ID: 1190311864

View in Genome Browser
Species Human (GRCh38)
Location X:49122580-49122602
Sequence TCTTCTTCCTTCAATGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 224}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190311855_1190311864 3 Left 1190311855 X:49122554-49122576 CCCACTCTATCCTTCCACCTTCT 0: 1
1: 0
2: 2
3: 56
4: 646
Right 1190311864 X:49122580-49122602 TCTTCTTCCTTCAATGGGGAAGG 0: 1
1: 0
2: 0
3: 29
4: 224
1190311857_1190311864 -7 Left 1190311857 X:49122564-49122586 CCTTCCACCTTCTTCCTCTTCTT 0: 1
1: 5
2: 42
3: 365
4: 2452
Right 1190311864 X:49122580-49122602 TCTTCTTCCTTCAATGGGGAAGG 0: 1
1: 0
2: 0
3: 29
4: 224
1190311856_1190311864 2 Left 1190311856 X:49122555-49122577 CCACTCTATCCTTCCACCTTCTT 0: 1
1: 0
2: 8
3: 76
4: 1003
Right 1190311864 X:49122580-49122602 TCTTCTTCCTTCAATGGGGAAGG 0: 1
1: 0
2: 0
3: 29
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190311864 Original CRISPR TCTTCTTCCTTCAATGGGGA AGG Intronic
900786157 1:4652036-4652058 GCTTCTTCAGTCTATGGGGACGG - Intergenic
901764462 1:11491063-11491085 TTTTCCTCCATCCATGGGGAGGG - Intronic
901990675 1:13110804-13110826 TATTCTTTCTTCAATGGAGATGG - Intergenic
903178959 1:21595996-21596018 TGTTCTTCCTGCAGTGGGGAAGG + Intergenic
904398076 1:30236435-30236457 TCCTCCTCCTCCAATGGAGATGG + Intergenic
906292152 1:44626309-44626331 TCTGCTTCCATCAAGAGGGAAGG + Exonic
906926093 1:50118479-50118501 TTTTTTTCCTTCAAATGGGAGGG - Intronic
911352754 1:96774173-96774195 TTTTCTTCTTTTAATGGTGAGGG + Intronic
912798112 1:112705069-112705091 ACTTCCTCCTTCCCTGGGGAGGG + Intronic
914718873 1:150272900-150272922 TCTTCTACCATAAATGGGGTGGG + Intronic
918715018 1:187775011-187775033 TACTCTTCCTTGTATGGGGACGG - Intergenic
920567216 1:206983712-206983734 TCTTCCTTCCTCAATGGTGAGGG + Intergenic
920939619 1:210469380-210469402 TCATCTCCCTTCAATGTGGCTGG - Intronic
922317732 1:224457338-224457360 TCTCCTTCCTTCAGTAGGGGCGG - Intronic
923012703 1:230101344-230101366 TTTTCTTCCTTCAAGGGGACAGG + Intronic
923262345 1:232279304-232279326 TCTTCTTGGTTCTGTGGGGAAGG - Intergenic
924098945 1:240583982-240584004 TCTTGTTCCTTGTGTGGGGAGGG - Intronic
1063354822 10:5388180-5388202 TGTTCTTCCTTCAGTGGTTATGG - Intergenic
1065498511 10:26354864-26354886 TCTTGGTCCTTTAATGAGGAGGG - Intergenic
1065977631 10:30857124-30857146 TCATTTTCCTTCAAAGGGCAGGG + Intronic
1067507790 10:46871473-46871495 TCTTCTTCCTCCATGGGGTATGG - Intergenic
1067654461 10:48180372-48180394 TCTTCTTCCTCCATGGGGTATGG + Intronic
1068293585 10:55037148-55037170 TTTTCTTCTTTCTATTGGGAGGG - Intronic
1068819929 10:61363138-61363160 TCTTTTTCCTTCCATGGCAAGGG + Intergenic
1070589504 10:77791805-77791827 TTTTCCTCCCACAATGGGGAAGG - Exonic
