ID: 1190311857

View in Genome Browser
Species Human (GRCh38)
Location X:49122564-49122586
Sequence AAGAAGAGGAAGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2865
Summary {0: 1, 1: 5, 2: 42, 3: 365, 4: 2452}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190311857_1190311865 -6 Left 1190311857 X:49122564-49122586 CCTTCCACCTTCTTCCTCTTCTT 0: 1
1: 5
2: 42
3: 365
4: 2452
Right 1190311865 X:49122581-49122603 CTTCTTCCTTCAATGGGGAAGGG 0: 1
1: 0
2: 1
3: 17
4: 249
1190311857_1190311864 -7 Left 1190311857 X:49122564-49122586 CCTTCCACCTTCTTCCTCTTCTT 0: 1
1: 5
2: 42
3: 365
4: 2452
Right 1190311864 X:49122580-49122602 TCTTCTTCCTTCAATGGGGAAGG 0: 1
1: 0
2: 0
3: 29
4: 224
1190311857_1190311868 1 Left 1190311857 X:49122564-49122586 CCTTCCACCTTCTTCCTCTTCTT 0: 1
1: 5
2: 42
3: 365
4: 2452
Right 1190311868 X:49122588-49122610 CTTCAATGGGGAAGGGTAAAGGG 0: 1
1: 0
2: 2
3: 23
4: 255
1190311857_1190311869 2 Left 1190311857 X:49122564-49122586 CCTTCCACCTTCTTCCTCTTCTT 0: 1
1: 5
2: 42
3: 365
4: 2452
Right 1190311869 X:49122589-49122611 TTCAATGGGGAAGGGTAAAGGGG 0: 1
1: 0
2: 1
3: 17
4: 251
1190311857_1190311867 0 Left 1190311857 X:49122564-49122586 CCTTCCACCTTCTTCCTCTTCTT 0: 1
1: 5
2: 42
3: 365
4: 2452
Right 1190311867 X:49122587-49122609 CCTTCAATGGGGAAGGGTAAAGG 0: 1
1: 0
2: 0
3: 12
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190311857 Original CRISPR AAGAAGAGGAAGAAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr