ID: 1190311865

View in Genome Browser
Species Human (GRCh38)
Location X:49122581-49122603
Sequence CTTCTTCCTTCAATGGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 249}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190311857_1190311865 -6 Left 1190311857 X:49122564-49122586 CCTTCCACCTTCTTCCTCTTCTT 0: 1
1: 5
2: 42
3: 365
4: 2452
Right 1190311865 X:49122581-49122603 CTTCTTCCTTCAATGGGGAAGGG 0: 1
1: 0
2: 1
3: 17
4: 249
1190311856_1190311865 3 Left 1190311856 X:49122555-49122577 CCACTCTATCCTTCCACCTTCTT 0: 1
1: 0
2: 8
3: 76
4: 1003
Right 1190311865 X:49122581-49122603 CTTCTTCCTTCAATGGGGAAGGG 0: 1
1: 0
2: 1
3: 17
4: 249
1190311855_1190311865 4 Left 1190311855 X:49122554-49122576 CCCACTCTATCCTTCCACCTTCT 0: 1
1: 0
2: 2
3: 56
4: 646
Right 1190311865 X:49122581-49122603 CTTCTTCCTTCAATGGGGAAGGG 0: 1
1: 0
2: 1
3: 17
4: 249
1190311858_1190311865 -10 Left 1190311858 X:49122568-49122590 CCACCTTCTTCCTCTTCTTCCTT 0: 2
1: 32
2: 277
3: 1646
4: 7228
Right 1190311865 X:49122581-49122603 CTTCTTCCTTCAATGGGGAAGGG 0: 1
1: 0
2: 1
3: 17
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190311865 Original CRISPR CTTCTTCCTTCAATGGGGAA GGG Intronic
900389563 1:2428070-2428092 CTTCCTGATTCAATGGGGACAGG + Intronic
900946162 1:5832431-5832453 CTTCTCCCTTCCCTGGAGAAGGG - Intergenic
901151743 1:7107935-7107957 CTTCTTCCTACACTTGAGAAGGG + Intronic
903178960 1:21595997-21596019 GTTCTTCCTGCAGTGGGGAAGGG + Intergenic
906750459 1:48253991-48254013 CTTCTTCCTTAAAAGAGGAGAGG + Intergenic
906820577 1:48925935-48925957 ATGCCTCCTTCAATGGGGGATGG - Intronic
910811720 1:91244445-91244467 CTTCTTCCTTAAATGTGTTAAGG - Intergenic
912798113 1:112705070-112705092 CTTCCTCCTTCCCTGGGGAGGGG + Intronic
913531970 1:119740080-119740102 CTTGTTTCTGCACTGGGGAAGGG - Intronic
914717465 1:150264577-150264599 CTTCTTCCTGGAAAGGGGAATGG - Exonic
920228475 1:204455030-204455052 TTTCTTCCTTTAATGGGAACTGG + Intronic
923012704 1:230101345-230101367 TTTCTTCCTTCAAGGGGACAGGG + Intronic
923175698 1:231462464-231462486 CTTCATCCTGCAGTGGTGAATGG - Intergenic
924353148 1:243138786-243138808 CTTCTACTGTCAATGGGAAAGGG + Intronic
924896738 1:248346215-248346237 CCTCTTCTTTCAATGGGGGCCGG + Intergenic
1062925200 10:1311174-1311196 ATTTCTCCTTCCATGGGGAATGG + Intronic
1063270841 10:4508678-4508700 ATTCTCCCTTCAATGTGGAATGG - Intergenic
1065843919 10:29729137-29729159 CTTCTTCCTCCTAAGGGAAATGG + Intronic
1067062876 10:43086973-43086995 CTTCTGCCGTGAGTGGGGAAGGG - Intronic
1067543544 10:47175473-47175495 CCTCTTCCCACAGTGGGGAAGGG - Intergenic