1072549340 10:96465601-96465623 TCCTCCTCCTTTAATGAGGAAGG + Intronic
1073004942 10:100316137-100316159 TCTTCTGCCTTCAAGGAGTAAGG - Intronic
1073586943 10:104719588-104719610 CCTTCTCCGTTAAATGGGGATGG + Intronic
1073978644 10:109129025-109129047 TTGACTTTCTTCAATGGGGATGG + Intergenic
1075733947 10:124652757-124652779 TCCACTTCCTTCAATATGGAAGG + Intronic
1077812065 11:5648169-5648191 TCTTCTTCCTAGAATGTGGATGG - Intergenic
1078471300 11:11589048-11589070 TTTTCTTCCATCAGTTGGGAAGG - Intronic
1078657513 11:13255494-13255516 GCCTCTTCCTTCACTGTGGAGGG - Intergenic
1084716620 11:70878361-70878383 TTTTCTCCCTTCTATGTGGAGGG - Intronic
1087476630 11:98644063-98644085 CTTTCTTCCTTCAATGGAGTTGG - Intergenic
1089440600 11:118513427-118513449 TGTTCTTCCTTTAAGAGGGAAGG + Intronic
1095539584 12:43293541-43293563 TCCTCTGCCTTCTGTGGGGAAGG + Intergenic
1096245583 12:49983667-49983689 TCTTCCTCCTCCCAGGGGGATGG + Intronic
1096310883 12:50519493-50519515 TTTTCTTCCTTGAATTGAGATGG + Intronic
1096815699 12:54200464-54200486 TCTTCTGTCTTCAATGCTGAGGG - Intergenic
1101866079 12:108520549-108520571 TCTTCTGCCTCCCAGGGGGATGG - Exonic
1102277750 12:111597196-111597218 TCTGCTGCCTTCAAAGGGGGCGG - Intronic
1102679081 12:114678400-114678422 TCTTCTTCCCACCAAGGGGAAGG - Intronic
1105759916 13:23504123-23504145 TTTTCTACCTTCTAAGGGGAAGG + Intergenic
1106295856 13:28413087-28413109 ACTTCTTGCCTCAATGGAGAAGG + Intronic
1107348003 13:39483805-39483827 CCCTCTTCCTTCCATGGGGAGGG + Intronic
1108465701 13:50713529-50713551 TCTTCTTCCTGAAATGAGAAGGG + Intronic
1110003820 13:70239866-70239888 TCCTCTTCCATCAGTGGGGTGGG - Intergenic
1110319263 13:74141664-74141686 TTTTCTTCCTACTATGGAGAGGG - Intergenic
1110714495 13:78685692-78685714 TTTTCTTCTTCCACTGGGGATGG + Intergenic
1111161348 13:84398853-84398875 TGCTCTTCCTTAAATGGTGATGG - Intergenic
1112676704 13:101710162-101710184 TGTTTATCCTTCAATGGGTAGGG + Intronic
1113188622 13:107718374-107718396 TCTTCTTCCTTTAATGAGGCAGG - Intronic
1113661560 13:112109711-112109733 TCCTTTTCTTTCAATGGGGCAGG + Intergenic
1115862698 14:37706329-37706351 TCTTCCTGCTTCCCTGGGGATGG + Intronic
1116117032 14:40666937-40666959 CCTTCTTTCTCCAATAGGGAGGG + Intergenic
1116252624 14:42506246-42506268 TCTTCTGGCTTTATTGGGGAGGG - Intergenic
1117045570 14:51810076-51810098 TCTTCTTTCTGGAATGGCGATGG - Intergenic
1117825965 14:59703983-59704005 TTTTCTTCCTTCTGAGGGGAAGG + Intronic
1117945797 14:61018915-61018937 TCCTCCCCCTTCAATGGGGCAGG - Intronic
1119075076 14:71629479-71629501 TCTTCTTCCATTCATGGGGAGGG - Intronic
1119161538 14:72456696-72456718 TGTTCTTTCTTCTCTGGGGAAGG + Intronic
