGG - Intronic
969126463 4:4951879-4951901 AGAGGGTGGAAGAGTTGAGTTGG + Intergenic
969982103 4:11168302-11168324 AGAAGGGGGAGGGATAGCATTGG - Intergenic
970576466 4:17433571-17433593 AGAAGGGGGAAGGTGGGAGTGGG + Intergenic
970886429 4:20992266-20992288 ACAGGGTGGCAGGATGGAGTGGG + Intronic
970904248 4:21196944-21196966 AGAAGGTGCAGAGATTGAGTGGG - Intronic
971251268 4:24975331-24975353 AGAAGGGGGAAGGAGAGGGAGGG + Intronic
972242260 4:37205645-37205667 TGAATGTTGAAGGATTGAGTAGG + Intergenic
972367165 4:38386965-38386987 AGAAGTAGGAAGGAAAGAGAAGG - Intergenic
973286078 4:48418121-48418143 AGAAGGAGGAAGGAGAAAGAAGG - Intronic
973370245 4:49240196-49240218 AGAACGGGGAGGGACAGAGTGGG - Intergenic
973390784 4:49555224-49555246 AGAACGGGGAGGGACAGAGTGGG + Intergenic
973874363 4:55201299-55201321 AGAAGGTTGAAAGTTATAGTAGG + Intergenic
974972617 4:68848034-68848056 AGATGGTGGAAGGTTGGAGGAGG - Intergenic
975030487 4:69608430-69608452 GGAGGGGGGAAGGATAGCGTTGG + Intronic
976096862 4:81517619-81517641 AGAAGGTGGTGGGCTAGATTTGG + Intronic
976522334 4:86042993-86043015 GGAAGGAGGAAGCATAGATTTGG + Intronic
978224619 4:106318472-106318494 AGAAGTTGGAAGGCAAGAATAGG + Intronic
978234026 4:106436091-106436113 AGAATGTGGAAGGAAAATGTAGG + Intergenic
978765816 4:112403860-112403882 AGAAGGGGGAAAAATAGATTAGG + Intronic
979260106 4:118637063-118637085 AGAAGGTGGCAGGATCCATTGGG + Intergenic
979328270 4:119403565-119403587 AGAAGGTGGCAGGATCCATTGGG - Intergenic
979428617 4:120598846-120598868 ACATGGGGGAAGGATAGCGTTGG + Intergenic
981082627 4:140650429-140650451 TGAAGGTGGTAGGAAAGGGTGGG - Intronic
981559246 4:146029047-146029069 AGAAGGTGGGGTGATGGAGTCGG - Intergenic
982458638 4:155640207-155640229 TGAAGCAGGAAGGCTAGAGTTGG - Intergenic
982627741 4:157788712-157788734 AGCAGGGAGAAGGATAGTGTGGG + Intergenic
982771899 4:159404144-159404166 AGAAGGTCTAAGGAAAGAGGCGG - Intergenic
984871961 4:184333669-184333691 AGAAGGAAGAAAGAGAGAGTGGG + Intergenic
984886574 4:184455181-184455203 AGAAGGTGGAGGGAATCAGTGGG - Intronic
985218580 4:187678479-187678501 AGCAAGTGGAAGGGTAGAATGGG + Intergenic
1202767358 4_GL000008v2_random:159712-159734 AGAATGGGGAGGGACAGAGTGGG - Intergenic
985804691 5:2033955-2033977 AGAAGGTCTAAGGGTAGAGAAGG - Intergenic
986505080 5:8441366-8441388 GGAAGATTGAAGGATTGAGTAGG + Intergenic
986544387 5:8879832-8879854 GGAAGGGGGAAGGGAAGAGTGGG - Intergenic
986772617 5:10987711-10987733 AGAAGGTGGAAGGGGAGGGGAGG - Intronic
986830469 5:11571769-11571791 AGAAGGTAGATGGACAAAGTGGG - Intronic
987617134 5:20290799-20290821 AGAAGGTGGAAGTGTGGACTAGG + Intronic
987622079 5:20347419-20347441 AGAATGGGGAAGGAGAGAGGAGG + Intronic
987929039 5:24379498-24379520 AGAAGAGGGATGAATAGAGTTGG + Intergenic
988318101 5:29657810-29657832 AGAGGGTGGAGGGAGAGAGGAGG + Intergenic
