ID: 1190311856

View in Genome Browser
Species Human (GRCh38)
Location X:49122555-49122577
Sequence AAGAAGGTGGAAGGATAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1088
Summary {0: 1, 1: 0, 2: 8, 3: 76, 4: 1003}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190311856_1190311869 11 Left 1190311856 X:49122555-49122577 CCACTCTATCCTTCCACCTTCTT 0: 1
1: 0
2: 8
3: 76
4: 1003
Right 1190311869 X:49122589-49122611 TTCAATGGGGAAGGGTAAAGGGG 0: 1
1: 0
2: 1
3: 17
4: 251
1190311856_1190311862 -2 Left 1190311856 X:49122555-49122577 CCACTCTATCCTTCCACCTTCTT 0: 1
1: 0
2: 8
3: 76
4: 1003
Right 1190311862 X:49122576-49122598 TTCCTCTTCTTCCTTCAATGGGG 0: 1
1: 0
2: 2
3: 53
4: 421
1190311856_1190311864 2 Left 1190311856 X:49122555-49122577 CCACTCTATCCTTCCACCTTCTT 0: 1
1: 0
2: 8
3: 76
4: 1003
Right 1190311864 X:49122580-49122602 TCTTCTTCCTTCAATGGGGAAGG 0: 1
1: 0
2: 0
3: 29
4: 224
1190311856_1190311868 10 Left 1190311856 X:49122555-49122577 CCACTCTATCCTTCCACCTTCTT 0: 1
1: 0
2: 8
3: 76
4: 1003
Right 1190311868 X:49122588-49122610 CTTCAATGGGGAAGGGTAAAGGG 0: 1
1: 0
2: 2
3: 23
4: 255
1190311856_1190311861 -3 Left 1190311856 X:49122555-49122577 CCACTCTATCCTTCCACCTTCTT 0: 1
1: 0
2: 8
3: 76
4: 1003
Right 1190311861 X:49122575-49122597 CTTCCTCTTCTTCCTTCAATGGG 0: 1
1: 0
2: 1
3: 64
4: 460
1190311856_1190311865 3 Left 1190311856 X:49122555-49122577 CCACTCTATCCTTCCACCTTCTT 0: 1
1: 0
2: 8
3: 76
4: 1003
Right 1190311865 X:49122581-49122603 CTTCTTCCTTCAATGGGGAAGGG 0: 1
1: 0
2: 1
3: 17
4: 249
1190311856_1190311860 -4 Left 1190311856 X:49122555-49122577 CCACTCTATCCTTCCACCTTCTT 0: 1
1: 0
2: 8
3: 76
4: 1003
Right 1190311860 X:49122574-49122596 TCTTCCTCTTCTTCCTTCAATGG 0: 1
1: 0
2: 8
3: 93
4: 677
1190311856_1190311867 9 Left 1190311856 X:49122555-49122577 CCACTCTATCCTTCCACCTTCTT 0: 1
1: 0
2: 8
3: 76
4: 1003
Right 1190311867 X:49122587-49122609 CCTTCAATGGGGAAGGGTAAAGG 0: 1
1: 0
2: 0
3: 12
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190311856 Original CRISPR AAGAAGGTGGAAGGATAGAG TGG (reversed) Intronic
900730693 1:4257342-4257364 CAGAAGTTGGATGGATAGACAGG + Intergenic
900849605 1:5131735-5131757 AAGGAGAGGGAAGGAGAGAGAGG - Intergenic
901178390 1:7321792-7321814 AGGAAGGAGGGAGGATAAAGGGG - Intronic
901677254 1:10892831-10892853 AAGAAGAAGGAAGGAAAGGGAGG - Intergenic
901833250 1:11906915-11906937 GAGAAGACGGAAGGAAAGAGGGG + Intergenic
902083680 1:13839466-13839488 TAGAAGGTGGTAGGAGGGAGAGG - Intergenic
902110046 1:14070912-14070934 CAGAGAGTGGAAGGACAGAGAGG + Intergenic
902260666 1:15222636-15222658 AAAAAGGAAGAAGGATAGAAAGG + Intergenic
902525023 1:17051467-17051489 AAGAAGGTGGGGAAATAGAGAGG + Intronic
903034646 1:20485985-20486007 GAGACGGTGGAAGGAGACAGAGG + Exonic
904521752 1:31101263-31101285 AAGAAGGGGGTGGGGTAGAGAGG + Intergenic
904603597 1:31686798-31686820 AAGAATGGGGGAGGGTAGAGAGG + Intronic
904812737 1:33174114-33174136 AAGAAGGGGGAAGAAGAAAGGGG - Intronic
905128249 1:35731314-35731336 AAGAAGGAGGATGGATGTAGGGG + Intronic
905262844 1:36731491-36731513 CAGAGGGTGGGAGGAGAGAGAGG + Intergenic
905855097 1:41305828-41305850 AAGAAGGAGGTAAGATAGAAAGG - Intergenic
906791372 1:48661223-48661245 AAGCAGGTGGCAGGAGGGAGTGG + Intronic
907593411 1:55697552-55697574 AACAAGGTGCAAGAATAGAAGGG - Intergenic
907594370 1:55705877-55705899 GAAAAGGAGGAAGGATAGAGAGG - Intergenic
908080567 1:60573675-60573697 AAGAAAATGGAAGGATGAAGAGG - Intergenic
908121215 1:60987969-60987991 AAGGCGAAGGAAGGATAGAGTGG - Intronic
908206517 1:61855820-61855842 AAGAAGCTGGAATTATACAGAGG + Intronic
908302303 1:62774075-62774097 AAGGAGAGGGAAGAATAGAGTGG - Intergenic
909089567 1:71208500-71208522 AAGAAGCTGTTAGAATAGAGTGG + Intergenic
909162551 1:72172090-72172112 CAGTAGGTGGAAGGATGGAGAGG + Intronic
909490724 1:76223405-76223427 TGGAAGGTGGGAGGAGAGAGAGG + Intronic
909656407 1:78038397-78038419 AAGGAGGTGGGGTGATAGAGGGG - Intronic
910308351 1:85793472-85793494 AAGAGGAGGGAAGGAAAGAGAGG + Intronic
910948394 1:92618017-92618039 AAGCAGCTGGATGGATAGAATGG + Intronic
910983083 1:92977936-92977958 AAGAAGGAGCAAGAATAGGGAGG - Intergenic
911001877 1:93174627-93174649 GGGAGGGTGGAAGGACAGAGAGG - Intronic
911296770 1:96127270-96127292 GAGATGGTGGAAGGGTAGAGTGG - Intergenic
911781521 1:101885509-101885531 AAGGAGATGGAAGGAGAGAAAGG - Intronic
912124027 1:106510733-106510755 GAGAGGGAGGAAGAATAGAGAGG + Intergenic
912227748 1:107754731-107754753 AAGAAGCTGAAAGGTAAGAGTGG - Intronic
912600658 1:110929862-110929884 GAGAAGGTAGGAGGAAAGAGAGG + Intergenic
912963635 1:114217886-114217908 AAGCTGATGGAAGGACAGAGTGG + Intergenic
912999111 1:114562141-114562163 TAGAAGGTGGAAGGTTAGAGAGG - Intergenic
913099424 1:115549636-115549658 ATGAAGGAGGAAGACTAGAGGGG - Intergenic
914918707 1:151833468-151833490 AAAAAGGAGAAAAGATAGAGAGG - Intergenic
915147701 1:153805084-153805106 GTGAAGGTGAAAGGATAGATTGG - Exonic
915240681 1:154519471-154519493 AGGAAGGAGGAAGTATTGAGGGG + Intronic
915525526 1:156473789-156473811 AAGAGGGAAGAAGGTTAGAGAGG - Intronic
915593885 1:156885594-156885616 GAGGAGGAGGAAGGATAGGGAGG - Intergenic
915868627 1:159533495-159533517 AAGAGGGTGTAAGGATATTGTGG + Intergenic
916082175 1:161240946-161240968 AAGATAGTGGAAGGATGTAGGGG + Intergenic
916151361 1:161794922-161794944 AAGGAGGCTGAACGATAGAGAGG + Intronic
916453162 1:164940793-164940815 AAGAAGGAGGAAAGGCAGAGGGG - Intergenic
916507243 1:165439342-165439364 AGGAAGGGGGAGGGAGAGAGTGG - Intronic
916662377 1:166934628-166934650 AAGAAGGTAGAAGGATACGACGG - Intronic
916778805 1:168000116-168000138 AAGAAATTGGAAGGCTCGAGAGG + Intronic
917033972 1:170726177-170726199 AAGAAGGCATAAGGAAAGAGAGG - Intronic
917223811 1:172760484-172760506 AAGAAGGAGGATGGAGAGAAAGG + Intergenic
918389515 1:184043691-184043713 TGGAAGGTGGGAGGAGAGAGAGG + Intergenic
918407370 1:184224174-184224196 CAGAAGGTGGGTGGAGAGAGAGG - Intergenic
918420628 1:184361118-184361140 TGGAAGGTGGAAGGAGGGAGAGG - Intergenic
918442717 1:184584077-184584099 AAGGAGGGGGAAGGAGAAAGTGG - Intronic
918486247 1:185031593-185031615 GATAAGGTGGGAGGATTGAGGGG + Intergenic
918552559 1:185760226-185760248 TAGAAGGTGTAAGAATTGAGTGG + Intronic
918567992 1:185953562-185953584 AAAGAGGTTGAAGGATAGGGAGG + Intronic
918639115 1:186817140-186817162 AAGAAGATGAAAGGAAAGAGAGG - Intergenic
918900475 1:190410006-190410028 AAGAAGAGGGAAGGAGAAAGAGG - Intronic
919204820 1:194408268-194408290 AAGAAGATGAAAGGTTTGAGGGG - Intergenic
919230664 1:194769117-194769139 AAGAAGGGGGAAAGAGGGAGAGG + Intergenic
919372157 1:196741366-196741388 CACAAGGTGGCAGGAGAGAGAGG + Intronic
919520873 1:198584835-198584857 TGGAAGGTGGAAGGAGGGAGAGG - Intergenic
920030519 1:203034832-203034854 TAGAAGGAGGAAGAAGAGAGAGG - Intronic
920140929 1:203812261-203812283 TAGAAGGTGGGAGGAGGGAGAGG - Intronic
920303645 1:205005007-205005029 AGGATGGTGGAAGCTTAGAGTGG + Intronic
920701961 1:208224702-208224724 AGGAAGGTGAGAGGAGAGAGGGG + Intronic
920716385 1:208344132-208344154 AAGAAGAGGGTAGGATAAAGTGG + Intergenic
920852995 1:209641487-209641509 AAGAAGGGAGAAAGAGAGAGAGG - Intronic
920880689 1:209877635-209877657 AAGAATGTGGAAACACAGAGTGG - Intergenic
921006733 1:211101046-211101068 CAGAAACTGGAAGGATAGAGGGG - Intronic
921179165 1:212618137-212618159 AAGAAGATGAAAGGAAAAAGAGG + Exonic
921335359 1:214080164-214080186 TAGAGGGTGGCAGGATGGAGAGG - Intergenic
921364512 1:214361016-214361038 ATCATGGTGGAAGGATAAAGGGG - Intronic
922163534 1:223096315-223096337 TAGAAGGTGGGAGGAAGGAGAGG - Intergenic
922191540 1:223323183-223323205 AGGAAGGAGGAAGGAAGGAGGGG + Intronic
922381418 1:225032217-225032239 AGGAAGGTAGAAGGAGGGAGAGG - Intronic
922434134 1:225586275-225586297 AAGGAGGGGGAAGAAAAGAGGGG + Intronic
922727915 1:227933267-227933289 AAAAAGGTGGAAGCAAACAGAGG - Intronic
923140256 1:231155883-231155905 AAGAGGGTGGAAGGGTGGGGGGG + Intergenic
923220209 1:231886025-231886047 CAGAAGGTGGAAAGGCAGAGAGG + Intronic
923374564 1:233347727-233347749 GAGAAGGTGGAGGGAAGGAGCGG + Intronic
923441008 1:234020497-234020519 AAAAAGGGGGAGGGACAGAGAGG - Intronic
923446290 1:234074512-234074534 AAGTAGGTGGAAAGATGAAGTGG + Intronic
923469330 1:234276934-234276956 AAGCAGGTGGAGGGCAAGAGGGG + Intronic
923837067 1:237623715-237623737 AAGAAGGAGGAAGAAAAGAAAGG - Intronic
924948392 1:248861325-248861347 AAAAAGGTGGGAGGACAAAGTGG - Intergenic
1062942652 10:1435613-1435635 CAGGAAGTGGAAGGAGAGAGAGG - Intronic
1062943757 10:1444574-1444596 AAGATGGTGAATAGATAGAGTGG - Intronic
1062989940 10:1805960-1805982 ATGAAGGAGGAAGAATTGAGTGG - Intergenic
1063493954 10:6489760-6489782 ATGTAGGTGGTAGGAGAGAGCGG + Intronic
1063699208 10:8368396-8368418 TGGAAGGTGGGAGGAGAGAGAGG + Intergenic
1064086760 10:12350980-12351002 AAAAAGGAGGAAGGAAAGAAAGG - Intronic
1064371249 10:14753415-14753437 ATGAAGGTGTTGGGATAGAGAGG - Intronic
1064467726 10:15601254-15601276 AAGAAAATGGAAGGGAAGAGGGG + Intronic
1065072136 10:22036061-22036083 AAGCAGCTGGATTGATAGAGTGG + Intergenic
1065181570 10:23131352-23131374 CAGAGGGTGGAAGGAGGGAGAGG + Intergenic
1065251911 10:23823908-23823930 AAGAGGGAGGAAGAAGAGAGGGG + Intronic
1065598709 10:27346248-27346270 TGGAAGGTGGAAGGAGAGAGAGG - Intergenic
1065710574 10:28513204-28513226 GATATGGTGGAAGGAAAGAGGGG - Intergenic
1065937077 10:30530115-30530137 TGGAAGGTGGAAGGAGGGAGAGG - Intergenic
1066045547 10:31592307-31592329 CAGAAGGAGGAAAGAAAGAGAGG - Intergenic
1066198994 10:33128006-33128028 AAGAAGGGGGAAGGAAAGAAGGG - Intergenic
1067394787 10:45905023-45905045 AATGAGGTGGAAGTTTAGAGAGG - Intergenic
1067783620 10:49227017-49227039 GAGCAGGTGGAAGGAGAGTGGGG + Intergenic
1067803578 10:49377254-49377276 AGGTAGGTGGAAGGATCCAGAGG + Intronic
1067807866 10:49405749-49405771 GAAAAGGAGGAAGGAGAGAGAGG - Intergenic
1067826099 10:49574130-49574152 AAGAGGGTGAATGGACAGAGCGG + Intergenic