1121491872 14:94366845-94366867 TCTTATTCTTTCAATGATGATGG - Intergenic
1122392955 14:101402942-101402964 TCCTCTTCCGTGAATGGGAATGG - Intergenic
1123723021 15:23076552-23076574 TTTTCTTCCTTCATTTGGGAGGG + Intergenic
1123991271 15:25685335-25685357 TCTGCACCCTTCAATGGGGAGGG + Intronic
1125077743 15:35639161-35639183 TCTTCTTCCTTTTATGGAGACGG - Intergenic
1125080793 15:35670506-35670528 TTTTCTTCCTTCCATAAGGATGG - Intergenic
1125431210 15:39595631-39595653 TCTACTTGCTTCAGTTGGGAAGG + Exonic
1127123635 15:55791953-55791975 TCTGCTTCCTGCAATGGGGCTGG - Intergenic
1127756443 15:62097136-62097158 TCACCTTTCTACAATGGGGAAGG - Intergenic
1128060526 15:64732678-64732700 TCTGCTGCCCTCAAGGGGGAAGG - Intergenic
1128170547 15:65508352-65508374 TCTTTGTCCTTTATTGGGGAAGG + Intronic
1128243772 15:66119045-66119067 TGTTCTGCCCTCAGTGGGGAAGG - Intronic
1128508093 15:68292936-68292958 TCTTCTTGCTTCAGTTAGGAAGG + Exonic
1128579452 15:68798640-68798662 TCCTCTTGCTTCAAGGAGGATGG - Intronic
1128924691 15:71644289-71644311 TCTTCTTCCTTCAATTGGTTAGG + Intronic
1129280562 15:74481523-74481545 GCTTCTGCCTTCAATGGTGCGGG + Intergenic
1129880541 15:79003695-79003717 TCTTCCTGCTCCCATGGGGAAGG - Intronic
1130940389 15:88503367-88503389 TCTTCTTCCTTGTAGGTGGATGG - Intergenic
1133233684 16:4378065-4378087 TCTTCACCCTGCACTGGGGAGGG - Intronic
1135108042 16:19668016-19668038 TCTTCCTTCTTCAAAGGAGAGGG - Intronic
1135664557 16:24325024-24325046 TCTTGGTTCTTCAAAGGGGATGG - Intronic
1137579106 16:49622544-49622566 TCTTCATCCTTCAATGCCCAGGG + Intronic
1137796514 16:51224663-51224685 TCTTCATCCATGAATGGGGTGGG - Intergenic
1138996267 16:62456821-62456843 TTTTCTTCCTTCGTGGGGGAAGG - Intergenic
1139198141 16:64944831-64944853 TGTTCTTCCTTCAATTTGGAAGG + Exonic
1139961480 16:70720594-70720616 TGTTCTTCCTTCAGAGGGAAAGG + Intronic
1141009853 16:80387257-80387279 TCTTCTTCCTTGAGTGGGGTGGG + Intergenic
1141035326 16:80621141-80621163 TCTTCTGCCTTCTCCGGGGATGG - Intronic
1141880598 16:86856530-86856552 TCTTGTCTCTTCCATGGGGATGG - Intergenic
1143492479 17:7292459-7292481 TCTTCTTCCTTCTATAGTCAAGG + Intronic
1145246527 17:21273298-21273320 GCTTCCTCCTCCAGTGGGGAGGG - Intergenic
1146002523 17:29139862-29139884 TCTTCCTCCTTGAGAGGGGATGG - Intronic
1146889394 17:36496255-36496277 TCTTCTGCCTTCACTGGGCTGGG - Exonic
1150007219 17:61477229-61477251 GGTCCTGCCTTCAATGGGGAGGG + Intronic
1151429312 17:74051714-74051736 TCCTGTTCCTCCACTGGGGAAGG - Intergenic
1152551387 17:81032142-81032164 CCTTCTTCCTGCACTGGGGGTGG - Intergenic
1155586222 18:27368999-27369021 TCTTCTTAATTTATTGGGGAAGG - Intergenic
1156113208 18:33753506-33753528 TCTTCATTCTTCAATGAAGAAGG + Intergenic
1156687608 18:39668914-39668936 CCTTCTTCCTACAAGGGGGAAGG + Intergenic