989542337 5:42632004-42632026 AGGGGGTGGAAGGAGAGAGGAGG - Intronic
989807898 5:45633971-45633993 AGAAGGGTGAAGGATTTAGTTGG + Intronic
990412518 5:55555071-55555093 AGAATGTGGGTGGAGAGAGTAGG + Intergenic
990938790 5:61179005-61179027 ATAAGGTGGAAAGCTAGACTAGG + Intergenic
991294280 5:65064329-65064351 AGCAAGTGGAAAGATTGAGTAGG - Intergenic
991505573 5:67320382-67320404 AGAAGGTGGAAGAATAGAAGAGG + Intergenic
991544308 5:67764808-67764830 AGAACGTGTAGGGATAGAGATGG + Intergenic
992073020 5:73165986-73166008 ACAAGGTGGAAGGAGGGAGAAGG - Intergenic
992559281 5:77934216-77934238 AGGAGGCGTAAAGATAGAGTAGG - Intergenic
992713107 5:79481271-79481293 TTAAGGTGGAAGGATAGATCTGG - Intronic
992817626 5:80460927-80460949 AGAAGGAGTATGGATAAAGTAGG - Intronic
992966144 5:82002641-82002663 TGAAGGTGGAGGGAGAGAGGAGG + Intronic
993527063 5:88977831-88977853 AGAAGGTAGAGGGATATATTTGG + Intergenic
993541259 5:89155065-89155087 AGAAGCAGGAAGTATAGTGTAGG + Intergenic
993622586 5:90186275-90186297 AGGAGGAGGAAGGAAAGAGGAGG - Intergenic
994337007 5:98578793-98578815 AAAAGGGGGAAGGGTAGAGAGGG - Intergenic
994337559 5:98585961-98585983 AGGGGGTGGAAGGGTAGAGAGGG + Intergenic
994691367 5:103023863-103023885 AGAACGTTGAAGCAAAGAGTTGG + Intronic
994964833 5:106655492-106655514 AGTAGGTGAACAGATAGAGTTGG + Intergenic
995432532 5:112097428-112097450 AGAAGGTGGAGGGAGGGAGGAGG - Intergenic
995808299 5:116078809-116078831 GGAATGTCGAAGGATAGATTTGG + Intergenic
996362969 5:122670857-122670879 AGAGGGTGGAAGGTGAGAGGAGG - Intergenic
997051262 5:130383381-130383403 ACAAGGTGGAAGGTAGGAGTAGG + Intergenic
997585865 5:135042901-135042923 AGCTGGTGGAAGGAAAGGGTTGG + Intronic
997899154 5:137748169-137748191 AGAAGGTGGGAGGAGAAAGAGGG - Intergenic
998586959 5:143437627-143437649 AGCAATTGAAAGGATAGAGTTGG - Intergenic
998776058 5:145604230-145604252 GGAGGGTGGAAGGAGGGAGTAGG - Intronic
998889099 5:146727518-146727540 AGAAGGTGGGAAGGTAGAATGGG + Intronic
999385023 5:151147961-151147983 AGAAAGGGGATGGTTAGAGTTGG - Intronic
999895447 5:156027951-156027973 AGAAGGTGGAAGGACAAAAAAGG + Intronic
1001235405 5:170025257-170025279 AGCAGGTGGAAGGATGGATTTGG - Intronic
1001690923 5:173631720-173631742 AGAGGGAGGAAGGAGAGAGAAGG - Intergenic
1001977908 5:176015454-176015476 AGAGGGAGGAAGGATAGGGAAGG - Intronic
1002239512 5:177828308-177828330 AGAGGGAGGAAGGATAGGGAAGG + Intergenic
1002499243 5:179636608-179636630 AGAAGGGGGTGGGCTAGAGTAGG + Intergenic
1002502433 5:179655913-179655935 AGAAGGGGGTGGGCTAGAGTAGG - Intergenic
1002730658 5:181330136-181330158 AGAAGGTGGCAGGATCCATTGGG + Intergenic
1002753872 6:143968-143990 AGAAGGTGGCAGGATCCATTGGG - Intergenic
1002951435 6:1816122-1816144 TGAAGGTGGTGGGATAGGGTAGG + Intronic
1003221131 6:4161961-4161983 AGAAGGTGGAAGGGCAGAGAAGG - Intergenic
1003873423 6:10418578-10418600 GGAAGTTGGAAGGAGAGAGCTGG + Intronic
1005102070 6:22182084-22182106 AGAGGGTGGAAGGAGGGAGAAGG - Intergenic
1005206906 6:23415128-23415150 AGGAGGTGGAGGGCTAGATTTGG - Intergenic
1005769040 6:29046604-29046626 AGAAGGTGGGAGGAAACTGTTGG + Intergenic
1005841251 6:29745883-29745905 GGAAGGTGGGAGGATAGAGGAGG + Intergenic
1005890185 6:30131015-30131037 TGAAGATGGAAGGAAAGAGAAGG - Intergenic
1006048438 6:31319686-31319708 TGAAATTGGAAGGATAGAGAAGG - Intronic
1006059571 6:31410368-31410390 TGAGGGTGGGAGGATAGAGGAGG - Intronic
1006072060 6:31505439-31505461 TGAGGGTGGGAGGATAGAGGAGG - Intronic
1006276676 6:33009719-33009741 AGAAGGTGGAAGGATTCACTGGG + Intergenic
1006335972 6:33420598-33420620 GGAAGGTAGAAGGATTGGGTTGG + Intronic
1007224129 6:40301068-40301090 AGAAGGTGGAAGCATGGTGGAGG + Intergenic
1007537194 6:42602503-42602525 AGAAGGTGGAATAAAAGAATGGG - Intronic
1007593774 6:43039017-43039039 AGCAGGTGAAAGGAGGGAGTTGG + Intronic
1008605708 6:53137337-53137359 AGAAGGTGGGTGGAGAGAGCAGG - Intronic
1008626416 6:53321028-53321050 AGTGGGTGGAAGGATTCAGTTGG - Intronic
1008696316 6:54042378-54042400 AAAAGGTGGAGGGAGAGAGAAGG - Intronic
1009367627 6:62868153-62868175 AAAAGGTGAAAGGATATCGTAGG - Intergenic
1010670825 6:78683763-78683785 AGAAGTAGGAAGCCTAGAGTCGG + Intergenic
1011154305 6:84312859-84312881 AAAAGATGGAAGGAGAGAGACGG + Intergenic
1011614284 6:89183867-89183889 AGAAGGTGGGAGGAGAGTGAGGG + Intronic
1012257111 6:97047020-97047042 AGAAATTGGAAGTATAGAGTGGG + Intronic
1012360291 6:98369130-98369152 AGGAGCTGGAAGGATAGAAATGG + Intergenic
1012402460 6:98853523-98853545 AGAAGGTGCATGTATGGAGTGGG + Intergenic
1013990655 6:116251293-116251315 AGAAGCTGGAAAGAGAGAGAAGG - Exonic
1014647106 6:123987770-123987792 AGAAGGGGGAGGGGGAGAGTGGG - Intronic
1014953911 6:127593229-127593251 AGAAGGGGGAATGATACAGATGG - Intergenic
1014982403 6:127960005-127960027 AGAAGGTGGAGGCATAGATTAGG + Intergenic
1015104834 6:129523581-129523603 ATCATCTGGAAGGATAGAGTAGG + Intergenic
1015247637 6:131092458-131092480 AAAAGATGGAAGGATAGATAGGG + Intergenic
1015444318 6:133285847-133285869 AGAAATGGGAAGGATGGAGTTGG + Intronic
1015977030 6:138800979-138801001 AGAAGGTGGAAGGGTAAATGAGG + Intronic
1016058625 6:139604826-139604848 AGATGTTGGTAGGGTAGAGTAGG + Intergenic
1016291365 6:142531735-142531757 AGAAAGTGGATGGCTAGAGATGG - Intergenic
1016578500 6:145600395-145600417 AGGGGGTGGAAGGACAGACTGGG - Intronic
1016699926 6:147042801-147042823 AGCAGCTGGAAGGAAAGGGTAGG + Intergenic
1017587446 6:155942799-155942821 AGGAGGAGGAAGGAAAGAGGAGG + Intergenic
1018063943 6:160112642-160112664 CAAAGGTGGGAGGATAGTGTAGG - Intronic
1018528823 6:164742100-164742122 AGAAGATGGGAGGATTGAGAAGG - Intergenic
1018549054 6:164973044-164973066 AGTAGGTAGAAGATTAGAGTTGG + Intergenic