1068916966 10:62443214-62443236 CTTCTTCCTTCTGAGGTGAAAGG + Intronic
1069857413 10:71448930-71448952 CTTTTTCCTGCCATGGGGAGTGG + Intronic
1069865873 10:71502523-71502545 CTTCTACCTTCAAGGGGTGATGG + Intronic
1071928589 10:90439824-90439846 CTTCTTCCATCAAGGGGAAAAGG - Intergenic
1072549342 10:96465602-96465624 CCTCCTCCTTTAATGAGGAAGGG + Intronic
1072567976 10:96633981-96634003 CTTCTTCCCTCCTTGGTGAAGGG + Intronic
1073307756 10:102516457-102516479 TTTCTTCCTTCATGGGGTAAGGG + Intronic
1073743789 10:106442188-106442210 CTTGTTCCTTTATTGGAGAATGG + Intergenic
1074292277 10:112147083-112147105 TTTCTTTCTACAATGGGAAATGG - Intergenic
1075198053 10:120378294-120378316 CTGCTACCATCAATGCGGAAAGG + Intergenic
1075262860 10:120977991-120978013 ATTCTGACTTCACTGGGGAAGGG + Intergenic
1075723712 10:124601239-124601261 CTGCTTCCTTGAAAGGGGCAAGG - Intronic
1077459980 11:2704180-2704202 CTTCTTCCTTCACTGGTCATAGG + Intronic
1077856933 11:6136596-6136618 CTTCTACATACAGTGGGGAAAGG + Intergenic
1083703841 11:64499689-64499711 CATCTTCTCTCACTGGGGAAAGG - Intergenic
1087125627 11:94623142-94623164 TTTCTTCCTTCAAAGTAGAACGG + Intergenic
1087804647 11:102542763-102542785 CTTATACCTTCAAGGGTGAATGG - Intergenic
1087820848 11:102710357-102710379 CATCCTCATCCAATGGGGAATGG + Intergenic
1089440601 11:118513428-118513450 GTTCTTCCTTTAAGAGGGAAGGG + Intronic
1090269852 11:125378465-125378487 CTGCTTCTTCCAATGGGGACAGG - Intronic
1092498843 12:9025760-9025782 TTTCCTTCTTCCATGGGGAAGGG - Intergenic
1092983024 12:13816812-13816834 CTTCCTCTTTTATTGGGGAACGG + Intronic
1094713099 12:32985330-32985352 CATCTTCCTTCTTTGTGGAAAGG + Intergenic
1095539586 12:43293542-43293564 CCTCTGCCTTCTGTGGGGAAGGG + Intergenic
1097216171 12:57414886-57414908 CTGATTCCTTGAATGGGGAATGG - Intronic
1098236239 12:68421128-68421150 CTTCTTCCTTCAATAGAGGGAGG - Intergenic
1099439873 12:82686946-82686968 CTTCTCACTTCACTGGAGAAGGG + Exonic
1100595987 12:96072608-96072630 CTGCTTCCATCCATGGGGCAAGG + Intergenic
1102475397 12:113185383-113185405 CTTCTTCCTCCACTGGGCCATGG + Exonic
1102679080 12:114678399-114678421 CTTCTTCCCACCAAGGGGAAGGG - Intronic
1103891418 12:124241761-124241783 CTGAGCCCTTCAATGGGGAAGGG + Intronic
1104381683 12:128313004-128313026 CCTCTTCCTTCCATGAGGAGAGG - Intronic
1105699044 13:22921711-22921733 CATTACCCTTCAATGGGGAAGGG + Intergenic
1106295857 13:28413088-28413110 CTTCTTGCCTCAATGGAGAAGGG + Intronic
1106492611 13:30241075-30241097 ATTCTTCCTTCCCTGGGGATAGG + Exonic
1108075956 13:46680045-46680067 CTGCTGCCTTCTATGGTGAAAGG + Intronic