1067854431 10:49780100-49780122 AAGAAGGGAGAAGGAGAGAAGGG - Intergenic
1067863110 10:49874154-49874176 AATGAGGTGGAAGTTTAGAGAGG - Intronic
1067923823 10:50487162-50487184 TAGAGGGTGGAAGGAGGGAGAGG + Intronic
1068356242 10:55912973-55912995 CAGAAGATGGAAAGTTAGAGAGG + Intergenic
1068382933 10:56282349-56282371 CAGAGGGTGGAAGGACGGAGAGG - Intergenic
1068584659 10:58783368-58783390 AAGAGGGAGGAAGGAAAGAAGGG - Intronic
1069397615 10:68007067-68007089 GAGGAGGTAGAAGGAGAGAGAGG - Intronic
1070081968 10:73197799-73197821 AAGATGGTGGCAGCATACAGGGG + Intronic
1070144171 10:73761675-73761697 AAGGAGGGGGAAGGAAGGAGAGG - Intronic
1070593808 10:77818684-77818706 AAGAGGGTGGCAAGTTAGAGTGG - Intronic
1070602313 10:77874312-77874334 AAGTATGTGGAAGCACAGAGAGG - Intronic
1071392455 10:85189600-85189622 AAGAAAGGGAAAGGAGAGAGAGG + Intergenic
1071408802 10:85366139-85366161 TGGAAGGTGGAAGGAGGGAGAGG - Intergenic
1071468462 10:85961760-85961782 AAGAAGGAAGAAGGGAAGAGAGG - Intronic
1071695030 10:87862325-87862347 AAGGAGGTGGAAGGATACACGGG - Exonic
1071851752 10:89579716-89579738 AACAGGGTGATAGGATAGAGAGG - Exonic
1072479752 10:95799281-95799303 TGGAAGGTGGGAGGAGAGAGAGG - Intronic
1072654592 10:97320976-97320998 ATGGTGGTGGAAGGGTAGAGAGG + Exonic
1073166990 10:101463690-101463712 AAGAAAATGGAGGGTTAGAGAGG + Intronic
1073569216 10:104562175-104562197 AAAAAGGGGGAAGGAAGGAGGGG - Intergenic
1073681042 10:105703600-105703622 AGGAAGGAGGAAGGAAAGAAAGG + Intergenic
1073729112 10:106269515-106269537 AAAAAGATGGAAGGAAAAAGGGG + Intergenic
1073904488 10:108262102-108262124 TGGAGGGTGGGAGGATAGAGAGG - Intergenic
1073989883 10:109250814-109250836 CAGAGGGTGGAAGGAGGGAGAGG - Intergenic
1074018769 10:109563040-109563062 AAAGAGGTTGAGGGATAGAGAGG - Intergenic
1074568158 10:114600399-114600421 AAGAAGGTGGAAGGAGTGGAGGG - Intronic
1075017103 10:118917934-118917956 AAGAAGGAGGGAGGGAAGAGAGG + Intergenic
1075257091 10:120933965-120933987 GAGAAACTGGAAGGGTAGAGTGG - Intergenic
1075284694 10:121173107-121173129 CAAAAGGTGGAAGGAGGGAGGGG + Intergenic
1075365366 10:121883455-121883477 AAGAAAGAGAAAGGATAAAGGGG + Intronic
1075962966 10:126585238-126585260 AAGAAGGAAGAAAGAGAGAGAGG + Intronic
1076034456 10:127187448-127187470 AAGAAGGCGAAAGCATACAGGGG - Intronic
1076934057 10:133555741-133555763 AAGAGGGTGGGAGGAGGGAGTGG - Intronic
1077159452 11:1106098-1106120 AGGTAGGTGGAAGGATGGAGGGG - Intergenic
1077356591 11:2121660-2121682 AGGAGGCTGGAAGGAGAGAGGGG + Intergenic
1077878906 11:6332042-6332064 AGGAGGGTGGAAGGATCTAGAGG - Intergenic
1077939305 11:6823703-6823725 ATGAGGGTGGAAGGGTAGAAAGG + Intergenic
1078405997 11:11070391-11070413 AGGGAGGAGGAGGGATAGAGAGG - Intergenic
1078443107 11:11383852-11383874 CACAAGGTGGCAGGAGAGAGAGG - Intronic
1078490175 11:11761007-11761029 AAGAAGGAGGAAGGGAAGTGAGG - Intergenic
1078588930 11:12620921-12620943 ATGGAGGTGAAAGAATAGAGAGG + Intergenic
1078630216 11:12995837-12995859 TAGAGGGTGGAAGGAGGGAGAGG - Intergenic
1079120434 11:17680289-17680311 AAGAAAGAGGAAGGAGTGAGTGG - Intergenic
1079301935 11:19286077-19286099 AAGTAGGTGGGAGGTCAGAGAGG + Intergenic
1079424088 11:20323934-20323956 AAAAAGATGGAAGGAGAGAGGGG + Intergenic
1079447212 11:20568496-20568518 AAAGAGGTGGAGGGATAGTGAGG - Intergenic
1079473166 11:20799851-20799873 TAGAAGGAGGAAGGAGAGAGGGG - Intronic
1079501509 11:21105891-21105913 AGGAAGGGGGAAGAATAAAGAGG - Intronic
1079650596 11:22923371-22923393 AATAAGTAGGAAAGATAGAGTGG + Intergenic
1079697086 11:23495371-23495393 AGGAAGGTGGAGGGAAGGAGAGG + Intergenic
1079727366 11:23892320-23892342 AAGGAGGTTGAAGGATAGTGAGG + Intergenic
1079822521 11:25148408-25148430 AAGGAGGGAGAGGGATAGAGGGG + Intergenic
1080683357 11:34496064-34496086 AAGGGGGTGGAAGCAGAGAGGGG - Intronic
1080698055 11:34620212-34620234 AAGAAGGTGGAATATTAGGGAGG - Intergenic
1080904294 11:36525028-36525050 AAGAACAAGGAAGGAAAGAGAGG - Intronic
1081540205 11:44029270-44029292 AAGAAGCTGGATGGCTGGAGGGG - Intergenic
1081769182 11:45636838-45636860 AACAGGGTGGAAGGATGGAGTGG - Intergenic
1082770603 11:57204777-57204799 AAGAAGGGAGTGGGATAGAGAGG - Intergenic
1082808436 11:57464164-57464186 AACAAGATGGAAGGAGAGTGGGG + Intronic
1083049945 11:59768122-59768144 AAGAAGGAGGCAGGGAAGAGGGG + Intronic
1084102050 11:66956236-66956258 AGGAAGGTGGAAGGAGAATGTGG - Intronic
1084245838 11:67856406-67856428 AAAGAGGTTGAAGGATAGTGAGG + Intergenic
1084470427 11:69356219-69356241 AAGAAGGAGGGAGGAAAGAAGGG + Intronic
1084826834 11:71738108-71738130 AAAGAGGTTGAAGGATAGTGAGG - Intergenic
1084984176 11:72852994-72853016 CAGAAGGTGGGAGGAGGGAGAGG + Intronic
1084984716 11:72858620-72858642 TAGAGGGTGGAAGGAGGGAGAGG + Intronic
1085084161 11:73655759-73655781 AAGAAGGAGGAGGGAGGGAGGGG - Intronic
1085113965 11:73913486-73913508 TAGATGGTGGAAGGCTAGATGGG - Intronic
1085379436 11:76100745-76100767 TGGAAGGTGGAAGGAGGGAGAGG - Intronic
1085531453 11:77194519-77194541 AAGAAGGTAGAAGGGCTGAGAGG + Exonic
1085565978 11:77513841-77513863 AAGTAGGTGGGAATATAGAGAGG - Intergenic
1085713353 11:78850686-78850708 AGAAAGGTGGAAGGAGAAAGAGG + Intronic
1085785074 11:79441183-79441205 AGGAAGGGGGAAGGAGACAGAGG - Intergenic
1085951527 11:81338270-81338292 AAGAAGGTATAAGGATTGATGGG + Intergenic
1086404386 11:86487531-86487553 CAGAAGGTGGGAGGAGAGGGGGG + Intronic
1086882085 11:92161104-92161126 AAGATGCTGAAAGGAAAGAGGGG + Intergenic
1087196612 11:95310072-95310094 AAGGAGGTTGAGGGATAGTGAGG - Intergenic
1087212998 11:95462138-95462160 AGGAAGAGGGAAGGGTAGAGAGG - Intergenic
1087641969 11:100764673-100764695 AAGAATGTGAAAGGAAAGAAGGG + Intronic
1087951013 11:104220330-104220352 AAGAAGGTGGAAAACTAGACTGG + Intergenic
1088071384 11:105790136-105790158 ATGCAGGTGGAAGGAAAGAATGG - Intronic
1088098987 11:106132923-106132945 AGGAAGGTGGAAGGGTGGAGGGG + Intergenic
1088713603 11:112529427-112529449 AAGAAGGTGAAAGGGAAGGGAGG + Intergenic
1088799739 11:113294576-113294598 TAGAAGTTGGGAGGAGAGAGTGG + Intergenic
1089067420 11:115672463-115672485 AAGAAGGTGGACGAACAGTGTGG - Intergenic
1089072244 11:115709746-115709768 AAGAAGGGGGCAGGAAAGAAAGG - Intergenic
1089352736 11:117830661-117830683 AAGATGGGGACAGGATAGAGGGG + Intronic
1089874316 11:121705032-121705054 AAGAAGGGGAAAGGCTAGAGGGG + Intergenic
1090249556 11:125241932-125241954 AAGAGGGTGGAGTGATGGAGAGG + Intronic
1090464450 11:126921625-126921647 AGGAAGATGGATGGATAGATAGG - Intronic
1090786424 11:130052279-130052301 CAGGTGATGGAAGGATAGAGAGG - Intergenic
1091090242 11:132764241-132764263 CAGAAAGTGGAAGTATAGAGTGG + Intronic
1091105599 11:132916635-132916657 AGGAAGGTGGTAGAATAAAGAGG + Intronic
1091114745 11:133002758-133002780 AAGAAGGACAAAGGAAAGAGAGG + Intronic
1091192332 11:133706438-133706460 CAGATTGTGGAGGGATAGAGTGG - Intergenic
1091266886 11:134277656-134277678 AAGAAAGTGGAAAGGGAGAGAGG - Intronic
1091396043 12:154749-154771 AGGAAGGCGGAAAGACAGAGAGG - Intronic
1091758271 12:3070462-3070484 AGGCAGGTGGCAGGATTGAGAGG - Intergenic
1092388343 12:8053016-8053038 AAGAATGAGGCAGGAAAGAGAGG - Exonic
1092440810 12:8500504-8500526 TGGAAGGTGGGAGGATGGAGAGG + Intergenic
1092475345 12:8814179-8814201 AAGAAGGAGGGAGGAGACAGTGG + Intergenic
1092534078 12:9371087-9371109 TAGAAGGTCGAAGGATAGAGAGG - Intergenic
1092671917 12:10872486-10872508 TAGAGGGTGGAAGGAGAAAGAGG + Intronic
1092876089 12:12849183-12849205 AAGCAGGACCAAGGATAGAGGGG - Intergenic
1093222555 12:16440343-16440365 AAGAAGTTGGAATTATTGAGTGG - Intronic
1093498667 12:19784711-19784733 TAGAAGGGGGAAGGAGGGAGGGG - Intergenic
1093641917 12:21537463-21537485 AAGAAAATGGAGGGTTAGAGGGG + Intronic
1094084736 12:26577005-26577027 CAGAAGGTGGAAGGCAAGAGAGG - Intronic
1094156191 12:27339104-27339126 TGGAAGGTGGAAGGTTGGAGAGG - Intronic
1094214594 12:27927220-27927242 AAGAAAGTGGAAGGATGAAGGGG + Intergenic
1095183948 12:39179347-39179369 AAGCAGTTGGAAGGAAACAGAGG + Intergenic
1095309200 12:40677146-40677168 AAGAAAGAGAAAGGAGAGAGTGG - Intergenic
1095612083 12:44141372-44141394 AAAAGGGTGGGAGGAGAGAGAGG - Intronic
1095683391 12:45004531-45004553 AAGTAAGTGGAGAGATAGAGTGG - Intergenic
1095869360 12:47009324-47009346 AAGAAGGTGGGAAGCTTGAGAGG + Intergenic
1095884866 12:47178044-47178066 CAGAAGCTGGAAGAATAGAAAGG + Intronic
1096005384 12:48166205-48166227 AAGAAGCTGGAAAGGTAGGGAGG + Intronic
1096657265 12:53099333-53099355 AAGAAGGTGCAAGGAATGAGGGG - Intronic
1096747449 12:53738141-53738163 AAGAAGGCTGAAGGTGAGAGGGG + Intergenic
1096911268 12:54986748-54986770 TAGAGGGTGGAAGGAGGGAGAGG - Intergenic
1097225438 12:57474533-57474555 AGGAAGCTGGCAGAATAGAGAGG - Intronic
1097398267 12:59102259-59102281 AAAGAGGTTGAAGGATAGTGAGG - Intergenic
1098040763 12:66352224-66352246 AAGAAGGGTGAAGAATGGAGAGG + Intronic
1098194939 12:67989732-67989754 AAGAAGGAGGAAGGCTGGGGTGG + Intergenic
1098385698 12:69916341-69916363 AAGAAGGGGGAAGACTTGAGAGG + Intronic
1098433705 12:70447602-70447624 AAAAAGGTGGCAGGACAGAGAGG + Intergenic
1098460805 12:70731085-70731107 AGGAAGGAGGAAGGAGAGAGAGG + Intronic
1098603974 12:72367427-72367449 AAGAAGCTGGAAGGAGGAAGGGG - Intronic
1098831736 12:75372746-75372768 AAGCAGCTGGATTGATAGAGTGG - Intronic
1099172430 12:79380786-79380808 TAGGAGGTGGAAGAATTGAGGGG - Intronic
1099243504 12:80166461-80166483 AAGAAGGTGAAAAGAGAGAAAGG - Intergenic
1099824994 12:87763737-87763759 TGGAAGGTGGGAGGAGAGAGTGG + Intergenic
1099954843 12:89343631-89343653 CAGAAGGAGGAAAGAAAGAGCGG - Intergenic
1100368576 12:93943978-93944000 CAGAAGTTGGGAGGAGAGAGGGG + Intergenic
1100550725 12:95644324-95644346 AAGAAGGAGGAAGGAAGGAGAGG - Intergenic
1101049126 12:100842741-100842763 TAGAAGGTGGAAGGGTAAAGGGG + Intronic
1101551007 12:105762148-105762170 CAGCAGGTGGAAGGCAAGAGGGG - Intergenic
1101693015 12:107098356-107098378 AAGAAGGGGGAGGGAGGGAGGGG + Intergenic