1019327624 7:446072-446094 AGAAGGAGGGAGGAGGGAGTGGG + Intergenic
1020264151 7:6549258-6549280 GGAAAGAGGGAGGATAGAGTCGG - Intronic
1020624096 7:10557405-10557427 GGATTGGGGAAGGATAGAGTTGG - Intergenic
1021035516 7:15793793-15793815 AGAAGGTAGAAGGGTAGCATAGG + Intergenic
1022222181 7:28324222-28324244 AGAAGCTAGAAGGATAAAATGGG - Intronic
1022280435 7:28903322-28903344 AGAAGATGGAAAAAAAGAGTGGG + Intergenic
1022291226 7:29005587-29005609 AGAGGGTGGAGGGAAAGAATGGG - Intronic
1023464549 7:40439693-40439715 AGAAGGTAGAAGCATCCAGTGGG + Intronic
1023624403 7:42101817-42101839 AGAGGGTGGAGGGATAGCATTGG - Intronic
1023740132 7:43273168-43273190 AGAAGGGGGATGGAGGGAGTGGG + Intronic
1024075802 7:45817309-45817331 AGAAGGTGGCAGGATCCATTGGG + Intergenic
1024647796 7:51383998-51384020 AGAAGGTGGCAGGATCCATTGGG - Intergenic
1025051636 7:55738485-55738507 AGAAGGTGGCAGGATCCATTGGG - Intergenic
1025128599 7:56364152-56364174 AGAAGGTGGCAGGATCCATTGGG - Intergenic
1025176979 7:56807035-56807057 AGAAGGTGGAAGGATCCATTGGG - Intergenic
1025285989 7:57661294-57661316 AGAAAGTGGAAAGATAGGCTGGG - Intergenic
1025557101 7:62322662-62322684 AGAGGGTGGAGGGATAGCATTGG + Intergenic
1025565535 7:62429736-62429758 AGAAGGTGGAGTGATAGCATTGG - Intergenic
1025694813 7:63769351-63769373 AGAAGGTGGAAGGATCCATTGGG + Intergenic
1025887760 7:65614464-65614486 AGGAGGAGGAAGGATGGAGGAGG - Intergenic
1026127697 7:67594106-67594128 AGAAGGAGGCAGGAAAGAGGGGG - Intergenic
1027640018 7:80721727-80721749 AAAAGGTAGAAGGAAATAGTTGG - Intergenic
1028715904 7:93967999-93968021 AGAAAATGGAAGGATAAAATGGG - Intronic
1029062964 7:97817507-97817529 AGGAGGTGGAAGTAAAGGGTGGG + Intergenic
1030675067 7:112375835-112375857 GGTGGGTGGAAGGATAGAGAGGG - Intergenic
1030759921 7:113337675-113337697 GGGAGGTGGAAGGAGAGAGGAGG + Intergenic
1030783090 7:113625770-113625792 AGAAGGGGGAAGGAGAGGGGAGG - Intergenic
1030956077 7:115854550-115854572 AGAAGAGGGAAGGATGAAGTAGG + Intergenic
1031339420 7:120580420-120580442 AGAAGGTGGAAGGGAAGATGGGG - Intronic
1031426350 7:121610184-121610206 AGAAGGAGTAAGGTTAGAGCAGG - Intergenic
1031478036 7:122246764-122246786 ACAAGGTGGCAGGAGAGAGAGGG - Intergenic
1031491672 7:122397389-122397411 AGAAAGGGGAAGGAGGGAGTGGG + Intronic
1031995780 7:128229920-128229942 GGAAGGAGGAAGGAGAGAGGAGG + Intergenic
1032052334 7:128657056-128657078 AGAAGGTGGCAGGATCCATTGGG + Intergenic
1032089978 7:128906648-128906670 GGAAGGAGGAAGGAAAGACTGGG + Intronic
1033554252 7:142474612-142474634 AGGAGGTGCAAGGAGAGAGAAGG - Intergenic
1033556519 7:142492717-142492739 AGGAGGTGCAAGGAGAGAGAAGG - Intergenic
1033793485 7:144819963-144819985 AGAAGTTGGATGGATAGATATGG - Intronic
1034428488 7:151027906-151027928 ATTAGGTGGAAGGAGAGACTTGG - Intergenic
1034678351 7:152909065-152909087 AGAAGGTGGGAGGCAAGAGGAGG - Intergenic
1034858562 7:154576986-154577008 AGGCAGTGGAAGGGTAGAGTGGG + Intronic
1036497623 8:9283829-9283851 AGAAGCTGGAAGGAAGGAGGGGG - Intergenic
1036576807 8:10035162-10035184 AGAAGGGGGAAGGGTAGAAGTGG + Intergenic
1036900219 8:12664802-12664824 AGGAGGTGGAAGGAGTGAGAGGG + Intergenic
1036984738 8:13515955-13515977 AGAATGTGGAAGGAAAGAAGAGG + Intergenic
1036990790 8:13591434-13591456 ACAAGGTGGCAGGAGAGAGAAGG - Intergenic
1037700422 8:21268949-21268971 TGTAGGTAGAAGGATATAGTTGG - Intergenic
1038057002 8:23869019-23869041 AGAAGGTGGAGGGTTGGAGGAGG + Intergenic
1038609740 8:29049357-29049379 AGAAGGTAGAAGAAGAGAGGAGG + Intronic
1039489023 8:37933792-37933814 AGAAGCTGGAAGGATATCCTAGG - Intergenic
1039663644 8:39495629-39495651 AGAAGGGGAAAGGAAAGACTGGG + Intergenic
1040027553 8:42795735-42795757 ATAAGGTGGAACGAGAGACTTGG + Intronic
1040101181 8:43507355-43507377 AGAACGGGGAGGGACAGAGTAGG + Intergenic
1040284888 8:46094613-46094635 AGAAGTGGCAAGGATTGAGTGGG + Intergenic
1041432054 8:57793398-57793420 AGAATGTGGAGGGAAAGTGTTGG + Intergenic
1041625211 8:60017679-60017701 AGAAGGTGGATGGATATGGATGG + Intergenic
1042360436 8:67876869-67876891 AGAAGGAGGAAGGATGGAGGAGG + Intergenic
1042544200 8:69936161-69936183 AGAATTTGGAAGGTCAGAGTGGG - Intergenic
1043214173 8:77564581-77564603 AGAAGGTGGAAGGAGGGAGAAGG + Intergenic
1043705403 8:83342451-83342473 AGAGGGGGGAAGGATAGCATTGG + Intergenic
1043864766 8:85362208-85362230 AGAAGGAGGAAGAAAAGAGGAGG - Intronic
1044194359 8:89356469-89356491 AGTGGGTGGTAGGATAAAGTGGG + Intergenic
1044299991 8:90572772-90572794 GGAAGGTAGAAAGATAGAGAAGG + Intergenic
1045133255 8:99182327-99182349 TGAAGGAGGAAGGATTGATTGGG + Intronic
1045736591 8:105303049-105303071 AGAAGGTGGAGGGATGGAGGAGG + Intronic
1046195352 8:110856716-110856738 AGAGGGTGGAAGGAGAGTGAGGG + Intergenic
1046630701 8:116620099-116620121 AAGAGGTGGAAGTATGGAGTGGG + Intergenic
1046931940 8:119850130-119850152 AAAAGATGGAAGGATAGAAAGGG + Intronic
1047254823 8:123207102-123207124 AGAAGGGGGAAGGATGGGGAGGG - Intronic
1047317527 8:123748151-123748173 GGAAGGTGGGAGGAGAGAGGAGG + Intergenic
1047693690 8:127382428-127382450 AGAAGGGGGAAGAAGAGAGGAGG + Intergenic
1048250968 8:132866615-132866637 AGAAGGAGAAAGGGTAGGGTGGG + Intergenic
1048447318 8:134501353-134501375 AGAGGCTGCAAGGATGGAGTGGG + Intronic
1048721341 8:137328743-137328765 AGGGGGTGGAAGAAGAGAGTAGG - Intergenic
1048728794 8:137414387-137414409 AGTAGGTGGAATGAGAGACTTGG + Intergenic
1048781067 8:138001673-138001695 AGAAGGTGTAGGGATGGAGAAGG + Intergenic
1049096272 8:140550132-140550154 AGGAGGTGGAAGCCTAGAGAGGG - Intronic
1049433714 8:142576755-142576777 AAAGGGTGGAAGGAAAGGGTCGG + Intergenic
1049760385 8:144329492-144329514 AGTGGGTGGAAGGATGGAGGTGG - Intergenic