1108288147 13:48929071-48929093 CTTCCTGCTTCAATCGGGATTGG + Intergenic
1110398610 13:75063605-75063627 TTTCTTCCTGCAATCAGGAATGG + Intergenic
1110625539 13:77651610-77651632 CTGGTTCCTTCTATGGGGGATGG - Intergenic
1110636272 13:77769824-77769846 CTTTTTTCTCCAATGTGGAAGGG + Intergenic
1111373649 13:87351147-87351169 TTTCTGCCTTCATGGGGGAATGG - Intergenic
1111659995 13:91197548-91197570 TTTCTGCCTTCAATTCGGAATGG + Intergenic
1113044028 13:106134683-106134705 CTGCTCCTTTTAATGGGGAAGGG - Intergenic
1115524879 14:34269972-34269994 CTAGTTCCTTTAATGGGAAATGG + Intronic
1117954326 14:61111104-61111126 CTTCCTGCTTCACTGGGGGAAGG - Intergenic
1118106272 14:62663575-62663597 CTTCTGACTTCAATTGGGCATGG - Intergenic
1119920126 14:78439016-78439038 TTACTTTCTTCAGTGGGGAAAGG + Intronic
1120826030 14:88956393-88956415 CTTCTTCATGCAATAGGCAAAGG - Intergenic
1121708073 14:96015617-96015639 CAAGTTCCTTAAATGGGGAATGG + Intergenic
1122415457 14:101547538-101547560 CTTCTTCCATTAATTGGGCAAGG - Intergenic
1122840243 14:104457890-104457912 CATCACCCCTCAATGGGGAAGGG + Intergenic
1124894940 15:33767612-33767634 CTTCTGCCCTGAATGGGGTAAGG + Intronic
1125117237 15:36108856-36108878 CTGCTTCTTTTACTGGGGAATGG + Intergenic
1125128743 15:36256488-36256510 CTCCTTCCTGCTATGGAGAAAGG - Intergenic
1126930065 15:53637922-53637944 CTGATTCCTTCAATGGGGGGTGG + Intronic
1127123634 15:55791952-55791974 CTGCTTCCTGCAATGGGGCTGGG - Intergenic
1128170548 15:65508353-65508375 CTTTGTCCTTTATTGGGGAAGGG + Intronic
1128243771 15:66119044-66119066 GTTCTGCCCTCAGTGGGGAAGGG - Intronic
1129280563 15:74481524-74481546 CTTCTGCCTTCAATGGTGCGGGG + Intergenic
1130844551 15:87732842-87732864 CATCTCTCTTAAATGGGGAATGG + Intergenic
1131445227 15:92493314-92493336 GTTCTTTCTTCATTTGGGAAGGG - Intronic
1131498268 15:92934256-92934278 TTTCTTCCTTTATTGGGAAAAGG - Intronic
1131810713 15:96170144-96170166 CTTCCTCCTCCTATGAGGAAGGG - Intergenic
1131891224 15:96973460-96973482 CTTCTTGCTTCAAAGGGGTGAGG - Intergenic
1132094046 15:98968994-98969016 CTCATTCATTCACTGGGGAAAGG + Intronic
1135255933 16:20941682-20941704 TTTCTGCCTCCAGTGGGGAAAGG + Intronic
1135731306 16:24897255-24897277 CTTCTTCCTTAAAAAGGCAAAGG - Intronic
1138944154 16:61827720-61827742 CTGCTTACCTCAATGGGGGAGGG - Intronic
1138996266 16:62456820-62456842 TTTCTTCCTTCGTGGGGGAAGGG - Intergenic
1139043259 16:63026494-63026516 CTTCTTCCTTCAAGGTCAAATGG - Intergenic
1139730891 16:68944372-68944394 CTTTTCCCTTCAGTTGGGAAAGG - Intronic
1140694391 16:77517916-77517938 TTTCTTCCTACTTTGGGGAAGGG - Intergenic
1140963888 16:79945024-79945046 CTCCTCCCATCAAAGGGGAAGGG - Intergenic
1142281565 16:89150865-89150887 CTTCTTTCTTTCATGGTGAATGG - Intronic
1143874077 17:9978805-9978827 CTTCTTGCTTCAATGGGCCATGG + Intronic
1145246526 17:21273297-21273319 CTTCCTCCTCCAGTGGGGAGGGG - Intergenic
1146411100 17:32586084-32586106 CTTCTCTGTTCAATGGGGAAAGG - Intronic
1146762750 17:35492574-35492596 CTTATTCCTTCATAGAGGAAGGG - Intronic
1148375545 17:47141989-47142011 CTTCTTCGTGAAATGGGGAAAGG - Exonic
1149298985 17:55286855-55286877 CTTCTTCCTTCCATGATGGAAGG + Intronic
1149489212 17:57070111-57070133 ATTCTTCCCTCCATGGAGAAAGG + Intergenic
1149802066 17:59579077-59579099 CTTCTTCCATTAATGGTTAATGG + Intronic
1149844424 17:59996412-59996434 CTTCTTCCATTAATGGTTAATGG - Intergenic
1150739172 17:67765785-67765807 TTTGTTCCTTCATTCGGGAAGGG + Intergenic
1151862834 17:76778282-76778304 TTTCTTTCTTCACTGTGGAATGG + Exonic
1152551386 17:81032141-81032163 CTTCTTCCTGCACTGGGGGTGGG - Intergenic
1153771051 18:8416676-8416698 CTTCCTGCTTCCAGGGGGAAAGG + Intergenic
1156390917 18:36649748-36649770 CTTCTTACTGCAATGCTGAAAGG - Intronic
1158624334 18:59058384-59058406 CGTCTAGCTTCAGTGGGGAATGG + Intergenic
1158923048 18:62215514-62215536 CATATTCCTTCAAAGAGGAAGGG + Intronic
1159889629 18:73941615-73941637 CTTCTTTCTTCAAGGATGAATGG - Intergenic
1165978057 19:39694360-39694382 CTGCTTTCTTCTTTGGGGAAAGG + Intergenic
929742687 2:44620548-44620570 GTTCCTGTTTCAATGGGGAATGG - Intronic
930366680 2:50447874-50447896 CTTCTGCCATCATTGGTGAATGG - Intronic
932113951 2:69027696-69027718 TTTCATCCTTGAATGTGGAAAGG - Intronic
932850354 2:75178524-75178546 GTTTTTTTTTCAATGGGGAAAGG - Intronic
939909823 2:147966635-147966657 CTTCTTGCTTCAATATTGAAAGG - Intronic
940122666 2:150284404-150284426 AATCTTCCTTCAATAGGGTATGG - Intergenic
943608867 2:190008387-190008409 CTTCTTCATTTAATGAAGAAAGG - Intronic
945103846 2:206289482-206289504 CTTCTTGGTTCTATGAGGAAGGG + Intronic
945166892 2:206955982-206956004 CTTCTTCCTTTTATGGTTAAGGG + Intronic
945767370 2:213997671-213997693 CTTCTTCTTTCAATGTGGCCTGG - Intronic
946772105 2:223099597-223099619 CTTCTTCCTTCCCTGGGATAAGG + Intronic
948314441 2:237016355-237016377 CTTCTTGTCTCAATGGTGAAAGG - Intergenic
948434153 2:237941531-237941553 ATTCTTCCTTTAATTGGAAATGG - Intergenic
1168773171 20:428872-428894 CTTCTCCCTGCCATGGGGAGGGG + Intronic
1169568774 20:6884547-6884569 CTTCATCTTTCTATGAGGAATGG - Intergenic
1169780919 20:9309390-9309412 CTTATTCATTCAATGGGTCAAGG - Intronic
1170309673 20:14978631-14978653 CTTCTTCCTTTCATGGGGTGGGG - Intronic
1170565561 20:17601266-17601288 TTTTTTTTTTCAATGGGGAAAGG + Intronic
1170611908 20:17921375-17921397 CTAATTCCTTTAATGGGAAATGG + Intergenic
1171908134 20:30918168-30918190 CTTCTTCGTGAAAGGGGGAAAGG - Intergenic
1172985695 20:38987125-38987147 CTCCTTCCTTCTGTGGGGATTGG + Intronic
1174149735 20:48477706-48477728 CTGCTGCCTTCTATGGGTAAGGG + Intergenic
1174662686 20:52227888-52227910 CTTAGTCCTTCAATGTGGTAAGG + Intergenic
1175672463 20:60917193-60917215 CTTCTTCCTCCAATGTGGCCTGG - Intergenic
1176553435 21:8241607-8241629 CTTCTTCGTGAAAGGGGGAAAGG - Intergenic
1176572357 21:8424631-8424653 CTTCTTCGTGAAAGGGGGAAAGG - Intergenic
1176580266 21:8469191-8469213 CTTCTTCGTGAAAGGGGGAAAGG - Intergenic
1178220552 21:30653117-30653139 CTTCTTTCTCCAATGGTTAATGG - Intergenic
1182270434 22:29149882-29149904 CTTCTTCCTGTGAAGGGGAACGG + Intronic
1203258433 22_KI270733v1_random:158635-158657 CTTCTTCGTGAAAGGGGGAAAGG - Intergenic
949272520 3:2235998-2236020 CATCTTAATTCAATGGAGAAGGG + Intronic
952469256 3:33628388-33628410 CTTCTTCCTTATTGGGGGAAGGG - Intronic
955148815 3:56346834-56346856 CTGCATCCTCCAATGGAGAAAGG + Intronic
955365125 3:58304295-58304317 CTTCTTCCTTCAGAGGAGACAGG - Intergenic
957040216 3:75330505-75330527 CTTCTTCCTTCAGGTGGGGAGGG + Intergenic
957609685 3:82451017-82451039 CATATTCCTTCACTGGGAAAGGG - Intergenic
960231240 3:115230008-115230030 CTTCTTCCTCCCAGGGGGGAAGG + Intergenic
960543148 3:118882650-118882672 CTGCTTCTGTCACTGGGGAAGGG + Intergenic
961045011 3:123702085-123702107 CTTCTTCCTTCAGGTGGGGAGGG + Intronic
962702343 3:138011930-138011952 CTTGTTCCATCAAGGGGGAGAGG - Intronic
965659776 3:171029053-171029075 CTTCTTCCATAAATGAGGAGGGG + Intergenic
966647041 3:182257963-182257985 CTTCTTGCTTCAAAGAGAAATGG - Intergenic
966861275 3:184232117-184232139 CTTCTTCCTGTTATGGGGGATGG + Intronic
967199662 3:187060945-187060967 CTTCTTCCTGTGATGAGGAAGGG - Intronic
970082472 4:12302919-12302941 ATTGATCCTTCCATGGGGAAAGG - Intergenic
971879879 4:32357827-32357849 TTTCTTCCTCCAAAGGGCAAAGG + Intergenic
972076693 4:35099041-35099063 TTTCTCCCTTCCATAGGGAAGGG + Intergenic
972746060 4:41934017-41934039 CTTCTGCCTTAAAACGGGAAGGG - Intergenic
973762531 4:54132430-54132452 CTGATACCTTAAATGGGGAATGG + Intronic
974030778 4:56774339-56774361 TTGCTTCCTTTAATGGAGAAAGG - Intergenic
977954478 4:103011293-103011315 CTTCTGCATACAATGGGGAAGGG + Intronic
978403914 4:108360276-108360298 CTCCTTCCGTCAAGGGGAAAAGG - Intergenic
978856858 4:113403499-113403521 GATCTTCCTTCGATAGGGAAGGG - Intergenic
979248799 4:118541742-118541764 CTTCTACTGTCAATGGGAAAGGG - Intergenic
979408464 4:120343839-120343861 CTTATTTCTGCAATGGAGAAAGG - Intergenic
982199829 4:152949552-152949574 CTTCTTCCTTCAAAGGATATGGG + Intronic
982486745 4:155975545-155975567 TTTCTCCCTTCAAGGGTGAAGGG + Intergenic
982729033 4:158935758-158935780 CTTCAGCCTTCAGTGAGGAAAGG + Intronic
983718099 4:170810341-170810363 TTTCTTGCTTGAATGAGGAAAGG - Intergenic
984875130 4:184360873-184360895 ATTCATTCTTCAGTGGGGAAAGG - Intergenic
986234729 5:5896266-5896288 TTTTTTCATGCAATGGGGAAGGG - Intergenic
987087697 5:14485675-14485697 CTTATTTTTTTAATGGGGAAAGG - Intronic
987411340 5:17618047-17618069 TTTCTTCCATCAATGGCGATAGG - Intergenic
987413763 5:17641366-17641388 TTTCTTCCATCAATGGTGATAGG - Intergenic
988056182 5:26100390-26100412 CTTCACCCAGCAATGGGGAAAGG - Intergenic
989744427 5:44810530-44810552 CTTCTTTCTCAACTGGGGAAGGG - Intronic
990685837 5:58300090-58300112 ATTTTTCCTTCTATGTGGAAGGG - Intergenic
990780124 5:59351312-59351334 CCTCTTCCTACAATGTGCAATGG + Intronic
991175843 5:63686909-63686931 CCTTTTCCTACAATGGGCAAAGG - Intergenic
991638718 5:68732676-68732698 TTTCTTCCTTCAAGGGGAAAAGG - Intergenic
992278271 5:75144474-75144496 TTTATTCAATCAATGGGGAAAGG + Intronic
993137913 5:83993499-83993521 CTTCTTATTTTAATGGAGAATGG - Intronic
993638454 5:90373575-90373597 CTTCTTCCAGGAATGTGGAAGGG - Intergenic
993909985 5:93669639-93669661 CTGCATACTGCAATGGGGAAAGG - Intronic
994198664 5:96948045-96948067 ATTCTTCTTTTATTGGGGAAGGG + Intronic
995609511 5:113893947-113893969 CATCTTACTTCAAAGAGGAAAGG - Intergenic
996549800 5:124718104-124718126 CTTCTTCTTTCAAAGTGGCATGG + Intronic
996703601 5:126474550-126474572 CTTGTTCATGGAATGGGGAAGGG + Intronic
996798446 5:127376455-127376477 CTTCCTCATTCTATTGGGAATGG - Intronic
998334564 5:141360095-141360117 CTTATTCCTCCTATGGGCAAAGG + Intronic
1000718259 5:164674403-164674425 TTTCTTCATTCATTGGTGAAAGG - Intergenic
1000759416 5:165203949-165203971 ATACTTCCTTCAATATGGAAAGG - Intergenic
1001849830 5:174953823-174953845 CATGTTCACTCAATGGGGAATGG - Intergenic
1004295112 6:14403132-14403154 CTTCTTCATTGAATGAGGATGGG - Intergenic
1004934239 6:20491766-20491788 CTTATTCCTTCATAGAGGAAGGG - Exonic
1005485247 6:26293472-26293494 GTTTTTCCTTTCATGGGGAAGGG + Intergenic
1005771307 6:29075326-29075348 CTTATTTCTACAATGGGGAAAGG + Intronic
1005853478 6:29841054-29841076 CTCCTTCCTTCAATTGGGGGTGG + Intergenic
1008078924 6:47174572-47174594 TTTCTTGATTCAATGTGGAAAGG - Intergenic
1010745665 6:79558786-79558808 CTGATTCCTTCTGTGGGGAATGG - Intergenic