1102237629 12:111304151-111304173 GAGAAGGTGGAAGTGCAGAGTGG + Intronic
1102623465 12:114215442-114215464 AGGAAGGTGGAGGGCGAGAGCGG + Intergenic
1102879491 12:116473503-116473525 AAGAAGGTGAAAGGGTAAAAGGG - Intergenic
1102983710 12:117262393-117262415 ATTAGGGTGGAAGGAGAGAGAGG + Intronic
1102990470 12:117312010-117312032 AGGAGGTAGGAAGGATAGAGAGG + Intronic
1103017344 12:117505766-117505788 AAGAAGGTGGCAGAAAAAAGAGG - Intronic
1104193692 12:126509516-126509538 AATAAGGTGGAAGGACAGGGAGG + Intergenic
1104239653 12:126975650-126975672 AGGAAGATGGAAGGAGACAGAGG + Intergenic
1104301729 12:127570612-127570634 AAGAAGGAGGAAGGAAGGAAGGG + Intergenic
1104374672 12:128253624-128253646 AAGAAGGTAGAAGCAAAGACTGG + Intergenic
1104842504 12:131831802-131831824 AGGAAGGGGGAAGGCTGGAGAGG + Intronic
1105370130 13:19794931-19794953 AGGCAAGTGGGAGGATAGAGAGG + Intergenic
1105479495 13:20760973-20760995 AAATAGGTGGAAGGATACATGGG - Intronic
1105572943 13:21621170-21621192 AAGCAAGTGGTAGGAAAGAGTGG - Intergenic
1105651564 13:22384131-22384153 AATAATGTGGAAGGAGAGACAGG + Intergenic
1108009038 13:45984716-45984738 AAGCAGGTGGAGGTAAAGAGAGG + Intronic
1108250110 13:48557599-48557621 AAGAAGCAGCAAGGATTGAGAGG + Intergenic
1108402307 13:50058559-50058581 TAGAGGGTGGGAGGATGGAGAGG - Intergenic
1108434485 13:50388211-50388233 CTGAAGGGGGAAGGATAGATTGG + Intronic
1108508987 13:51137643-51137665 AAGGAGGAGGAAGGAAAAAGGGG - Intergenic
1108532727 13:51342672-51342694 GAGAGGGTGGAAAGATGGAGAGG + Intronic
1108914135 13:55587610-55587632 AAGCAGCTGGAATGATAGAATGG - Intergenic
1109081349 13:57905308-57905330 CAGAGGGTGGAAGGAGAGAGAGG + Intergenic
1109347909 13:61139380-61139402 TGGAAGGTGGGAGGAGAGAGTGG - Intergenic
1110361290 13:74628641-74628663 ATGGAGGGGGAAGAATAGAGAGG + Intergenic
1111057215 13:82967154-82967176 AAGAAAGGGGAAGGAGAGGGAGG + Intergenic
1111057614 13:82971744-82971766 AAGCAGGTGGATTGATAGAATGG - Intergenic
1111113267 13:83743159-83743181 CAGAGGGTGGAAGGAGGGAGAGG + Intergenic
1111222432 13:85221488-85221510 CACAAGGTGGCAGGAGAGAGAGG - Intergenic
1111288515 13:86128607-86128629 AATGAGTTGCAAGGATAGAGAGG - Intergenic
1111362386 13:87191494-87191516 AAAGAGGTTGAAGGATAGTGAGG + Intergenic
1111436440 13:88215940-88215962 GAGAAGGAGGAAGGATAGGAGGG + Intergenic
1111445198 13:88338751-88338773 CAGGAGGTGGGAGGATAGAGAGG - Intergenic
1111664166 13:91246022-91246044 AAGAAGGAGAAAAGAAAGAGGGG - Intergenic
1112199582 13:97261898-97261920 AAGAAGGGGGAAGGACAGGGTGG - Intronic
1112288439 13:98124396-98124418 GAGAAGGTGGCAGGATAGTAGGG - Intergenic
1112308756 13:98299302-98299324 GAGAGGGTGTGAGGATAGAGAGG - Intronic
1112432924 13:99368212-99368234 AAGGAGGTGGGAGGATGGGGAGG + Intronic
1112912161 13:104500378-104500400 AAGACGCTGGAAGGATGGAAAGG + Intergenic
1113144747 13:107196153-107196175 GAGAAGGTGGAAGAAGGGAGAGG + Intronic
1113387825 13:109866767-109866789 AAGAAGGAGGAAGGAAGGAAGGG + Intergenic
1113659346 13:112094962-112094984 AAGGAGAAGGAAGGAGAGAGAGG - Intergenic
1114207016 14:20581587-20581609 CAGAGGATGGAAGGATACAGAGG - Intergenic
1114271408 14:21102532-21102554 GAGAAGGTGGGAGGATAAGGAGG + Intronic
1115585365 14:34806435-34806457 CAGAAGGTGGGAGGAGGGAGAGG - Intronic
1115587930 14:34833679-34833701 AAGCTGGGGGAAGGATAGAATGG + Intronic
1115860022 14:37674638-37674660 TGGAAGGTGGAATGATAAAGCGG - Intronic
1116343864 14:43762490-43762512 TGGAAGGTGGAAGGAGGGAGAGG + Intergenic
1116805229 14:49488067-49488089 TAGAGGGTGGAAGGAGGGAGAGG - Intergenic
1117234454 14:53756856-53756878 CACAAGGTGGCAGGAGAGAGGGG + Intergenic
1117528693 14:56637864-56637886 AAAAAGGTGGCAGGCTAGAGAGG + Intronic
1118113955 14:62752799-62752821 CACAAGGTGGCAGGAGAGAGAGG - Intronic
1119090206 14:71773885-71773907 GAGAAGGTGGCAGGGTAGGGAGG + Intergenic
1119197552 14:72728424-72728446 AAGAAGGCTGAAGAACAGAGCGG + Intronic
1119997648 14:79271373-79271395 AAGAAGGAGGAAGGTAAGGGAGG - Intronic
1120255457 14:82113511-82113533 AAAGAGGTGGGAGGATAAAGAGG + Intergenic
1120610571 14:86636440-86636462 AAGAAGGTGGAGGGAAGGAGAGG + Intergenic
1120903128 14:89593086-89593108 AAGGAGGAGGAAGGAAAGAAAGG + Intronic
1121186143 14:91971540-91971562 AAGAAGGGGAAAGGAGGGAGAGG + Intronic
1121240995 14:92430126-92430148 CAGAAGGTGGAAGGTTATTGAGG - Intronic
1121471408 14:94157213-94157235 AATAAGGTGAAAGAACAGAGAGG - Intronic
1121706181 14:95995984-95996006 AAGGAGGTAGGAGGAGAGAGAGG - Intergenic
1122122712 14:99563122-99563144 AAGATTCTGGAAGGGTAGAGGGG + Intronic
1122422611 14:101587043-101587065 CAGAAGGTGGGGGGATGGAGAGG + Intergenic
1202832682 14_GL000009v2_random:53877-53899 AAGAACGGGGAGGGACAGAGTGG + Intergenic
1123917384 15:25046402-25046424 TAGAAGGTGGGAGGAGAGTGAGG - Intergenic
1124098712 15:26673238-26673260 AGGAAGGAGGAAGGAAAGAAAGG - Intronic
1124462757 15:29908090-29908112 AAGAAGAAGGAAAGATAAAGAGG + Intronic
1124690728 15:31820056-31820078 AAGAATGTTTAAGGATGGAGTGG - Intronic
1125087268 15:35745089-35745111 GAGAAGGTGGAAATAAAGAGAGG + Intergenic
1125440415 15:39696797-39696819 AAAAAGGAGGAAGGAAGGAGAGG + Intronic
1125891061 15:43267614-43267636 GCGCAGGTGGAAGGAGAGAGAGG + Intergenic
1125931600 15:43604159-43604181 GAGAAGGTAGAAGGAGAGTGGGG + Intronic
1125944704 15:43703639-43703661 GAGAAGGTAGAAGGAGAGTGGGG + Intergenic
1126321397 15:47428414-47428436 AAGAAGTTCTAAGGATGGAGAGG + Intronic
1126323419 15:47448865-47448887 AACAGGGTGGAAGGATGAAGAGG - Intronic
1126530411 15:49704143-49704165 AAAGAGGTTGAGGGATAGAGAGG + Intergenic
1126704838 15:51397405-51397427 TAGAAGGGGGAAGGGGAGAGAGG - Intronic
1126716803 15:51526117-51526139 AGGGAGGGGGAAGGAGAGAGAGG + Intronic
1126927393 15:53605344-53605366 CAGAAGGTGGGAGGAGAGAGAGG + Intronic
1127019126 15:54726296-54726318 AAGAGGGTAGAGGGAGAGAGGGG - Intergenic
1127202410 15:56670332-56670354 CAGAGGGTGGGAGGAGAGAGAGG - Intronic
1127709026 15:61576978-61577000 TAGAAGTTGGGAGGAGAGAGAGG + Intergenic
1128045050 15:64610335-64610357 TAGAGGGTGGGAGGAAAGAGAGG + Intronic
1128396285 15:67229594-67229616 AGGAAGGAGGATGGAGAGAGGGG + Intronic
1128971874 15:72115385-72115407 GTCAAGGAGGAAGGATAGAGGGG - Intronic
1129000722 15:72331330-72331352 AAGAACGTGGAAGGACAGACTGG - Intronic
1129954066 15:79617577-79617599 TAGAGGGTGGAAGGAGGGAGAGG - Intergenic
1129958613 15:79662559-79662581 AGGAAGCTGGAAAGGTAGAGGGG - Intergenic
1130123411 15:81071708-81071730 TGGAAGGTGGGAGGAGAGAGAGG - Intronic
1130268062 15:82427306-82427328 AAGAAAGAGGAAAGAAAGAGAGG - Intergenic
1130503962 15:84519528-84519550 AAGAAAGAGGAAAGAAAGAGAGG + Intergenic
1130909171 15:88259146-88259168 TAGAAGGTGGGAGGAGGGAGAGG + Intergenic
1131657742 15:94479151-94479173 AAGGAGGAGGAAGTATACAGAGG - Exonic
1131720310 15:95161220-95161242 CAGAAGGTGGCAGAAGAGAGAGG - Intergenic
1132019329 15:98346742-98346764 CACATGGTGGAAGGAGAGAGAGG + Intergenic
1132752749 16:1466304-1466326 AGGAAGGTGGAGGGAGAGATGGG - Intronic
1133000533 16:2849169-2849191 AAGAAGGAGGAAGGAGAGAAAGG + Intergenic
1133337533 16:5015663-5015685 AAGAAGGAGGAAGGATGCTGGGG + Exonic
1133515879 16:6508218-6508240 TGGAAGGTGGAAGGAGGGAGAGG + Intronic
1133715417 16:8442712-8442734 TGGAAGGTGGAAGGAGGGAGAGG + Intergenic
1134204267 16:12224274-12224296 AAGAAGGAGGGAGGAAGGAGAGG - Intronic
1134395120 16:13855438-13855460 AGGAAGGTCTAAGGAAAGAGAGG - Intergenic
1134894956 16:17877414-17877436 GAGGAGGTGGAAGAAAAGAGAGG - Intergenic
1134904841 16:17971519-17971541 AAGAAGATGGAAGAAGAGACAGG + Intergenic
1135156963 16:20060873-20060895 AAGGACATGGAAGGAAAGAGTGG - Intronic
1135506091 16:23037662-23037684 AATATGGATGAAGGATAGAGAGG - Intergenic
1135840624 16:25873185-25873207 GAGTAGGTGGATGGATAGATGGG - Intronic
1135891774 16:26363784-26363806 AAGAAGAAGGAAGGAAAGAAGGG - Intergenic
1136056866 16:27696481-27696503 CAGAAGGTGGGAGGAAGGAGAGG - Intronic
1136146216 16:28317977-28317999 AGGAAGGTGGATGGAGAGTGAGG + Intronic
1136396329 16:29994498-29994520 AAGAAGGTGGAGGGAAATAAAGG - Exonic
1137248897 16:46728919-46728941 AGGAAGGGGAAAGGAGAGAGAGG + Intronic
1137254261 16:46761922-46761944 AAAAAGGAAGGAGGATAGAGGGG + Intronic
1137328631 16:47468077-47468099 AAAAAGGTTGAAGGAAAGAGAGG - Intronic
1137454916 16:48610586-48610608 AAGAAGGTAAAAGGGTAGGGAGG - Intronic
1137693772 16:50447773-50447795 AGGAGGCTGGAAGGAGAGAGAGG + Intergenic
1138403293 16:56766888-56766910 AAGAAGCTGGAAGGTAAGATGGG + Intronic
1138621231 16:58212928-58212950 AAGAAGGAGGAAGAAAAGAAAGG + Intergenic
1138623934 16:58234226-58234248 AAAAAGGTGGAGGGACTGAGTGG + Intronic
1138826108 16:60322219-60322241 TGGAGGGTGGAAGGAAAGAGAGG - Intergenic
1138919995 16:61515807-61515829 CAGAATGTGGCAGAATAGAGTGG + Intergenic
1138963683 16:62057862-62057884 TGGAAGGTGGGAGGAGAGAGAGG + Intergenic
1140106827 16:71968258-71968280 AAGGAGGTGGAAGGATTTAGAGG - Intronic
1140767049 16:78169694-78169716 AAGAAGGAGGTAGGGTAGAGTGG + Intronic
1140775246 16:78243500-78243522 TAGAGGGTGGAAGGAGGGAGAGG - Intronic
1140798620 16:78464291-78464313 AAAAAGGGAGAAGGAAAGAGAGG + Intronic
1141072729 16:80972966-80972988 AAGAAGCTGGAGGGAGAGTGGGG - Exonic
1141165140 16:81655305-81655327 CAGAAGGTGGAAGGATCTGGAGG + Intronic
1141734666 16:85844243-85844265 AAGAAGGAGGAAGGAAAGAAGGG - Intergenic
1141763653 16:86044968-86044990 AAGAAGAGGAAAGGACAGAGAGG + Intergenic
1141910421 16:87054806-87054828 CAGAGGGTGGAGGGATAGATGGG + Intergenic
1142887551 17:2922208-2922230 AGGAAGGCGGAAGGACAGAAGGG + Intronic
1143124672 17:4634035-4634057 CAGAGGGTGGAAGGAGTGAGGGG + Intronic
1144363639 17:14520903-14520925 CAGAAGGTGGGAGGAGGGAGAGG - Intergenic
1144400401 17:14892983-14893005 CAGAGGGTGGTAGGATGGAGTGG + Intergenic
1144561024 17:16320375-16320397 AAGAAGGAAGAAAGAAAGAGAGG + Intronic
1144746789 17:17621386-17621408 AAGAAGGAGGAAGAAGAAAGAGG + Intergenic
1144821967 17:18081458-18081480 TAGAAGGTGGAGGCAGAGAGAGG + Intergenic