1049783692 8:144440481-144440503 AGCAGGAGGAAGGACAGGGTCGG + Intronic
1050015598 9:1229749-1229771 GGATGGGGGAGGGATAGAGTTGG + Intergenic
1050106735 9:2173684-2173706 AGGAGTAGGAAGGCTAGAGTTGG - Intronic
1050373556 9:4947454-4947476 AGAAACTGGAAGGCTAGGGTGGG - Intergenic
1050697443 9:8294600-8294622 AGGAGGAAGAAGGAGAGAGTAGG - Intergenic
1051848911 9:21486310-21486332 AGGAGGTGGTAGGACAGATTTGG - Intergenic
1052350403 9:27452860-27452882 AGAAGCTGGAGGTATAGAGAGGG + Intronic
1052680774 9:31689388-31689410 TAAAAGTGGAAGGAAAGAGTTGG + Intergenic
1052688427 9:31782534-31782556 AGAAGGTGGAGGGATGGAAGAGG + Intergenic
1052876446 9:33570293-33570315 AGAATGGGGAGGGACAGAGTGGG + Intronic
1053499561 9:38574051-38574073 AGAATGGGGAGGGACAGAGTGGG - Intronic
1054763440 9:69023372-69023394 AGTGGGTGGAAGAACAGAGTGGG + Intergenic
1055246343 9:74248524-74248546 AGAGGGTGGAAGGTTGGAGGAGG + Intergenic
1055897715 9:81198539-81198561 AGAAGGAGGAAGGGGAGAGAAGG + Intergenic
1056587160 9:87936178-87936200 AGAACGGGGAGGGACAGAGTGGG - Intergenic
1057031319 9:91777697-91777719 TGAAGGAGACAGGATAGAGTTGG - Intronic
1057949617 9:99359384-99359406 AGAAGGTGGCAAGACAGAGCAGG - Intergenic
1058947567 9:109873046-109873068 AGAAAGAGGAAGGAAAGAGTGGG + Intronic
1059078767 9:111224366-111224388 AGATGGGGGAGGGATAGAATTGG + Intergenic
1059529921 9:115026541-115026563 TGAAGGTGGAGGGGTACAGTGGG - Exonic
1059542475 9:115144241-115144263 AGAAGGTGGAAGGGAAGGGAAGG - Intronic
1059648510 9:116292155-116292177 AGAAGATGGAGGGATAAAGCAGG + Intronic
1059976031 9:119718189-119718211 AGAAAGTGAAGGGAGAGAGTGGG + Intergenic
1060356086 9:122908606-122908628 GGAAGGGGGAAGGATGGAGATGG - Exonic
1060896596 9:127222410-127222432 CAAAGGTGGAATGAGAGAGTAGG + Exonic
1060969342 9:127729442-127729464 TGAAGGTGCCAGGTTAGAGTGGG - Intronic
1062352937 9:136148047-136148069 AGCAGGTGGAGGGATGGAGCTGG + Intergenic
1062755067 9:138282646-138282668 AGAAGGTGGCAGGATCCATTGGG + Intergenic
1203372168 Un_KI270442v1:317866-317888 AGAAGGAGAAAAGTTAGAGTAGG + Intergenic
1203707285 Un_KI270742v1:63986-64008 AGAATGGGGAGGGACAGAGTGGG + Intergenic
1203548112 Un_KI270743v1:144584-144606 AGAACGGGGAGGGACAGAGTGGG - Intergenic
1203578975 Un_KI270745v1:26815-26837 AGAAGGTGGCAGGATCCATTGGG + Intergenic
1185877286 X:3711944-3711966 TGAATTTGGAAGGACAGAGTGGG - Intronic
1186118643 X:6333444-6333466 AGAAGGTGGAGGGAAGGAGGAGG - Intergenic
1186459950 X:9740044-9740066 AGAAAGTGGGAGGAGAGGGTGGG + Intronic
1186488716 X:9954243-9954265 AGAAGGAGGAAGAAAAGAGAAGG + Intergenic
1186509420 X:10119303-10119325 AGAAGGTGGTGGGAGAGAGGAGG - Intronic
1186826957 X:13350025-13350047 GGAAGGAGGAAGGAGAGAGAAGG - Intergenic
1187429578 X:19209877-19209899 AGATGGTGGAAGGGGAGAATTGG + Intergenic
1187505399 X:19874788-19874810 AGAGGGTGGAAGGGGAGAGGGGG + Intronic