1161981107 19:7630857-7630879 TCTTCTTCCTGCCAGAGGGATGG + Intronic
1164378349 19:27709592-27709614 CTTTCTTCCTTCAATGTGTATGG + Intergenic
1165303451 19:34988123-34988145 TTTTCTTCCTTCTCTGGGAATGG + Intergenic
1167906517 19:52665128-52665150 TATTCTTCATTCACTGGGGTGGG + Intronic
1168721145 19:58555681-58555703 GCTTCTTACTTCTATGGGGTGGG - Intergenic
925358693 2:3262137-3262159 TCTTCTTTCTTCATTGGGATAGG - Intronic
927875821 2:26654542-26654564 TCTTCTGCCTTCTAAGGGGGTGG + Intergenic
930521076 2:52468320-52468342 TCTTCTTCTTGCAAAGGAGAGGG - Intergenic
930977910 2:57487072-57487094 TCTTCTGCCTTCCATGGATATGG + Intergenic
932448292 2:71793968-71793990 TCTTCTTCCTAGACTTGGGAGGG + Intergenic
933090202 2:78108750-78108772 TGTCCTTCCTTAAATGGTGAAGG + Intergenic
933188013 2:79300464-79300486 TCTTCTCTCTCCAATGGGGAAGG + Intronic
935819533 2:106880735-106880757 TGTTCTTCCTTCAGTTGGAAGGG + Intronic
936998796 2:118442588-118442610 TCTTTTTCCTGCAATGCCGATGG + Intergenic
940020386 2:149150189-149150211 TCTTCTTGCGTTAATGTGGATGG + Intronic
940565408 2:155353885-155353907 TCTTCCTCCTTAAGTGGGGCAGG - Intergenic
940777782 2:157902769-157902791 TCTTCTTCCTTCCAGAAGGAAGG + Intronic
940908669 2:159191195-159191217 TGTTCTTCCTTAAATGTAGATGG + Intronic
943096441 2:183435269-183435291 TCTTCTTGCTTAAATTGGGCAGG - Intergenic
943541914 2:189226428-189226450 TCTACTTGCTTCAATGTGGCTGG - Intergenic
945011200 2:205465754-205465776 TCCCATTCCTTCAATGGGGCAGG - Intronic
945103845 2:206289481-206289503 TCTTCTTGGTTCTATGAGGAAGG + Intronic
946445846 2:219739259-219739281 TCTTCTGGCTTCAGTGAGGAAGG + Intergenic
948925835 2:241096707-241096729 TATTTTTCTTTAAATGGGGAAGG + Intronic
1168773170 20:428871-428893 CCTTCTCCCTGCCATGGGGAGGG + Intronic
1170309674 20:14978632-14978654 CCTTCTTCCTTTCATGGGGTGGG - Intronic
1172130959 20:32654836-32654858 TCTTCTTCTTTTTTTGGGGAAGG - Intergenic
1173442199 20:43087731-43087753 TCTTCATCTTTCAAAAGGGAGGG + Intronic
1173618864 20:44421188-44421210 TCTTCATCCTGCAATGTGAAGGG - Intronic
1174149734 20:48477705-48477727 TCTGCTGCCTTCTATGGGTAAGG + Intergenic
1179961180 21:44767684-44767706 TCTGCTTCCTGGGATGGGGAGGG - Intergenic
1180868282 22:19132243-19132265 TCTGCCTCCTTCAAGAGGGAGGG + Exonic
1181911286 22:26240273-26240295 TCTCCTTCCATCAAAGAGGAGGG - Intronic
1182391627 22:30002043-30002065 TCTTCTTTTTTCAATAGTGAAGG - Intronic
1183192055 22:36327898-36327920 GCTCCTTCCTTCAGTGGGGATGG - Intronic
1183697455 22:39431272-39431294 TTCTCTGCCTTCAGTGGGGAGGG + Exonic
1184442810 22:44528701-44528723 TCCTCCTCCTACAATGGGGAGGG + Intergenic
1184959390 22:47917987-47918009 TCTTCTTCCTTCAGTTAGGAAGG + Intergenic