1145065718 17:19760041-19760063 AAGAGGGTGGCAGGAAGGAGGGG - Intergenic
1145824482 17:27866606-27866628 AAAAGGGAGGAAGGAAAGAGAGG - Intronic
1145881303 17:28354580-28354602 GAAAAGCTGGAAGGAAAGAGGGG + Exonic
1146582606 17:34052524-34052546 AAGAGGGTGGAAGGATGGTGGGG - Intronic
1147009450 17:37433295-37433317 AAGCAGGATGAAGGATAGATGGG - Intronic
1147054664 17:37825054-37825076 AAAGATGTGGAAGGATAGATGGG + Intergenic
1147168464 17:38605314-38605336 AAGAAGGGGGATGGATGGTGAGG - Intronic
1147532947 17:41297473-41297495 AAAAAGGAAGAAGGAGAGAGAGG - Intergenic
1147584386 17:41645381-41645403 CAGGAGGTGGAAGGGTAGAGAGG - Intergenic
1147745131 17:42690243-42690265 GAGAACCAGGAAGGATAGAGTGG + Intronic
1147792074 17:43020211-43020233 AAGGAGGAGGAGGGAGAGAGAGG + Intronic
1147862809 17:43533443-43533465 CAGGAGAAGGAAGGATAGAGGGG + Intronic
1148339229 17:46863522-46863544 AAGAAAGAGGATGGTTAGAGGGG + Intronic
1149063916 17:52457846-52457868 TAGAGGGTGGAAGGAGAGAAAGG + Intergenic
1149072442 17:52558657-52558679 AAAAAGGGGCAAGGGTAGAGAGG - Intergenic
1150524804 17:65911357-65911379 AAGTAGGTGGAAGGAAATATGGG + Intronic
1151100518 17:71550843-71550865 AAGGAGGGGGAAGGAAAGAGAGG + Intergenic
1151103370 17:71581793-71581815 TAGAAGGTGGGAGGAGGGAGAGG + Intergenic
1151126893 17:71855116-71855138 GAGAGGGAGGAAGGAGAGAGGGG - Intergenic
1151430711 17:74060635-74060657 AGGGAGGGAGAAGGATAGAGAGG - Intergenic
1151562081 17:74875841-74875863 TAGAAGGTTGACTGATAGAGTGG - Intergenic
1152157338 17:78643541-78643563 AAGAGGGAGGAAGGAAAGACGGG - Intergenic
1152811889 17:82386247-82386269 AAGACGGAGGGAGGACAGAGAGG - Intergenic
1153153807 18:2126594-2126616 TAGAAGGTGGGAGGAGGGAGAGG - Intergenic
1153162006 18:2216919-2216941 CAGAAGGTGGGAGGAGGGAGAGG + Intergenic
1153500470 18:5744168-5744190 AAGAAAGTGGAAAGGTAGATGGG - Intergenic
1153667338 18:7378045-7378067 AAGGAAGTGGAAGCACAGAGAGG - Intergenic
1153850069 18:9085692-9085714 AGTAAGGTGGAAGGATTGCGTGG - Intergenic
1154068645 18:11132366-11132388 AAGCAGGTGGATTGATAGAACGG + Intronic
1154395720 18:13986814-13986836 TTGAAGGTGGGAGGAGAGAGAGG + Intergenic
1154473488 18:14726858-14726880 AGGAGGGTGGGAGGAGAGAGAGG - Intergenic
1155141727 18:23050245-23050267 GGGCAGGTGGAAGCATAGAGAGG - Intergenic
1155363753 18:25030161-25030183 AAGAAAGGGGGAGGGTAGAGGGG + Intergenic
1155692590 18:28644093-28644115 AAGAAGAAGGAAGGAAAGAAGGG + Intergenic
1156194744 18:34761474-34761496 GAAAAGGTGGAAGGAAAGAAGGG + Intronic
1156221174 18:35053790-35053812 GGGAAGGTAGAAGGAGAGAGAGG + Intronic
1156302021 18:35844682-35844704 AAAGAGGTTGAGGGATAGAGAGG - Intergenic
1156441925 18:37199236-37199258 CAGAAGGTGGGAGGAGGGAGAGG - Intronic
1156544561 18:37950804-37950826 AAGAAGGGAGGAGTATAGAGAGG + Intergenic
1157140399 18:45100058-45100080 AAGAAGGTGGAAGAAGGAAGAGG - Intergenic
1157470282 18:47983164-47983186 AAGAAGGAGGAAGGGGAAAGGGG - Intergenic
1157889167 18:51398165-51398187 AAGAAGCTAAAAGAATAGAGAGG - Intergenic
1157907727 18:51584573-51584595 AAGGAGGTGGAGTGAGAGAGAGG + Intergenic
1158922455 18:62208645-62208667 TAGAGGGTGGAAGGAGGGAGAGG - Intronic
1159188594 18:65012464-65012486 AAGAAGTTGAAAGCATAAAGAGG + Intergenic
1159853820 18:73560201-73560223 TGGAAGGTGGCAGGAGAGAGAGG - Intergenic
1159869438 18:73743814-73743836 AAGACGGTGGGAGGAGAGAATGG - Intergenic
1160325842 18:77947633-77947655 AAGGAGGTGGATGACTAGAGTGG + Intergenic
1160345495 18:78128679-78128701 AAGCAGGGGACAGGATAGAGTGG - Intergenic
1160965687 19:1746073-1746095 AAGAATGGGGAAGGATGGGGAGG + Intergenic
1160965702 19:1746111-1746133 TAGAAGGGGGAAGGATGGGGAGG + Intergenic
1160965718 19:1746154-1746176 AAGAATGGGGAAGGATGGGGAGG + Intergenic
1161022289 19:2015898-2015920 AAGGAGGGGGAAGGAGGGAGGGG + Intronic
1161022306 19:2015936-2015958 AAGGAGGGGGAAGGAGGGAGGGG + Intronic
1161022323 19:2015974-2015996 AAGGAGGGGGAAGGAGGGAGGGG + Intronic
1161022340 19:2016012-2016034 AAGGAGGGGGAAGGAGGGAGGGG + Intronic
1161778815 19:6278500-6278522 AATGAGGTGGAAGGAGGGAGAGG + Intronic
1161863693 19:6818396-6818418 AAGAAGAGGGGAGGATAGGGAGG - Intronic
1161900605 19:7116288-7116310 AATAAGAAGGAAGGAGAGAGGGG + Intronic
1162227639 19:9237217-9237239 AGAAAGGAGGAAGGATAGAAGGG - Intergenic
1162383816 19:10349056-10349078 ATGAAGTTGGCTGGATAGAGTGG - Intergenic
1162540654 19:11293985-11294007 GAGAAGCTGGGAGGGTAGAGGGG + Intergenic
1163164011 19:15483033-15483055 GAGGAGGTGGAAGGGGAGAGAGG - Intronic
1163551769 19:17969499-17969521 AAGAGGGTGGAGGGGTGGAGGGG - Intronic
1164190602 19:22913751-22913773 TAGAAGGTGGAAGGGTTGATAGG - Intergenic
1164300178 19:23955270-23955292 AAAAAGGGGGCAGGACAGAGAGG + Intergenic
1164302466 19:23973761-23973783 AAGGAGGAGGAAGAAGAGAGAGG + Intergenic
1164441854 19:28284994-28285016 AAGAAGGAGGATGGAGAGAAAGG + Intergenic
1164509286 19:28884402-28884424 TGGAAGGTGGGAGGAGAGAGAGG - Intergenic
1164592137 19:29512909-29512931 GAGAAGGAGGAAGGAGAGGGGGG + Intergenic
1164771931 19:30816214-30816236 AAGAAGGAGGAAGGGCAGAAGGG - Intergenic
1164855454 19:31517377-31517399 AAGAAGGAAGAAGGAGGGAGAGG + Intergenic
1165077313 19:33287056-33287078 CAGACGGAGGAAGGAGAGAGAGG - Intergenic
1165846177 19:38819127-38819149 AAGAAAATGGCAGGACAGAGAGG + Intronic
1165846310 19:38819973-38819995 AAGAAAATGGCAGGACAGAGAGG + Intronic
1166322078 19:42024744-42024766 AAGAAGCTGGCACGAGAGAGAGG - Intronic
1166634113 19:44434329-44434351 AAGAGTGTGGAAGGGAAGAGGGG - Intronic
1167044294 19:47040824-47040846 AAAAAGGTGAAAGCACAGAGAGG - Intronic
1167110815 19:47459994-47460016 AAAAAGATGGAGGGAGAGAGAGG - Intronic
1167566932 19:50262548-50262570 AAAAAGCTGAAAGAATAGAGTGG + Intronic
1167622830 19:50568533-50568555 GAGAGGGAGGAAGGAAAGAGGGG + Intergenic
1168450844 19:56465588-56465610 GGGAAGGTGGAAGCACAGAGAGG + Intronic
1202639999 1_KI270706v1_random:73854-73876 AAGAACGGGGAGGGACAGAGTGG - Intergenic
925140806 2:1548944-1548966 AAGAAGGGTGAAGGCCAGAGAGG - Intergenic
925260579 2:2525069-2525091 AACATGGTGGTAGGATACAGAGG - Intergenic
925697088 2:6591871-6591893 AAATACGTGGAAGGATAGACAGG - Intergenic
925763928 2:7212743-7212765 AAATAGGAGGAAGGCTAGAGAGG + Intergenic
925825779 2:7847167-7847189 AAGGAGGTTGGGGGATAGAGAGG - Intergenic
926039041 2:9658017-9658039 CAGAAGGTGGAGGGACAAAGAGG - Intergenic
926553219 2:14325624-14325646 AAGAAGGAGAAGGGAAAGAGTGG + Intergenic
927273460 2:21239454-21239476 AAGAAGAAGGAAGGCAAGAGTGG - Intergenic
927650132 2:24907612-24907634 AAGGAGGGGAAAGGAGAGAGGGG + Intronic
927882930 2:26701380-26701402 GAGAAGGTGGATGGAAAGGGAGG + Intronic
927947965 2:27148839-27148861 AAGAAGGCAGGAGGATAGTGGGG - Intergenic
928275681 2:29898140-29898162 GGGAAGGTGGCAGGAAAGAGAGG - Intronic
928921922 2:36535234-36535256 AGGGAGGGGGAAGGAGAGAGGGG + Intronic
929292170 2:40205652-40205674 TGGAAGGTGGGAGGAGAGAGAGG + Intronic
929656586 2:43738790-43738812 AAGAATGTCTAAGGATATAGGGG - Intronic
929671714 2:43881035-43881057 AAGAAGGGGGAAGGATGAAGAGG + Intergenic
929781726 2:44961481-44961503 GAGAAGGTGGAGGCAGAGAGAGG + Intergenic
929804976 2:45136980-45137002 AGGAAGGTGGGAGGAGGGAGAGG - Intergenic
931187008 2:59962943-59962965 AAGAATGTGGAAAGAGAGAATGG - Intergenic
931647549 2:64438283-64438305 AAGAAAGAGGAAGAATAAAGAGG + Intergenic
932441041 2:71735380-71735402 AGGAGGGAGGAAGGATAAAGGGG + Intergenic
932589727 2:73057835-73057857 CACAAGGTGGCAGGAGAGAGAGG - Intronic
932751877 2:74376376-74376398 ACGACTGTGGAAGGATAGACTGG - Intronic
933078997 2:77965750-77965772 AAAGAGGTGGAGGGATAGTGAGG - Intergenic
933143784 2:78825774-78825796 AGGAGGCTGGAAGGAGAGAGAGG + Intergenic
933168970 2:79104313-79104335 TAGAAGGTGGAAGGAAAGTAAGG + Intergenic
933329804 2:80879590-80879612 AAGGAGGTTGAGGGATAGTGAGG + Intergenic
933472353 2:82742120-82742142 GAGAAAGTGGAAGGAGAGAAGGG - Intergenic
933738401 2:85513616-85513638 CAGAAGGAGGGAGGACAGAGGGG + Intergenic
934164768 2:89283969-89283991 AAGAAGGAAGAAGGAATGAGTGG + Intergenic
934202506 2:89898555-89898577 AAGAAGGAAGAAGGAATGAGTGG - Intergenic
934819075 2:97356327-97356349 CAGAAGGTGGAACGTGAGAGAGG - Intergenic
935794289 2:106626285-106626307 ATGAATGTAGAAGGAAAGAGGGG - Intergenic
935816423 2:106850242-106850264 AAGCACCTGGCAGGATAGAGGGG + Intronic
936034561 2:109100534-109100556 AAGAAAGAGGAAGGAAACAGGGG + Intergenic
936938011 2:117856945-117856967 AAGAGAGTGGTAGGATAGAGGGG + Intergenic
937023691 2:118680488-118680510 AACAGGGTGGAAGGATGGTGTGG - Intergenic
937239251 2:120449751-120449773 AAGAAGGTGGCAGAAGAAAGGGG + Intergenic
937441988 2:121923683-121923705 CAGAGGGTGGGAGGAGAGAGGGG - Intergenic
937492289 2:122382656-122382678 GAGAAGGTGGAAGCAGAAAGAGG + Intergenic
937623905 2:124022839-124022861 TAGAAGGTGGAATTATATAGTGG + Intergenic
937800844 2:126078582-126078604 AAGCAGGTGGATTGATAGAACGG + Intergenic
938647976 2:133350887-133350909 GTGAAGGGGGAAGGAGAGAGAGG - Intronic
938650239 2:133375579-133375601 CAGAGGGTGGGAGGAGAGAGAGG - Intronic
938742964 2:134250162-134250184 TAGAAAGTAGGAGGATAGAGGGG + Intronic
939143754 2:138388192-138388214 TTGAAGCTGGAAGGATAAAGAGG + Intergenic
939214044 2:139213520-139213542 AAGCAGGTGGATTGATAGAATGG + Intergenic
939817590 2:146915430-146915452 CAGAAGGAGGAAGGAGAGTGTGG + Intergenic
939890032 2:147725596-147725618 GAGAAGGTGGAAGAAGAGACAGG + Intergenic
939988984 2:148859702-148859724 AGAAAGGTGAAAGGCTAGAGAGG - Intergenic
940058304 2:149536628-149536650 AAGAAGTTGGGTAGATAGAGTGG + Intergenic
940166601 2:150780503-150780525 ATGAAGGTAGAGGAATAGAGAGG - Intergenic
940422430 2:153496063-153496085 AAGAGTGGGGAAGGACAGAGTGG + Intergenic
940552750 2:155182428-155182450 AAAAAAGTGAAAGGATAAAGAGG - Intergenic
940831688 2:158473657-158473679 TAGAGGGTGGGAGGAGAGAGGGG + Intronic
941342021 2:164318389-164318411 AAGCAGGAGGCAGGTTAGAGGGG - Intergenic
941515668 2:166473024-166473046 TAGAGGGTGGGAGGAGAGAGAGG + Intronic