1187985566 X:24807092-24807114 AGTTGGTGGCAGGATGGAGTAGG + Intronic
1188842467 X:35033160-35033182 AGAAACTGGAAGGATGGAATTGG + Intergenic
1189302226 X:39960346-39960368 TGAAGGTGGAAGGGTGGTGTGGG - Intergenic
1190039941 X:47062888-47062910 ACAAGGTGGAAAGATGGAATTGG + Intergenic
1190311855 X:49122554-49122576 AGAAGGTGGAAGGATAGAGTGGG - Intronic
1191156643 X:57281711-57281733 TGAAGGTGGAGGGAGAGAGGAGG - Intergenic
1191178857 X:57537847-57537869 AGAAGCTGTAACAATAGAGTGGG - Intergenic
1191670579 X:63745028-63745050 AGAGGGAGGAGGGAGAGAGTGGG + Intronic
1191989940 X:67024309-67024331 AGAGGGTGGAAGGTGAGAGGAGG - Intergenic
1192071978 X:67950467-67950489 AGCAGGAGGAAGGAGAGAGGAGG + Intergenic
1192395513 X:70776946-70776968 AGAATGTGTAATGATAAAGTCGG - Intronic
1192725321 X:73745009-73745031 GGAAGGTGGGAGGCTAGAGGAGG - Intergenic
1192909921 X:75592363-75592385 GGAAGGGGGAAGGATAGCATTGG + Intergenic
1193746930 X:85293516-85293538 AGAAGGTGGAAGGTGGGAGGAGG + Intronic
1193843330 X:86437220-86437242 AGAAGGTGTAATGATCAAGTTGG + Intronic
1194293764 X:92104681-92104703 GGAAGGTGGAAGCATAGTGAAGG + Intronic
1194507682 X:94752728-94752750 GGAAGGGGGAAGGATTGTGTAGG + Intergenic
1194511876 X:94806691-94806713 AGAAGGTGGGAGAAGAGAGAGGG - Intergenic
1194559410 X:95402601-95402623 AGAAGGTGGAAGGTTGGAGGAGG + Intergenic
1194942443 X:100027254-100027276 AGAAGGAAGAAGGAGAGAGAGGG + Intergenic
1195522079 X:105842759-105842781 AGCAGGTGGATGGAAACAGTAGG + Intronic
1196131392 X:112160722-112160744 AGAAGGTGGAGGGAGAAAGAAGG + Intergenic
1197382067 X:125757291-125757313 AGAAAGCAGAAGGATAGGGTAGG - Intergenic
1197730262 X:129803807-129803829 AGAAGGAGGAAGGGGAGAGTTGG + Exonic
1197958356 X:131977321-131977343 AGAAGGGGAAAAGATAGAATGGG + Intergenic
1198507287 X:137313247-137313269 AGAAGTTGTAAGGATAAATTAGG - Intergenic
1198726161 X:139679363-139679385 AGAGGATGGAAGGAAAGAATAGG + Intronic
1198854660 X:141003282-141003304 AGAAGGTTGAAGCACAGAGTAGG - Intronic
1198877358 X:141241865-141241887 AGAAGGTTGAAGCACAGAGTAGG + Intronic
1198908041 X:141584086-141584108 AGAAGGTTGAAGCACAGAGTAGG + Intronic
1198908750 X:141590338-141590360 AGAAGGTTGAAGCACAGAGTAGG - Intronic
1198918320 X:141697813-141697835 AGAAGGTTGAAGCACAGAGTAGG + Intronic
1199078098 X:143546966-143546988 AGAAGGGGGAAGGTCAGAGGAGG + Intergenic
1199279879 X:145988973-145988995 AGAAGGCGGAAAGAAAGAGAGGG + Intergenic
1199852501 X:151735774-151735796 AAAAAGAGGAAAGATAGAGTGGG - Intergenic
1199982818 X:152930156-152930178 AGAAGGTGGAAGGTGGGAGTAGG - Intronic
1201065573 Y:10091925-10091947 AGAAGGGGGGAGGAGAGAGAGGG + Intergenic
1201474377 Y:14364665-14364687 AGAAGGAGGAGGAATAGAATGGG + Intergenic
1202381599 Y:24279433-24279455 AGAAGGTGGAAGGATCCATTGGG + Intergenic
1202489186 Y:25390693-25390715 AGAAGGTGGAAGGATCCATTGGG - Intergenic