949965373 3:9351543-9351565 TCTTCTTCCCTCAGGGAGGAGGG - Intronic
950443280 3:13022212-13022234 TCTTCTTCCTACCATGAAGAAGG - Intronic
952263471 3:31762982-31763004 TCTTCTTTCTTCTAGGGGGAAGG - Intronic
952469257 3:33628389-33628411 TCTTCTTCCTTATTGGGGGAAGG - Intronic
956253857 3:67263283-67263305 TCCTCTTCCTTCAACAGGGAGGG + Intergenic
956728383 3:72175524-72175546 TCCTCTTCCCTAAATGGGCAGGG + Intergenic
957021691 3:75135287-75135309 TCCTCTTCCTAGTATGGGGAGGG + Intergenic
957040215 3:75330504-75330526 TCTTCTTCCTTCAGGTGGGGAGG + Intergenic
958163870 3:89853877-89853899 TCTTCTTCCTTTGCTGGAGATGG + Intergenic
959383965 3:105678422-105678444 TCTTCTTCCTTCAGGTAGGAGGG - Exonic
960029316 3:113041738-113041760 TCTCCTTCCTTGCTTGGGGAAGG + Intergenic
960188008 3:114668082-114668104 TCTTCTTCCTTAAATGTAAAGGG + Intronic
961045010 3:123702084-123702106 TCTTCTTCCTTCAGGTGGGGAGG + Intronic
961114502 3:124317216-124317238 TCGTCTTCCCTCAAGGGAGAGGG + Intronic
963554530 3:146771640-146771662 TCTTCTTCCTTCATTGATTAGGG - Intergenic
963573910 3:147034507-147034529 TCTTCATCCTTCCATAGGTAAGG - Intergenic
963717287 3:148818138-148818160 TTTTCCTCTTTCAATTGGGATGG + Intronic
964287280 3:155132037-155132059 GTTTCTTCCTAGAATGGGGAAGG + Intronic
964703613 3:159595334-159595356 TATTCCTGCTTCAATGGTGAAGG + Intronic
965002581 3:162974186-162974208 TCCTCTTACCTCAATGTGGATGG - Intergenic
965171155 3:165265875-165265897 CCTTCTTCCTTTTTTGGGGACGG + Intergenic
965659775 3:171029052-171029074 TCTTCTTCCATAAATGAGGAGGG + Intergenic
966134747 3:176685698-176685720 TATTCTACCTTCAATGAAGATGG + Intergenic
966242784 3:177773373-177773395 TCCTCTTTTGTCAATGGGGATGG - Intergenic
970231255 4:13913504-13913526 TCTTCTTTCTGCAGTTGGGAGGG - Intergenic
972076692 4:35099040-35099062 TTTTCTCCCTTCCATAGGGAAGG + Intergenic
972123088 4:35729913-35729935 TTTACTTCCTTCCAAGGGGAAGG - Intergenic
972332600 4:38077905-38077927 TCTGCTTCCTGCGATGGGGTAGG + Intronic
972746061 4:41934018-41934040 TCTTCTGCCTTAAAACGGGAAGG - Intergenic
973136531 4:46715013-46715035 TATTCTTCCTTCAGTTGAGAAGG + Intergenic
977954477 4:103011292-103011314 CCTTCTGCATACAATGGGGAAGG + Intronic
980037882 4:127905701-127905723 TCTTATTCCTTCATTAGGAATGG - Intergenic
981572549 4:146168144-146168166 TCTTCCACCTTCAATGCAGATGG - Intergenic
982199828 4:152949551-152949573 TCTTCTTCCTTCAAAGGATATGG + Intronic
986016198 5:3759448-3759470 TTTTCTTACATCAATGGGGTTGG + Intergenic
987076708 5:14389470-14389492 TCTGCTTAATTCAATGGGAATGG - Intronic
987257245 5:16168659-16168681 TCTCCTTCTTTCCATGGGGCTGG + Intronic
988459778 5:31424182-31424204 TCATCTTCCCTCAGTGAGGAAGG - Intronic
990685838 5:58300091-58300113 TATTTTTCCTTCTATGTGGAAGG - Intergenic