941809246 2:169739016-169739038 AAGAAGGCAGAAGGAGGGAGAGG - Intronic
941834764 2:170004433-170004455 AAGTAGCTGGAAGGATTGATGGG + Intronic
942034413 2:171996866-171996888 AAGAAGGAGGAAGGAAAAATGGG + Intronic
942207018 2:173629348-173629370 AAAGAAGTGGAAGGAAAGAGGGG - Intergenic
942256726 2:174109942-174109964 AAGAGGGTGGGAAGAGAGAGAGG - Intronic
942305971 2:174607969-174607991 AAAAAGGTGCCAGGATAAAGTGG + Intronic
942579870 2:177406581-177406603 AAGAAGGTGAAAATGTAGAGTGG + Intronic
942960536 2:181825188-181825210 AAGAAGGTGAAAGGAACAAGGGG - Intergenic
943312282 2:186341122-186341144 AAGAAGGTGCAGGGATTGACTGG + Intergenic
943823020 2:192351750-192351772 CACAAGGTGGCAGGAAAGAGAGG + Intergenic
944794012 2:203163564-203163586 ATGAAGGAGGAAGGATTGATTGG - Intronic
945020583 2:205567197-205567219 GAGAAAGAGGGAGGATAGAGAGG + Intronic
946541485 2:220689052-220689074 AATAAGGTGAAAGGAAATAGAGG - Intergenic
946919209 2:224560514-224560536 GAGCAGCTGGAAGGATGGAGTGG - Intronic
947083382 2:226423573-226423595 AAGAAGGAGGAAGCACAGACTGG - Intergenic
947358556 2:229322361-229322383 TCGAAGGTGGAAGGAGGGAGAGG + Intergenic
948127657 2:235576660-235576682 AAGAAGGTGGAACTCTAGAGAGG + Intronic
948222660 2:236285323-236285345 CAGAAGGTGGAAGGACAAAAAGG - Intergenic
948860554 2:240750737-240750759 CAGGAGGTGGAGGGACAGAGAGG + Intronic
1168957451 20:1844412-1844434 CAGAAGGTGGAAGGACAAAGGGG - Intergenic
1169032331 20:2419250-2419272 AAGTATGTGAAAGGAGAGAGAGG - Intronic
1169385625 20:5146958-5146980 AGTAAGGAGGAAGGAGAGAGAGG + Intronic
1169578409 20:6991704-6991726 AAGAAGGCTGAAGCAGAGAGAGG - Intergenic
1169616907 20:7458026-7458048 AACATGGTGGAAGGGTAGAAGGG - Intergenic
1170034313 20:11973861-11973883 AAGAAGGAGGAAGGAGGAAGAGG + Intergenic
1170327358 20:15171359-15171381 AAGGTGGGGGAAGGATGGAGGGG - Intronic
1170624622 20:18021782-18021804 AAGAAGGTGGAAGGAAAGGAGGG + Intronic
1170729071 20:18956503-18956525 AAGAAGGAGAAAGAAAAGAGAGG + Intergenic
1170731099 20:18975426-18975448 AAGAGGGAGGAAGGAAGGAGAGG - Intergenic
1171198654 20:23223773-23223795 ATGAAGATGGATGGAAAGAGAGG - Intergenic
1171433700 20:25103641-25103663 AAGAAGGAGGAAGGATTGCTGGG + Intergenic
1171478637 20:25434894-25434916 CAGAAGGTGGAAGGACAAAAAGG + Intronic
1171977576 20:31605279-31605301 AAGAACGTGGAATGAGAGTGCGG - Exonic
1171986719 20:31665911-31665933 AAGGGGGTGGGAGGGTAGAGTGG + Exonic
1172199162 20:33113167-33113189 AACACAGTGGAAGGAAAGAGAGG - Intergenic
1172217223 20:33244483-33244505 TAGAAGGTGGGAGGAGAGTGGGG + Intergenic
1172608427 20:36231424-36231446 AAGAAGGTGGGAGGGGAGGGCGG + Exonic
1172806235 20:37613905-37613927 AAGAAGCTGGAGGGACAGACAGG - Intergenic
1173402978 20:42741067-42741089 CAGAAGGTGTAAGGAGTGAGAGG + Intronic
1173649399 20:44653375-44653397 AACAAGGGGGAAAGAGAGAGTGG + Intergenic
1173905561 20:46626213-46626235 AAGGAGGGGGAGGGAGAGAGAGG - Intronic
1174175303 20:48640837-48640859 AAGAAGATGGATGGATGGATGGG + Intronic
1175503317 20:59465480-59465502 AAGAAGGAGGAGGGAGACAGAGG - Intergenic
1175524977 20:59627457-59627479 GAGCAGCTGGAAGGATGGAGAGG + Intronic
1175542435 20:59756118-59756140 AGAAGGGAGGAAGGATAGAGGGG + Intronic
1175935096 20:62510541-62510563 TGGAAGGTGGAGGGGTAGAGAGG - Intergenic
1176333774 21:5576723-5576745 AAAAAGGTGGAGGCAAAGAGAGG + Intergenic
1176393983 21:6244229-6244251 AAAAAGGTGGAGGCAAAGAGAGG - Intergenic
1176467436 21:7071945-7071967 AAAAAGGTGGAGGCAAAGAGAGG + Intronic
1176490997 21:7453723-7453745 AAAAAGGTGGAGGCAAAGAGAGG + Intergenic
1176509645 21:7684660-7684682 AAAAAGGTGGAGGCAAAGAGAGG - Intergenic
1176800994 21:13431007-13431029 AGGAGGGTGGGAGGAGAGAGAGG + Intergenic
1176964253 21:15194001-15194023 CAGAAAGTGGAAGGATATAGAGG + Intergenic
1177594490 21:23219051-23219073 TAGAGGGTGGGAGGAGAGAGAGG - Intergenic
1178362985 21:31965302-31965324 TGGAGGGTGGAAGGAGAGAGAGG + Intronic
1178581972 21:33845399-33845421 GGGAAGCTGGAAGGAGAGAGTGG - Intronic
1178806755 21:35845799-35845821 AAGAAGGAGGAAAACTAGAGAGG - Intronic
1178851856 21:36219040-36219062 AAGGAGATGGAAGCACAGAGAGG - Intronic
1179010199 21:37550795-37550817 GAGAAGGTGGGAGGACTGAGAGG + Intergenic
1179158442 21:38872472-38872494 CACAAGGTGGCAGGAGAGAGGGG - Intergenic
1179256092 21:39716484-39716506 GAGAGGGTGGGAGGAGAGAGAGG - Intergenic
1179280476 21:39929938-39929960 GAGAAGGTGGAATGGAAGAGAGG - Intergenic
1179888663 21:44325298-44325320 CAGATGGTGGCAGGAAAGAGGGG - Intronic
1180908108 22:19430330-19430352 CACAAGATGGAAGGAGAGAGAGG + Intronic
1181547925 22:23614209-23614231 AACAAGCTGGAAGGACACAGAGG + Exonic
1181548701 22:23622171-23622193 AAGAACCTGGAAGGACACAGAGG + Exonic
1181932970 22:26417596-26417618 AAAAAGGTGGGAGGAGAGTGAGG + Intergenic
1182345208 22:29658387-29658409 AGGAAAGAGGAAGGAAAGAGAGG + Intronic
1182370197 22:29805291-29805313 AACAAGGAGGAAGGACAGGGAGG - Intronic
1182448218 22:30402219-30402241 AAGCAGGTGGGTGGAGAGAGTGG + Intronic
1183034861 22:35133930-35133952 AGGGAGGAGGAAGGAGAGAGAGG + Intergenic
1183086198 22:35488766-35488788 AAGAAGGAGAGAGGAAAGAGAGG + Intergenic
1183102540 22:35592751-35592773 AAGATGGAGGAGGGACAGAGAGG - Intergenic
1183305227 22:37079457-37079479 AAGAAGGAAGAAGGAAAGAAGGG + Intronic
1183372388 22:37441185-37441207 AAGAAGGTGGAAGAAAGGTGGGG - Intergenic
1184959362 22:47917897-47917919 GAGAAGGAGGAAGGAGAGGGAGG - Intergenic
1185268970 22:49919478-49919500 CAGAAGCTGGAAGGCCAGAGAGG - Intronic
949285076 3:2393087-2393109 AAGAAGGTAGAAGAATAGGATGG - Intronic
949491211 3:4590865-4590887 GGGAGGGTGGAAGGAGAGAGAGG - Intronic
950398874 3:12755011-12755033 AGGGAGGGGGAAGGAGAGAGAGG - Intronic
950555521 3:13693523-13693545 AAGAAGATGGGAGGGTAGAGAGG - Intergenic
951096534 3:18638272-18638294 TGGAAGGTGGAAGGAAGGAGAGG + Intergenic
951394752 3:22151991-22152013 TGGAGGGTGGAAGGAGAGAGAGG - Intronic
951485404 3:23203662-23203684 AAGAAGGGGGAGGGGTAGAAAGG - Intronic
951714001 3:25619306-25619328 AAGAAAGAAAAAGGATAGAGAGG - Intronic
952230513 3:31424843-31424865 AAGAAAGAGGAAGGAAGGAGAGG + Intergenic
952482887 3:33780076-33780098 AAAAAGGTTGAAGGAGTGAGGGG + Intergenic
952606387 3:35152179-35152201 TAGAGGGTGCAAGGAGAGAGAGG - Intergenic
952859426 3:37800648-37800670 TAGGAGGTGGTAGGACAGAGTGG - Intronic
953218113 3:40940181-40940203 AGGAAGTTGCAAAGATAGAGAGG + Intergenic
953365148 3:42337862-42337884 AAGAAGGTGGAATGAAATAGGGG - Intergenic
953436614 3:42882227-42882249 GAGAGGGTGGAGGGATAGGGTGG + Intronic
954003176 3:47573647-47573669 AAAGATGTGGAAGGATACAGAGG + Intronic
954065167 3:48100092-48100114 AAGAACCTAGAAAGATAGAGGGG + Intergenic
954742156 3:52761694-52761716 GAAAAGTTGGAAAGATAGAGTGG - Intronic
954766832 3:52925333-52925355 AAGAATGTGGTAAGACAGAGAGG + Intronic
955531937 3:59882611-59882633 AAGTAGGTGGAGGTACAGAGGGG + Intronic
955566226 3:60249724-60249746 GAGAAGGGGGAAGGAAAAAGAGG + Intronic
955663966 3:61330789-61330811 AAGAAGGTGGGAGGAGAAAGAGG + Intergenic
955870949 3:63437700-63437722 AAGAAGCTGTAAGTATGGAGAGG + Intronic
955878003 3:63513798-63513820 AGGAAGATGGAAGGAAAGAGGGG + Intronic
956077149 3:65517541-65517563 AAGAAAGTGGGAGGTCAGAGTGG + Intronic
956758356 3:72412951-72412973 CAGAAGGTGGAAGGGCAGAAAGG - Intronic
956951401 3:74287744-74287766 GGGAGGGTGGAAGGAAAGAGAGG + Intronic
957724482 3:84046565-84046587 AAGAAAGGGAAAGGAGAGAGAGG - Intergenic
958754261 3:98231665-98231687 AGGAAGGAGGAAGGAAAGATAGG - Intergenic
959089219 3:101884638-101884660 AAGTAGGAAGAAGGATGGAGAGG + Intergenic
959632414 3:108522178-108522200 AAGATGGTGGAAAGACAGAGGGG + Intronic
959816324 3:110677352-110677374 ATGAAGGTGGGAGGAGGGAGAGG + Intergenic
959833661 3:110893263-110893285 AAGAAGGAGGAAGGAGAAAATGG - Exonic
959960414 3:112292117-112292139 TAGATGGTGGGAGGAGAGAGAGG + Intronic
960367220 3:116787245-116787267 AAGAAGGGGGAGGGAGGGAGAGG - Intronic
960397550 3:117155697-117155719 AACAATGTGGAGGGAGAGAGGGG + Intergenic
960471001 3:118065142-118065164 CAGAAGGTGGAAGGACAAAAAGG + Intergenic
960698582 3:120419189-120419211 CAGGAGGTGGAAGAATAGGGTGG + Intronic
961345501 3:126260841-126260863 AAGAAGAGGGAAGGAAGGAGAGG - Intergenic
961905333 3:130257076-130257098 AAGTAGGGGGAAGGAGACAGAGG - Intergenic
962007410 3:131362097-131362119 AGGAAGGTGCAAGGCCAGAGCGG - Intergenic
962160851 3:132998793-132998815 TGGAAGGTGGAAGGACAAAGAGG - Intergenic
962186813 3:133269124-133269146 AGGTAGGTGGAAGAATGGAGGGG - Intronic
962350745 3:134653886-134653908 AAGATGGTAGCAGGATGGAGGGG - Intronic
962364696 3:134770742-134770764 AAGAAGGTGGAATCTCAGAGGGG - Intronic
962731676 3:138289420-138289442 AAGAAGGTGAGAGGAGAGAGTGG + Intronic
962906416 3:139807358-139807380 AAGAAGTAGGAAGGAAGGAGAGG + Intergenic
963110194 3:141682269-141682291 AAGAAAGAGGAAGGAAGGAGGGG + Intergenic
963690050 3:148488068-148488090 AAGAAGGAGGAAGCAAAGAAAGG + Intergenic
964287449 3:155134283-155134305 TAGAGGGTGGAGGGAGAGAGTGG - Intronic
964389253 3:156180824-156180846 AAGAAGGTGGAAACAGAGATTGG + Intronic
965799310 3:172475498-172475520 TAGAGGGTGGGAGGAGAGAGAGG - Intergenic
965909684 3:173757568-173757590 AAGAAGGTGGATGGGAAAAGAGG + Intronic
966145695 3:176809272-176809294 AAGGTGGTGGAAGGAGGGAGAGG - Intergenic
966774711 3:183533759-183533781 ACGGAGGCGGAAGGACAGAGGGG - Intronic
966903388 3:184503811-184503833 CAGAAGGTGGAAGGACAAAAGGG + Intronic
966942334 3:184754875-184754897 AAGAAGGTGGTGGGAGAAAGTGG + Intergenic
967467634 3:189825921-189825943 AAGGAGGGGGAAGGGTGGAGAGG - Intronic
967471664 3:189869084-189869106 AAGGAGGTGGAAGGATGGTAGGG - Intronic
967550513 3:190789352-190789374 AAAAAGGGGGAAGGGAAGAGAGG + Intergenic
967780444 3:193433387-193433409 TAGAAGGTGGAGGGTAAGAGAGG + Intronic
967786689 3:193504615-193504637 AATAAAGTGGAAGGTTAGAGGGG - Intronic
968289790 3:197529913-197529935 AAGAAGGATGAAGGGAAGAGTGG - Intronic
1202738552 3_GL000221v1_random:33538-33560 AAGAATGGGGAGGGACAGAGTGG + Intergenic
968481100 4:833448-833470 AGGAAGGTGGAAGGAGGAAGGGG + Intergenic
969838386 4:9861978-9862000 ATGAAGTTGGAAGGATAGTAGGG - Intronic
969939718 4:10718884-10718906 TGGAAGGTGGAAGGAGAGATGGG + Intergenic
969986629 4:11218079-11218101 AAGGAGTTGTAATGATAGAGAGG + Intergenic
970029466 4:11658662-11658684 AAGGAGGTTGAGGGATAGTGAGG + Intergenic
970172594 4:13304633-13304655 GAGAAAGAGGAAGGATAGAAAGG - Intergenic
970572046 4:17392888-17392910 GAGAGGGTGGAAGGAGAGGGTGG + Intergenic
970605379 4:17676239-17676261 AGGGAGGTCCAAGGATAGAGAGG + Intronic
971012964 4:22459322-22459344 AGGAGGGTGGAAGGAGGGAGAGG + Intronic
971044652 4:22791888-22791910 ATGACAGTGGAAGCATAGAGAGG + Intergenic
971092777 4:23363930-23363952 GAGAAGGTGGGAGGATAAAAAGG + Intergenic
971251267 4:24975330-24975352 GAGAAGGGGGAAGGAGAGGGAGG + Intronic
971355518 4:25891347-25891369 ATGAAGGTGGAAGGAGAGCCAGG - Intronic
971421852 4:26481141-26481163 AATGAGGTGGAAGGCTACAGCGG + Intergenic
971589492 4:28449301-28449323 AAAAAGGTGGAAGAACAGATGGG + Intergenic
971875916 4:32308254-32308276 AAGGAGGTGAGAGGATAGAGAGG + Intergenic
972076532 4:35096413-35096435 TAGAAGGTGGGAAGAGAGAGAGG + Intergenic
972109008 4:35531603-35531625 ATGAAGGAAGAAGGATAGGGAGG + Intergenic
972348265 4:38211830-38211852 AAGAAGGTGGATGGATGGGATGG + Intergenic
972942525 4:44214269-44214291 AAGGAGCTAGGAGGATAGAGGGG + Intronic
973273772 4:48287838-48287860 AGGAAGGCAGAAGGTTAGAGAGG - Intergenic
973370246 4:49240197-49240219 AAGAACGGGGAGGGACAGAGTGG - Intergenic
973390783 4:49555223-49555245 AAGAACGGGGAGGGACAGAGTGG + Intergenic
973848047 4:54933187-54933209 AAGTAGGTTTAAGGAGAGAGTGG - Intergenic
974063408 4:57055424-57055446 AGGAAGGTGGAAAGTTAGAAAGG + Intronic
974085571 4:57257030-57257052 TAGACGGTGGTAGGAAAGAGAGG - Intergenic
974642080 4:64644239-64644261 TAGAGGGTGGAAGGAGAGTGAGG - Intergenic
975255444 4:72230373-72230395 AAGCAACTGGAAGGAAAGAGGGG - Intergenic
975438124 4:74377733-74377755 CACAAGGTGGCAGGAGAGAGAGG + Intronic
975822404 4:78285414-78285436 AAGAATATGGAAGCAGAGAGAGG - Intronic
976220927 4:82756403-82756425 AAGAAAGTTGAGGCATAGAGAGG - Intronic
976890818 4:90045319-90045341 ATGAAGGTGGAAAGTTAGCGAGG - Intergenic
977028239 4:91848288-91848310 ACTATGGTGAAAGGATAGAGTGG + Intergenic
977256539 4:94747067-94747089 TGGAAGGTGGAAGGAGGGAGAGG + Intergenic
977465225 4:97375843-97375865 AAGAAGTTGGAAGCATATATGGG - Intronic
978141174 4:105318893-105318915 ATGTAGGTGGAAGGATAAGGAGG - Intergenic
978292087 4:107153336-107153358 TGGAAGGTGAAAGGATAGACAGG - Intronic
978708399 4:111746065-111746087 AAGAAAGAGGAAGGAAAGAAAGG - Intergenic
979141000 4:117174496-117174518 TGGAAGGTGGAAGGAGAGAGGGG + Intergenic
979156050 4:117392204-117392226 AAGAAGAGGGAAGAATAAAGGGG + Intergenic
979657265 4:123209765-123209787 TAGAAGGTGGAAGGAGAAAGAGG + Intronic
980957909 4:139447197-139447219 AAGCAGCTGGAATGATAGAACGG + Intergenic
981673734 4:147316586-147316608 AGGAAGGAGAAAGGCTAGAGAGG + Intergenic
981912246 4:149995386-149995408 AAGAGGGAGGGAGGAGAGAGGGG + Intergenic
982114282 4:152084391-152084413 GAGAAGGTGGAAGGGGAGACAGG + Intergenic
982774935 4:159431582-159431604 AAAAAGGTGGAGGGAGAGACAGG - Intergenic
983116588 4:163825092-163825114 TAGAATGTGGAAAGAGAGAGAGG - Intronic
983283323 4:165708512-165708534 CAGAGGGTGGAAGGAGGGAGAGG - Intergenic
983457039 4:167978144-167978166 TAGAAGGTGGGAGGAGGGAGAGG + Intergenic
983850124 4:172570099-172570121 CAGAAGGTGGAAGAATACATGGG + Intronic
983895334 4:173075560-173075582 ATGAATTTGGAAGCATAGAGTGG + Intergenic
984005421 4:174300243-174300265 CTGAAAGTGAAAGGATAGAGAGG + Intronic
984393872 4:179169914-179169936 AAAGAGGTTGAAGGATAGTGAGG + Intergenic
984456672 4:179977730-179977752 GAGAAGCAGGAAGGAGAGAGAGG - Intergenic
984791274 4:183617179-183617201 AAGAAAGAGGAAGGAGGGAGGGG - Intergenic
984886575 4:184455182-184455204 AAGAAGGTGGAGGGAATCAGTGG - Intronic
985195319 4:187422446-187422468 AGAAAGGTGGATGGATAGATGGG + Intergenic
1202767359 4_GL000008v2_random:159713-159735 AAGAATGGGGAGGGACAGAGTGG - Intergenic
986450120 5:7854889-7854911 AAGAAGGTGAAAGACTAGACTGG - Intronic
986685496 5:10272443-10272465 CAGAAGGTGGAAGGCAGGAGAGG - Intergenic
986830470 5:11571770-11571792 AAGAAGGTAGATGGACAAAGTGG - Intronic
987686331 5:21208469-21208491 AAAAAAGTGGAAAGATAAAGAGG - Intergenic
989491545 5:42060938-42060960 TAGAGGGTGGAAGGAAGGAGAGG + Intergenic
989546799 5:42683691-42683713 AGGAAGGTGGAAGGGAAGAAAGG + Intronic
989597613 5:43171341-43171363 AAGGAGATGGAATGATAGATGGG - Intronic
989661224 5:43799891-43799913 CAGAAGGTGGAAGCAAAGTGAGG + Intergenic
989705921 5:44330187-44330209 AACAAGGTGCAAGGAGACAGTGG + Intronic
990051316 5:51505244-51505266 GACAAGGTGGCAGGAGAGAGGGG + Intergenic
990533920 5:56701218-56701240 AAGAAGCCTGAAGGATAGGGAGG - Intergenic
990598559 5:57334690-57334712 AGGAAGGTGGCTGGATAGGGAGG - Intergenic
990777899 5:59324053-59324075 AGGGTGGTGGAAGGAGAGAGAGG - Intronic
990782255 5:59378285-59378307 TAGAAGGTGGGAGGAGGGAGAGG + Intronic
990843741 5:60113224-60113246 AAGGAGGTGATAGGATGGAGGGG - Intronic
991214321 5:64144750-64144772 CAGAGGGTGGAAGGAAAAAGAGG - Intergenic
991570390 5:68047700-68047722 AAGATGGTGGAGGGAGAGAAGGG + Intergenic
991572647 5:68071981-68072003 TGGAAGATGGAATGATAGAGGGG + Intergenic
992358776 5:76014085-76014107 AAGAAGAAGGAAAGAAAGAGAGG + Intergenic
992621115 5:78593897-78593919 AAGAAGGAGGGGGGATGGAGAGG + Intronic
992662320 5:78973935-78973957 TATAAGGTGGAGGGGTAGAGTGG - Intronic
992952602 5:81875248-81875270 AAGAAGCTGGAAGGAAAGAATGG + Intergenic
993516193 5:88837969-88837991 AAGAAGGCTGGAGGACAGAGTGG + Intronic
993601338 5:89928692-89928714 AACAAGGAGGAAGGGTATAGTGG + Intergenic
993683749 5:90912530-90912552 TAGAATGTGGAAGGAGGGAGGGG - Intronic
993823048 5:92644645-92644667 ATGAAAGTGGCAGGAGAGAGGGG - Intergenic
994225628 5:97249172-97249194 TAGAGGGTGGAAGGAGGGAGAGG + Intergenic
994315406 5:98327120-98327142 AAGAAGATGGAAGAAAAGATTGG - Intergenic
994337008 5:98578794-98578816 TAAAAGGGGGAAGGGTAGAGAGG - Intergenic
994337558 5:98585960-98585982 AAGGGGGTGGAAGGGTAGAGAGG + Intergenic
994798119 5:104332706-104332728 AAGAAGATGGAAATAAAGAGTGG - Intergenic
995487234 5:112651592-112651614 AAGCAGGTGGCAGGAGAAAGAGG - Intergenic
995860072 5:116631585-116631607 AAGAATGTGGAGTGAAAGAGGGG - Intergenic
996816206 5:127575248-127575270 AAGAAGGTGAAAAGAGAAAGAGG + Intergenic
996893603 5:128453904-128453926 AGGAGGGTGGAAGGACAAAGAGG - Intronic
997084267 5:130778500-130778522 AAAAAGGAGGAAGGAGAAAGAGG + Intergenic
997269044 5:132520218-132520240 CAGAAGGTGGAAGGGCAAAGAGG - Intergenic
997702650 5:135914498-135914520 AAGAAGGTAGAAAAGTAGAGTGG - Intergenic
997899155 5:137748170-137748192 GAGAAGGTGGGAGGAGAAAGAGG - Intergenic
998333158 5:141347038-141347060 AGGAAGGAGGAAAGAGAGAGAGG - Intronic
998333164 5:141347070-141347092 AGGAAGGAGGAAAGAGAGAGAGG - Intronic
998333169 5:141347098-141347120 AGGAAGGAGGAAAGAGAGAGAGG - Intronic
998595670 5:143527333-143527355 TAGAAGGTGGGAGGAGGGAGAGG + Intergenic
998600857 5:143583460-143583482 CAGAAAGAGGAAGAATAGAGGGG + Intergenic
999070486 5:148738720-148738742 AAGAAGGAGGGAGGAGAAAGCGG + Intergenic
999111855 5:149128374-149128396 AATAAGGTGGAAGCAGAGAAGGG + Intergenic
999184769 5:149698865-149698887 AAGGAGAGGGAAGGAGAGAGCGG + Intergenic
999188850 5:149731627-149731649 AGGGAGGTGGGAGGAGAGAGAGG + Intronic
999578489 5:153007594-153007616 AGGAAGGTGGAAGGGTAAAGAGG - Intergenic
999598538 5:153234095-153234117 AAGGAGGTGGGATGATAGGGAGG - Intergenic
999921747 5:156329149-156329171 CGGAAGGGGGAAGGATACAGAGG + Intronic
1000341306 5:160279205-160279227 AAGCAGGATGAAGGATGGAGGGG + Intronic
1000603008 5:163297319-163297341 AGGAAGGTGGGAGGAAAGTGAGG + Intergenic
1000607885 5:163343915-163343937 AAGAAGATGAAAGGATATTGAGG - Intergenic
1001012629 5:168112361-168112383 TAGAGGGTGGGAGGAGAGAGAGG - Intronic
1001341754 5:170853207-170853229 AACAAGGGGTAAGGAAAGAGTGG + Intergenic
1001947231 5:175789829-175789851 CAGAAGGTGGAAGGACAAAAGGG - Intergenic
1003060989 6:2862287-2862309 TGGAAGGTGGAAGGCAAGAGAGG - Intergenic
1003457179 6:6293709-6293731 AAGAAGGAAGAAGGAAAGAAGGG + Intronic
1003548212 6:7079050-7079072 AAGAGGAAGGAAGGAGAGAGAGG + Intergenic
1003940121 6:11016142-11016164 AAGAAGGAAGAAGGAAATAGAGG - Intronic
1004282397 6:14292193-14292215 CAGAAGGTGGGAGGAGAGAAAGG + Intergenic
1004370603 6:15049062-15049084 AAGCAGCTGGATGGATAGAATGG + Intergenic
1004887303 6:20063371-20063393 ACAAAGGAGGAAGGATAGAGAGG + Intergenic
1005040077 6:21593707-21593729 AAGACTGTGAAAGGATAAAGAGG + Exonic
1005089522 6:22042261-22042283 AAGGAGGGGGAAGGAGAGGGAGG - Intergenic
1005283242 6:24297314-24297336 TAGAGGGTGGGAGGAGAGAGAGG + Intronic
1005315651 6:24600297-24600319 AATAAGATGGATGGATGGAGGGG + Intronic
1005891610 6:30144862-30144884 AAGAAGGTGGCAGGCTGGTGTGG - Intronic
1006113354 6:31762077-31762099 AAGAAGGTGGGAGGAGTAAGGGG - Intronic
1006189476 6:32198808-32198830 AAGATAGGGGAAGGAGAGAGGGG - Intronic
1006264572 6:32908810-32908832 AAGAAAATGGAAGGATTCAGAGG - Intergenic
1006276675 6:33009718-33009740 GAGAAGGTGGAAGGATTCACTGG + Intergenic
1006698092 6:35948904-35948926 CAGAAGGTGGAAGGACAAAAGGG - Intronic
1006945915 6:37784448-37784470 AAGAGGGTGGAGGGAGAGGGAGG + Intergenic
1007270065 6:40629544-40629566 AATAAGGTGGTAGGATGGACAGG - Intergenic
1007354528 6:41303111-41303133 CAGAAAGAGGAAGGATTGAGAGG - Intergenic
1007869951 6:45023757-45023779 TTGAAGGTGGAAGGAGGGAGAGG + Intronic
1008255511 6:49295163-49295185 AAGAGGGTGGGAGGAGGGAGAGG + Intergenic
1008989511 6:57586602-57586624 AAAATGGTGGAAGAAAAGAGAGG + Intronic
1009178095 6:60485158-60485180 AAAATGGTGGAAGAAAAGAGAGG + Intergenic
1009341681 6:62562660-62562682 AAGAAGACTGAGGGATAGAGAGG - Intergenic