992017176 5:72587354-72587376 TCTTCTTCCTTGAATATGCAAGG + Intergenic
992649031 5:78839073-78839095 TCTTCTTTTGTAAATGGGGAAGG + Intronic
993638455 5:90373576-90373598 TCTTCTTCCAGGAATGTGGAAGG - Intergenic
995644543 5:114296345-114296367 GCTTCTTCCTTCCATCAGGATGG - Intergenic
996654154 5:125917473-125917495 TTTTCTCCCTTCAGTGGGAATGG - Intergenic
996703600 5:126474549-126474571 TCTTGTTCATGGAATGGGGAAGG + Intronic
997312219 5:132896576-132896598 TCTTCTTCCTCCACTGAGGAGGG + Exonic
998205944 5:140157054-140157076 TTTTTTTCCTTGAATGGGGGTGG - Intergenic
999214969 5:149925090-149925112 TTATCTTCCTCCAAAGGGGATGG - Intronic
1000282154 5:159791550-159791572 TCTGCTTCTTTGAAGGGGGATGG + Intergenic
1000446266 5:161325673-161325695 TTTTCCTCCTTCAATTTGGAGGG + Intronic
1000607251 5:163338342-163338364 TCATCTGCCTTGAGTGGGGAGGG - Intergenic
1001400291 5:171442357-171442379 TGGTCTGCCTTCAGTGGGGAAGG + Intronic
1002079607 5:176729516-176729538 TCTTCCTCCTTCCCTGGGGTGGG - Intergenic
1003649915 6:7949853-7949875 ACTTCTTTCTTGAATGGGAAAGG - Intronic
1004295113 6:14403133-14403155 TCTTCTTCATTGAATGAGGATGG - Intergenic
1004630757 6:17418879-17418901 TTTTTTTCCTTCAATTGCGATGG + Intronic
1006700916 6:35972447-35972469 TCTTCTTCATTCCATGGGAGTGG - Intronic
1009972949 6:70644224-70644246 TCTTCCTCCTTCAAGGTTGATGG + Intergenic
1010288279 6:74105201-74105223 TCTTCTTCCTTCACTGTTAAAGG + Intergenic
1014139291 6:117921775-117921797 TTTTCTTCCATCATTGTGGAAGG - Intronic
1014307201 6:119757759-119757781 TCATTTGCCTTCAATTGGGATGG + Intergenic
1015751408 6:136563506-136563528 TCCTCTTCCTTCTAAGGGGGCGG + Intronic
1015933259 6:138383529-138383551 TTTGCTTCCTTGAATGGGGGAGG + Intergenic
1016631353 6:146236588-146236610 TCTTCTCCCTTCAATAGGCTGGG + Intronic
1017162045 6:151374291-151374313 TCTGCTTCCTTCCTTGTGGAGGG + Intronic
1018181640 6:161228332-161228354 ACATCTTCCTTGAATGGGGAAGG - Intronic
1020613883 7:10434610-10434632 TCTTCTTGCTTCAATCATGATGG + Intergenic
1020649860 7:10861093-10861115 TCTTATGTCTTCAATGGTGAAGG - Intergenic
1024287743 7:47773931-47773953 CCTTATTACTTCACTGGGGAAGG + Intronic
1025828291 7:65028620-65028642 TCTTCTCCATAAAATGGGGATGG - Intergenic
1025915817 7:65865053-65865075 TCTTCTCCATAAAATGGGGATGG - Intergenic
1027801826 7:82762810-82762832 TCTTCTTCCTTCTGTAGAGATGG + Intronic
1027890125 7:83962790-83962812 CCTTCCTCCTTAAATGGGGAAGG - Intronic
1028681392 7:93538406-93538428 TCTTCCACCTTCAGTGGAGATGG + Intronic
1029317545 7:99728132-99728154 CCATCTTCCTTGAGTGGGGAGGG - Intronic
1029542876 7:101194820-101194842 TATTTTTCCTTCACTGGGGATGG + Intergenic
1030569794 7:111208785-111208807 TTTTTTTTCTTCAATGGGGTTGG + Intronic