1009382613 6:63051778-63051800 TGGAAGGTGGGAGGAGAGAGAGG - Intergenic
1009464135 6:63950771-63950793 AAAGAGGTTGAGGGATAGAGAGG - Intronic
1009508398 6:64516301-64516323 TGGAAGGTGGAAGGAGGGAGAGG + Intronic
1010769190 6:79809067-79809089 AGGAAGGTGAGAGAATAGAGAGG + Intergenic
1010889028 6:81282959-81282981 ATGAAGGTGGGAGGAGGGAGAGG + Intergenic
1010927790 6:81764599-81764621 AAGAAGGATGAAGGAAAGAAAGG - Intergenic
1011162464 6:84406821-84406843 TAGAAGGTGGAAGAAGGGAGTGG + Intergenic
1011568064 6:88701152-88701174 AAGAAGGTAGATGGATAGAGGGG + Intronic
1011614283 6:89183866-89183888 GAGAAGGTGGGAGGAGAGTGAGG + Intronic
1011798443 6:90982967-90982989 AAGAAGGTGGGAGGTGAGATGGG - Intergenic
1011960957 6:93089318-93089340 GAGAAGGTGGAAGGAGGGAGTGG + Intergenic
1012257110 6:97047019-97047041 GAGAAATTGGAAGTATAGAGTGG + Intronic
1012349310 6:98231843-98231865 TACAAGGTGGCAGGAGAGAGAGG + Intergenic
1012541090 6:100362716-100362738 AAGAAGAGGAAAGGAGAGAGAGG - Intergenic
1012945067 6:105456658-105456680 CCAAAGGTGGAAGGATAGTGAGG - Intergenic
1013122222 6:107150958-107150980 ATGGAGGTGGAAGGATAAACAGG + Intergenic
1013874460 6:114806312-114806334 AAGAAGAAGGAAGGAAAGAATGG - Intergenic
1014647107 6:123987771-123987793 AAGAAGGGGGAGGGGGAGAGTGG - Intronic
1014998737 6:128188491-128188513 AGGAAGGAGGTAGGATTGAGAGG - Intronic
1015088422 6:129325127-129325149 AAAAATGTGGGAGGGTAGAGAGG - Intronic
1015247636 6:131092457-131092479 AAAAAGATGGAAGGATAGATAGG + Intergenic
1015277894 6:131403541-131403563 AAGGAGGTTGAGGGATAGTGAGG - Intergenic
1015474021 6:133638814-133638836 TGGAAGGTGGAAGGAGGGAGAGG - Intergenic
1016002397 6:139055415-139055437 ATAAAGGTGGAAGTTTAGAGAGG + Intergenic
1016017147 6:139198335-139198357 AAGAAGGAGAAAGGAGAGAAGGG - Intergenic
1016095108 6:140027280-140027302 CGGAAGGTGGGAGGAGAGAGAGG - Intergenic
1016544137 6:145201691-145201713 AAGAAGAAGGAAGGAGAAAGAGG - Intergenic
1016647070 6:146423004-146423026 AAGAAGAAGGAAGGAGAGAAGGG + Intronic
1016779969 6:147946241-147946263 AAGATGGTAGAGGGATACAGTGG - Intergenic
1017779632 6:157705881-157705903 AAAGAGGTGGAGGGATAGTGAGG + Intronic
1017929919 6:158943410-158943432 AAGAATATGGAAAGAGAGAGGGG - Intergenic
1018609455 6:165633485-165633507 AAGAAGATGGAATAATTGAGGGG + Intronic
1018709746 6:166489771-166489793 ATGTAGATGGAAGGAGAGAGGGG - Intronic
1018865630 6:167745221-167745243 AAGAAAATTGAAGGACAGAGGGG + Intergenic
1019327623 7:446071-446093 AAGAAGGAGGGAGGAGGGAGTGG + Intergenic
1019609363 7:1929169-1929191 GAGGAGGTGGAAGAAAAGAGGGG - Intronic
1019625241 7:2012593-2012615 AGGAAGGAGGATGGACAGAGGGG + Intronic
1020735495 7:11944160-11944182 TAGAGGGTGGGAGGAGAGAGAGG - Intergenic
1021297829 7:18930837-18930859 TAAAAAGTGGAAGGAAAGAGTGG - Intronic
1021585283 7:22201252-22201274 CAGAGGGTGGAAGGAGAGAAAGG - Intronic
1021927005 7:25543522-25543544 AGGAAGATGGAAGGACAGACAGG - Intergenic
1022015165 7:26343384-26343406 AAGAAAGCGGAAGGTCAGAGGGG - Intronic
1022651951 7:32285689-32285711 AAGAAGAAAGAAGGAGAGAGGGG + Intronic
1022788162 7:33659896-33659918 ATGAAGGTGCAAGGCCAGAGGGG - Intergenic
1023237730 7:38107979-38108001 AAGAAGGTGGGAGGGACGAGAGG - Intergenic
1023256615 7:38318779-38318801 ATGAAGATGGAAGGACAGGGAGG - Intergenic
1023464548 7:40439692-40439714 AAGAAGGTAGAAGCATCCAGTGG + Intronic
1023967633 7:44971126-44971148 AAGAAGGAGGAAGGAAAGCAGGG + Intronic
1024324634 7:48099482-48099504 GAGAAGGGGGAAGAACAGAGGGG + Intronic
1024392166 7:48827684-48827706 AAGAAGAAAGAAGGATAGCGGGG + Intergenic
1024422520 7:49185639-49185661 CAAAAGGTGGGAGGATAGAAAGG + Intergenic
1024744391 7:52389707-52389729 AAGCAGGTGGATTGATAGAATGG + Intergenic
1025176980 7:56807036-56807058 CAGAAGGTGGAAGGATCCATTGG - Intergenic
1025694812 7:63769350-63769372 CAGAAGGTGGAAGGATCCATTGG + Intergenic
1025852347 7:65253792-65253814 AAAAAGATGGATGGATGGAGAGG - Intergenic
1026110545 7:67455686-67455708 AAGAAAGAGGAAGGAGAGAAAGG - Intergenic
1026127698 7:67594107-67594129 GAGAAGGAGGCAGGAAAGAGGGG - Intergenic
1026227656 7:68456864-68456886 AAAATGGGGGAGGGATAGAGAGG + Intergenic
1026494083 7:70887913-70887935 AAGAAGGTAGAGGGAAGGAGGGG + Intergenic
1026909014 7:74081853-74081875 AAAAAAGGGGAAGGAAAGAGAGG - Intergenic
1027960984 7:84944823-84944845 AAGGAGGGGGAAGGAAAGAAAGG + Intergenic
1028477712 7:91268279-91268301 AAGAAGGTGGAATAATTGACGGG + Exonic
1028689911 7:93640527-93640549 AAAGAGGTTGAAGGATAGTGAGG - Intronic
1028715905 7:93968000-93968022 AAGAAAATGGAAGGATAAAATGG - Intronic
1029040422 7:97567112-97567134 CAGAAGGTGGAAGGGGAGAAAGG - Intergenic
1029088059 7:98026707-98026729 AGGAAGGGGGAAGGAAAGAAAGG - Intergenic
1029240195 7:99155300-99155322 ATGAAGGTGGGAGTATAGACTGG - Intergenic
1029924545 7:104301931-104301953 AAGAAGGAGGAAGGAAAGAGAGG + Intergenic
1030019882 7:105262899-105262921 CAGTTGGTGGAAGTATAGAGTGG + Intronic
1030134960 7:106237854-106237876 AAGGAGGTGGAGGTATGGAGTGG + Intergenic
1030305104 7:108009715-108009737 AAGAAGGTGGCAGGATCCAATGG + Intergenic
1030559244 7:111064355-111064377 AAGGAGGTGGATTGATAGAATGG + Intronic
1030620184 7:111781165-111781187 AAGAAGATGGAAGAATGGAGAGG + Intronic
1030675068 7:112375836-112375858 GGGTGGGTGGAAGGATAGAGAGG - Intergenic
1030735540 7:113043511-113043533 AGGGAGGTGGCAGGAAAGAGGGG + Intergenic
1030996799 7:116369241-116369263 AAGCGGGAGGAAGGATGGAGAGG - Intronic
1031209790 7:118808372-118808394 GAGGAGGTGGAAGGGGAGAGAGG + Intergenic
1031339421 7:120580421-120580443 CAGAAGGTGGAAGGGAAGATGGG - Intronic
1031478037 7:122246765-122246787 CACAAGGTGGCAGGAGAGAGAGG - Intergenic
1032089977 7:128906647-128906669 AGGAAGGAGGAAGGAAAGACTGG + Intronic
1032976540 7:137230840-137230862 ATGAAGATGGAAGTAAAGAGGGG - Intronic
1033472978 7:141665653-141665675 AGAAAGGTGGAAGGACAGAAAGG - Intronic
1033656576 7:143379523-143379545 AATAAGGTTGAAGGAAAGAGAGG + Intergenic
1033723797 7:144090669-144090691 CAGAAGGTGAGAGGAGAGAGAGG - Intergenic
1034422285 7:150996187-150996209 GAGAAGGAGGAAGGGTACAGGGG - Intronic
1034821479 7:154220422-154220444 GGGAAGGTGGGAGGAGAGAGAGG + Intronic
1034858561 7:154576985-154577007 AAGGCAGTGGAAGGGTAGAGTGG + Intronic
1034995103 7:155572055-155572077 AGGAAGGAGGAAAGATAGAAGGG + Intergenic
1035774506 8:2177932-2177954 TAGAGGGTGGAAGGAGGGAGAGG - Intergenic
1036141448 8:6212799-6212821 AAGAAGGTGGAGGGACAAAAGGG + Intergenic
1036371871 8:8169258-8169280 AAAGAGGTGGAGGGATAGTGAGG - Intergenic
1036497624 8:9283830-9283852 AAGAAGCTGGAAGGAAGGAGGGG - Intergenic
1036774667 8:11602337-11602359 AAGAAGGGGGAGAGAAAGAGGGG - Intergenic
1036879031 8:12496386-12496408 AAAGAGGTGGAGGGATAGTGAGG + Intergenic
1036900218 8:12664801-12664823 AAGGAGGTGGAAGGAGTGAGAGG + Intergenic
1036924679 8:12892782-12892804 AAGAAACTCAAAGGATAGAGAGG - Intergenic
1037023257 8:14000254-14000276 TGGAAGGTGGAAGGAAAGAAAGG - Intergenic
1037359581 8:18059073-18059095 AAAAAAGGGGAAGGAGAGAGAGG - Intronic
1037615849 8:20518429-20518451 AAGAAGGAGGCAGGATAGGAGGG + Intergenic
1037771994 8:21807310-21807332 AGGAAAGTGGAAGGCAAGAGAGG - Intronic
1038069970 8:24002956-24002978 AAGCAGGTTGAAGGATAGATAGG + Intergenic
1038322338 8:26538984-26539006 TAGAAGGGGGAGGGATGGAGGGG - Intronic
1038356212 8:26831778-26831800 AAGAAGATGCAAGGATGGAAAGG - Intronic
1038401336 8:27287087-27287109 CAGAAGGCGGAAGGAGGGAGGGG - Exonic
1039009029 8:33073060-33073082 AAGAAGAAGGAAAGAAAGAGAGG + Intergenic
1040984369 8:53278001-53278023 AAGAAACTCAAAGGATAGAGAGG - Intergenic
1042421127 8:68590258-68590280 AAGATGGAGGAAGGAAAGAAAGG + Intronic
1042524035 8:69746048-69746070 AAGAAGGTGGAAGGAAGAGGAGG - Intronic
1042544201 8:69936162-69936184 AAGAATTTGGAAGGTCAGAGTGG - Intergenic
1042595331 8:70440982-70441004 AAGAAAGAGGAAAGATAGAAAGG + Intergenic
1042616990 8:70660600-70660622 AAGATGGTGGAATGAGAGTGTGG - Exonic
1042753089 8:72179719-72179741 TACAAGGTGGAAGCATAAAGAGG + Intergenic
1042892823 8:73631989-73632011 AAGAAGGGGGGAGGAGAGGGAGG + Intronic
1043267737 8:78287617-78287639 TAGAGGGTGGGAGGATGGAGTGG - Intergenic
1043296381 8:78668142-78668164 GAGAAGGAGGAAGGAGAGAAAGG - Intronic
1043554571 8:81416135-81416157 TGTAAGGTGGAAGGAGAGAGAGG + Intergenic
1043948768 8:86284290-86284312 AAGAAAGTGGGAGGAGAAAGGGG + Intronic
1044085788 8:87940592-87940614 AAGAAGCTGGAAAGATGCAGGGG + Intergenic
1044194358 8:89356468-89356490 AAGTGGGTGGTAGGATAAAGTGG + Intergenic
1044313255 8:90719929-90719951 AAGAAGGTAGAAGGAAATAGTGG - Intronic
1044425530 8:92045694-92045716 AAGGAGATTGAAGGATTGAGAGG - Intronic
1045091803 8:98753475-98753497 TGGAAGGTGGAAGGAGGGAGAGG + Intronic
1045133254 8:99182326-99182348 ATGAAGGAGGAAGGATTGATTGG + Intronic
1045189477 8:99868788-99868810 ATAAATGTGGAAGGAGAGAGAGG + Intronic
1045194001 8:99911659-99911681 AACATGGTGGAAGGTCAGAGGGG + Intergenic
1045574612 8:103406763-103406785 ATGAAGGTGGAAAAACAGAGAGG - Intronic
1045682729 8:104679935-104679957 AAGAAGGAGGAAGGAAGGAAGGG - Intronic
1045875956 8:106980862-106980884 AAGAAGGAGGAAGGGAAGGGAGG + Intergenic
1046195351 8:110856715-110856737 CAGAGGGTGGAAGGAGAGTGAGG + Intergenic
1046592726 8:116225441-116225463 TGGAAGGTGGAAGGGCAGAGGGG - Intergenic
1046705406 8:117444465-117444487 GAGAAGGTGGAAGGAAAGCAAGG + Intergenic
1046751027 8:117926629-117926651 AGGAAACTGGAAGGAGAGAGGGG + Intronic
1046931939 8:119850129-119850151 AAAAAGATGGAAGGATAGAAAGG + Intronic
1047250454 8:123178360-123178382 ATGATGGTGGAAGGAAAGACTGG + Intergenic
1047254824 8:123207103-123207125 GAGAAGGGGGAAGGATGGGGAGG - Intronic
1047598979 8:126407591-126407613 AAGAAGGAAGAAAGAAAGAGAGG - Intergenic
1048078322 8:131097554-131097576 TAGAAGGTGGGAGGAGGGAGAGG + Intergenic
1048079234 8:131107006-131107028 GAGCAACTGGAAGGATAGAGTGG - Intergenic
1048408107 8:134143217-134143239 AAGAAGGAAGAAAGAAAGAGAGG - Intergenic
1048457060 8:134587766-134587788 CAGAAGGTGGAAGGGCAGAATGG - Intronic
1048465597 8:134662388-134662410 GAGAAGGTGGAAGAGAAGAGGGG + Intronic
1048869225 8:138783480-138783502 AAAAATGTGGAAGGAGAGACTGG - Intronic
1048940426 8:139395943-139395965 AAGAAGAAGGAAGGATCGGGGGG - Intergenic
1049096273 8:140550133-140550155 GAGGAGGTGGAAGCCTAGAGAGG - Intronic
1049408831 8:142463511-142463533 GGGAAGGAGGAAGGTTAGAGAGG + Intronic
1050258357 9:3816161-3816183 AAGGAGGTCGAGGGATAGTGAGG + Intergenic
1050453110 9:5804795-5804817 GAGAATTTGGAAGGATAGGGAGG + Intronic
1050475924 9:6041022-6041044 AAGGAGGAGGAAGGAGAAAGAGG - Intergenic
1050996380 9:12223971-12223993 AGGAAGGTAGAATGAGAGAGTGG + Intergenic
1051114024 9:13673752-13673774 AAGTAGGAGTAAGGATAGAGAGG - Intergenic
1051345227 9:16145294-16145316 CAGGAGGTGGAAGCAGAGAGGGG - Intergenic
1051762976 9:20489159-20489181 GAGCGGGTGGAAGGGTAGAGAGG + Intronic
1051873408 9:21765393-21765415 AAGGAGGAGGAAGGAAGGAGAGG + Intergenic
1051953635 9:22663454-22663476 AAAAAGGTTGAGGGATAGTGAGG + Intergenic
1052342052 9:27373550-27373572 AAGAAAGTGGGAAAATAGAGAGG - Intronic
1052350402 9:27452859-27452881 CAGAAGCTGGAGGTATAGAGAGG + Intronic
1052540809 9:29809757-29809779 CAAAAGGTGGCAGGAGAGAGAGG - Intergenic
1052876445 9:33570292-33570314 AAGAATGGGGAGGGACAGAGTGG + Intronic
1053499562 9:38574052-38574074 AAGAATGGGGAGGGACAGAGTGG - Intronic
1054763439 9:69023371-69023393 AAGTGGGTGGAAGAACAGAGTGG + Intergenic
1054893267 9:70276671-70276693 AAGAAGATGGATGAATAGATGGG + Intronic
1055460071 9:76511333-76511355 AAGAAGGTGGATGGTTAAAATGG - Intergenic
1055705922 9:79003869-79003891 AAGAAGGTGGAAGAACAGAGAGG - Intergenic
1056247957 9:84717016-84717038 AAGGAGGTGGAAGGGTAGAGGGG + Intronic
1056249093 9:84730104-84730126 AAGAAGATGGAAAGAAAGAAGGG - Intronic
1056587161 9:87936179-87936201 AAGAACGGGGAGGGACAGAGTGG - Intergenic
1056688034 9:88782857-88782879 AAGAATGGGGAAGGGAAGAGTGG + Intergenic
1057093940 9:92287408-92287430 AAGATGGATGAAGGATATAGGGG + Intronic
1057602968 9:96474967-96474989 GAGAAGATGGAAGGATGGAAGGG - Intronic
1057931507 9:99197544-99197566 CAGAAGGTGCAAGGGAAGAGGGG - Intergenic
1058619713 9:106870135-106870157 TAGAAGGACAAAGGATAGAGTGG + Intronic
1058645854 9:107131022-107131044 AAGGAGGTGGAAGGAAAGGCAGG - Intergenic
1058895361 9:109396238-109396260 GAGAAGGCGGAGGGACAGAGTGG + Intronic
1058943500 9:109835346-109835368 GAAAGGGTGGAGGGATAGAGGGG + Intronic
1058944301 9:109841892-109841914 GAGAAGTTGGAAGGATAGAGGGG + Intronic
1058944309 9:109841912-109841934 GGGAGGGTGGAAGGGTAGAGGGG + Intronic
1058944316 9:109841932-109841954 GGGAGGGTGGAAGGAAAGAGGGG + Intronic
1058944332 9:109841973-109841995 GGGAAGTTGGAGGGATAGAGGGG + Intronic
1058947566 9:109873045-109873067 AAGAAAGAGGAAGGAAAGAGTGG + Intronic
1059262209 9:112988518-112988540 AAGAAAATGGAATGATAGACTGG - Intergenic
1059534920 9:115071611-115071633 CAGAAGGTGGAATGATTGAGGGG + Intronic
1059574305 9:115473816-115473838 AAAGAGGTTGAAGGATAGTGAGG - Intergenic
1059882062 9:118702225-118702247 AAAAAAGTGGCAGCATAGAGTGG - Intergenic
1059931087 9:119261863-119261885 AAGAAGGAGGAGGGAAAGAGAGG - Intronic
1059976030 9:119718188-119718210 AAGAAAGTGAAGGGAGAGAGTGG + Intergenic
1060417875 9:123445381-123445403 AAGGAGGTGGAAGGTTTGAAAGG + Intronic
1061899688 9:133666533-133666555 AAGGAGGGGGAAGGAAAAAGGGG - Intronic
1061942525 9:133891347-133891369 ATGAAGGGGGAGGGATAAAGGGG + Intronic
1061942590 9:133891522-133891544 ATGGAGGGGGAAGGATGGAGAGG + Intronic
1061942661 9:133891700-133891722 ATGAAGGGGGAGGGATGGAGGGG + Intronic
1062050647 9:134444782-134444804 AGGGAGGGGGAAGGAGAGAGAGG - Intergenic
1062097881 9:134712180-134712202 AAGAAGGGGGCAGGAAGGAGGGG - Intronic
1062097893 9:134712210-134712232 AAGAAGGGGGCAGGAAGGAGGGG - Intronic
1062164552 9:135100851-135100873 AGGTAGGTCGATGGATAGAGAGG + Intronic
1203427921 Un_GL000195v1:58494-58516 AAAAAGGTGGAGGCAAAGAGAGG - Intergenic
1203707284 Un_KI270742v1:63985-64007 AAGAATGGGGAGGGACAGAGTGG + Intergenic
1203548113 Un_KI270743v1:144585-144607 AAGAACGGGGAGGGACAGAGTGG - Intergenic
1185689458 X:2141444-2141466 AAGAAGATGGGAGGAGGGAGAGG + Intergenic
1186072081 X:5833023-5833045 AAGAAAGAGGAAAGACAGAGGGG - Intergenic
1186279687 X:7978398-7978420 AAGCAGCTGGATTGATAGAGTGG + Intergenic
1186471532 X:9825841-9825863 ATGAGGGTGGAAAGCTAGAGGGG + Intronic
1186957546 X:14699982-14700004 TGGAGGGTGGAAGGACAGAGAGG + Intronic
1187047830 X:15665331-15665353 TAGAGGGTGGGAGGAGAGAGAGG + Intergenic
1187505398 X:19874787-19874809 AAGAGGGTGGAAGGGGAGAGGGG + Intronic
1187526506 X:20059732-20059754 AAAAAGAAGGAAGGAAAGAGAGG + Intronic
1187546359 X:20256385-20256407 AAGAGGATGCAAAGATAGAGAGG + Intronic
1187765649 X:22638644-22638666 AGGAAGGTGGTAAGATACAGAGG + Intergenic
1188005665 X:25014226-25014248 AAGAAGAAAGAAGGAGAGAGGGG - Intronic
1188484655 X:30669576-30669598 TAAAAGGTGGAAGCATAGTGTGG + Intronic
1188513554 X:30961539-30961561 AAGAAGGTAGATGGAGAAAGAGG + Intronic
1188735190 X:33704298-33704320 TGGAAGGTGGGAGGAGAGAGAGG - Intergenic
1188969129 X:36591677-36591699 TAGAAGGTGGGAGGAGGGAGAGG - Intergenic
1188972306 X:36632836-36632858 AAGAAGAGGGAAGAATATAGGGG - Intergenic
1189212487 X:39295669-39295691 ACCAAGGTGGAAGGATACTGAGG + Intergenic
1189302227 X:39960347-39960369 ATGAAGGTGGAAGGGTGGTGTGG - Intergenic
1189516918 X:41721828-41721850 AAGCAAATGGAAGGAAAGAGAGG - Intronic
1189582568 X:42422755-42422777 CATAGGGTGGAAGGAGAGAGAGG + Intergenic
1189952699 X:46248726-46248748 TGGAAGGTGGGAGGAAAGAGAGG + Intergenic
1189970004 X:46408372-46408394 AAGAGGGAGGAGGGATGGAGTGG + Intergenic
1190077626 X:47329411-47329433 CAGAAGGTGGCAGGGTACAGTGG + Intergenic
1190311856 X:49122555-49122577 AAGAAGGTGGAAGGATAGAGTGG - Intronic
1190457385 X:50639355-50639377 AAGAAGGAGAGATGATAGAGGGG + Intronic
1191147463 X:57183064-57183086 CAGAAGGTGGGAGGATAGAGAGG + Intergenic
1191178858 X:57537848-57537870 AAGAAGCTGTAACAATAGAGTGG - Intergenic
1191719066 X:64214432-64214454 AAGCAGTTGGAATGATAGAACGG - Intergenic
1192305466 X:69954808-69954830 TGGAAGGTGGGAGGATGGAGAGG - Intronic
1192444810 X:71202979-71203001 AAAAAGGTGAAAGGATTGGGAGG + Intergenic
1192627416 X:72744764-72744786 AACAAAGTGGGAGGATATAGGGG - Intergenic
1192654292 X:72976049-72976071 AACAAAGTGGGAGGATATAGGGG + Intergenic
1192940809 X:75909847-75909869 AAAAATGTGGAAGGAGAGATTGG + Intergenic
1193318072 X:80087856-80087878 TAGAGGGTGGGAGGACAGAGAGG - Intergenic
1193324131 X:80159493-80159515 TAGAAGGTGAAAGGATGAAGAGG + Intergenic
1193626326 X:83825384-83825406 TAAAGGGTGGAAGGAGAGAGAGG + Intergenic
1193773380 X:85614762-85614784 TGGAAGGTGGGAGGAGAGAGAGG - Intergenic
1194030595 X:88808973-88808995 GGGAGGGTGGAAGGAGAGAGAGG - Intergenic
1194250451 X:91568302-91568324 AAGAAATTGGAATGATTGAGGGG - Intergenic
1194511877 X:94806692-94806714 TAGAAGGTGGGAGAAGAGAGAGG - Intergenic
1194541230 X:95175269-95175291 AGAAAGGTGGAAGGAGGGAGAGG + Intergenic
1194637568 X:96364284-96364306 TAGAAAGTGGAAGGATAGTAGGG + Intergenic
1194755367 X:97732824-97732846 AAGAAGCTGGAAGGATTTTGAGG + Intergenic
1194786517 X:98091470-98091492 TGGAAGGTGGGAGGAGAGAGAGG - Intergenic
1194942442 X:100027253-100027275 AAGAAGGAAGAAGGAGAGAGAGG + Intergenic
1195294592 X:103463501-103463523 AAGAAGGAGGAGGGAGAGGGAGG + Intergenic
1195318227 X:103699524-103699546 AGGAAAGTTGAAGGACAGAGTGG + Intergenic
1195439991 X:104888533-104888555 AGGAAGCAGGAAGGATAGATAGG - Intronic
1195468829 X:105210893-105210915 TAACAGGTGGAAGGATGGAGAGG - Intronic
1195783543 X:108490787-108490809 CAGAGGGTGGAAGGATGAAGAGG - Intronic
1195809618 X:108815569-108815591 AAGCAGCTGGATTGATAGAGTGG - Intergenic
1196000484 X:110779102-110779124 ATGAAGGTGGGAGGAGAGAGAGG + Intronic
1196261779 X:113591450-113591472 TAAAAGGAGGAAGGATACAGGGG - Intergenic
1196693934 X:118590903-118590925 AAGTAGGAAGAAGGAAAGAGGGG - Intronic
1197441519 X:126496404-126496426 AAGGAGGTGGAAGGAGAAGGAGG - Intergenic
1197597547 X:128484310-128484332 AGGAGGGTGGAATGAGAGAGAGG - Intergenic
1197654945 X:129106750-129106772 AGGAAGGTGGCAGGGAAGAGGGG - Intergenic
1197958355 X:131977320-131977342 AAGAAGGGGAAAAGATAGAATGG + Intergenic
1198075020 X:133185706-133185728 AGGAAGGGGAAAAGATAGAGTGG - Intergenic
1198426903 X:136529648-136529670 TTGAAGGTGGAAGGAGGGAGAGG + Intergenic
1199208572 X:145178834-145178856 AGGAAGGTGGAATGAAAGAAGGG - Intergenic
1199279878 X:145988972-145988994 GAGAAGGCGGAAAGAAAGAGAGG + Intergenic
1199466457 X:148143343-148143365 AAGAAGGTGGAATGCCAAAGGGG - Intergenic
1199943767 X:152649512-152649534 AAGATGGTGGAGAGATAGATAGG + Intronic
1200089079 X:153625978-153626000 AAGGAGGTGGAAGGAGAGTTGGG + Intergenic
1200105835 X:153711602-153711624 AAGAACATGGAAAGAAAGAGAGG + Intronic
1200340299 X:155389362-155389384 AAGAAGCTGGATTGATAGAATGG - Intergenic
1200569402 Y:4809548-4809570 AAGAAATTGGAATGATTGAGGGG - Intergenic
1200959839 Y:8986571-8986593 AGGAAGCAGGAAGGATAGATAGG - Intergenic
1201065572 Y:10091924-10091946 GAGAAGGGGGGAGGAGAGAGAGG + Intergenic
1201144801 Y:11058296-11058318 AGGTGGGTGGAAGCATAGAGTGG + Intergenic
1201378730 Y:13349307-13349329 AACAAGCAGGAAGGCTAGAGAGG - Intronic
1201964228 Y:19714157-19714179 TAGAAGGTGGGAGGAGAGAGAGG + Intronic
1202019315 Y:20448656-20448678 TAAAAGGTGGAAGGAAAGGGAGG + Intergenic
1202275687 Y:23117259-23117281 AGGAGGGTGGGAGGAGAGAGAGG + Intergenic
1202290341 Y:23303432-23303454 AGGAGGGTGGGAGGAGAGAGAGG - Intergenic
1202365995 Y:24165404-24165426 AAGAAAGAGGAAAGAAAGAGAGG - Intergenic
1202381598 Y:24279432-24279454 CAGAAGGTGGAAGGATCCATTGG + Intergenic
1202428679 Y:24750978-24751000 AGGAGGGTGGGAGGAGAGAGAGG + Intergenic
1202442112 Y:24919111-24919133 AGGAGGGTGGGAGGAGAGAGAGG - Intergenic
1202489187 Y:25390694-25390716 CAGAAGGTGGAAGGATCCATTGG - Intergenic
1202504787 Y:25504719-25504741 AAGAAAGAGGAAAGAAAGAGAGG + Intergenic