1031466271 7:122116153-122116175 GCTTTTTCATTCAGTGGGGATGG + Intronic
1032652833 7:133897209-133897231 TCTTCTTGCTGGAATGAGGAAGG - Intronic
1034686338 7:152974547-152974569 ACTTCCTCTCTCAATGGGGAAGG + Intergenic
1034719647 7:153278646-153278668 ATTTCTTCCTTCAATTGTGAGGG - Intergenic
1035143387 7:156787095-156787117 TCTTCCTCTATCAATGGGCAAGG + Intronic
1035472885 7:159121324-159121346 TCCTCTCCCTTCACAGGGGATGG + Intronic
1036010129 8:4712873-4712895 TCTTCTTCCATCCATCGGCATGG - Intronic
1037296943 8:17411910-17411932 TCTTCCTCCTTCCATGATGAAGG - Intronic
1041830041 8:62143698-62143720 TCTTCATCATGGAATGGGGATGG + Intergenic
1045438601 8:102188532-102188554 TCAGTTTCCTTCACTGGGGATGG - Intergenic
1045962864 8:107989138-107989160 TCTTCTTCCTTCGAAGAGAAGGG - Exonic
1046339079 8:112827840-112827862 TCTTCTGCCTCCTATGGAGAGGG - Intronic
1046581817 8:116102631-116102653 TCCTCTTCCATCAAGAGGGATGG + Intergenic
1046584764 8:116137711-116137733 TCTTTTTCCATGTATGGGGATGG - Intergenic
1048223716 8:132565714-132565736 TCATCTTTCTTCAGTGGGGGTGG + Intergenic
1049031761 8:140043467-140043489 TCTTCCTGCTTCCATGGGAAGGG + Intronic
1049068262 8:140336823-140336845 TCTTCTTCCTTCCATCGTCACGG - Intronic
1050304624 9:4295900-4295922 TCATCTTCCTTGAATGAGAATGG + Intronic
1051870236 9:21728347-21728369 TATCCTTCCTTCAATATGGAGGG - Intergenic
1053557663 9:39154700-39154722 TGTTCCTCCTTCACTGGGGGAGG - Intronic
1053724224 9:40981093-40981115 TCTTCTTTCTTCAATTTTGATGG - Intergenic
1053821779 9:41974988-41975010 TGTTCCTCCTTCACTGGGGGAGG - Intronic
1054139451 9:61464251-61464273 TGTTCCTCCTTCACTGGGGGAGG + Intergenic
1054341746 9:63870908-63870930 TCTTCTTTCTTCAATTTTGATGG + Intergenic
1054608791 9:67212420-67212442 TGTTCCTCCTTCACTGGGGGAGG + Intergenic
1055707400 9:79020665-79020687 TCTTCTTCCTTTAATAGTGATGG - Intergenic
1059060575 9:111031844-111031866 TCTCCTTCCTTAAAAGGGAAAGG + Intronic
1060299512 9:122366824-122366846 TCTTCTTCCAGCAATTGTGAGGG + Intergenic
1060374378 9:123105480-123105502 TCTTCTTCCTGCTATGGAGAAGG - Intergenic
1061633410 9:131889004-131889026 TCTTGTTACTTCTAGGGGGAAGG - Intronic
1061787291 9:133037444-133037466 TATTCTGCCTTCTAAGGGGATGG + Intronic
1187368174 X:18681819-18681841 TCTTCTTGCAGCAAAGGGGAAGG - Intronic
1190311864 X:49122580-49122602 TCTTCTTCCTTCAATGGGGAAGG + Intronic
1190879736 X:54483749-54483771 TGTCCTTCCTGCGATGGGGAAGG - Intronic
1196121695 X:112058139-112058161 TATTCTTTCTTCACTGGGTAGGG - Intronic
1197572288 X:128163884-128163906 TCTGCTTCCTTCAAAGGGTCTGG + Intergenic
1199919160 X:152379138-152379160 TCTTTTGCCATCAATGGGTATGG - Intronic
1200215330 X:154365709-154365731 TCTTCTTCTTGGAAGGGGGAGGG - Intronic