1011812052 6:91144224-91144246 CTCATTGCTACAATGGGGAAGGG - Intergenic
1012370010 6:98492781-98492803 CTTCTCCCTTCAAAAGGTAAAGG + Intergenic
1013806501 6:114001954-114001976 GCTCTTCCTTCAGTAGGGAATGG - Intronic
1013887735 6:114989976-114989998 TTTCCTCTTTCCATGGGGAATGG - Intergenic
1014493167 6:122087940-122087962 CTTCTTCTTTCCAGTGGGAATGG - Intergenic
1014815234 6:125928055-125928077 CTTCCTCCGTCAATGGGGTGAGG + Intronic
1015891937 6:137978158-137978180 CTTCTGCCTGTGATGGGGAATGG - Intergenic
1015933260 6:138383530-138383552 TTGCTTCCTTGAATGGGGGAGGG + Intergenic
1018557338 6:165063010-165063032 TTTCTTCCTTTAATGGGCACAGG + Intergenic
1019516981 7:1444497-1444519 CTGTTTCCTTCTCTGGGGAATGG - Intronic
1020718991 7:11717464-11717486 TTTCTGCTTTCCATGGGGAAAGG + Intronic
1021955998 7:25825042-25825064 CTTCTCCCTTCATTGGCAAATGG - Intergenic
1023286754 7:38629369-38629391 CTATTTTCTTCACTGGGGAAAGG - Intronic
1023324682 7:39041061-39041083 CTTCCTCCTTCAATGAGAGATGG + Intronic
1024287744 7:47773932-47773954 CTTATTACTTCACTGGGGAAGGG + Intronic
1024347849 7:48331016-48331038 CTTATTGCATCAAAGGGGAATGG - Intronic
1024846375 7:53648196-53648218 CTGCTTCCACCAATGGTGAAAGG + Intergenic
1024972819 7:55086356-55086378 CTTTTTTCTTCAAAGGGAAAGGG - Intronic
1027726627 7:81813746-81813768 CTTCCACCATGAATGGGGAAGGG - Intergenic
1027890124 7:83962789-83962811 CTTCCTCCTTAAATGGGGAAGGG - Intronic
1029655376 7:101920782-101920804 ATTCTTAATTCAATAGGGAATGG - Intronic
1029974041 7:104815896-104815918 CCTCATTCTTCAAAGGGGAAAGG - Intronic
1030122882 7:106127874-106127896 CTTTTTTTTTCAATGGTGAAAGG - Intergenic
1030346841 7:108443483-108443505 CTTCAGCCTTCAGTGGGGCAGGG - Intronic
1033443552 7:141401276-141401298 TTTATTCCTTCCATAGGGAAAGG + Intronic
1033628446 7:143133557-143133579 CTTCTTCAGTCAATGAGGACTGG - Intronic
1034686339 7:152974548-152974570 CTTCCTCTCTCAATGGGGAAGGG + Intergenic
1034719646 7:153278645-153278667 TTTCTTCCTTCAATTGTGAGGGG - Intergenic
1037141106 8:15521542-15521564 ATTCTTCTTTCAATGTGGTATGG - Intronic
1037296942 8:17411909-17411931 CTTCCTCCTTCCATGATGAAGGG - Intronic
1042191781 8:66194473-66194495 CTTCTTCCTCCAGTGGGCAGAGG - Intergenic
1042647068 8:70998697-70998719 GTGCTTCCTTTAGTGGGGAAAGG + Intergenic
1045359058 8:101415169-101415191 GTTCTTCCTTCCCTGGGGAGAGG - Intergenic
1045592431 8:103613279-103613301 CATCTCCCTTCAATGGGCAGAGG + Intronic
1045724581 8:105157726-105157748 CTTCTTCCTTCAAGGGTCACAGG + Intronic
1046394431 8:113623627-113623649 CTAATTCCTTCAATGGGAATTGG + Intergenic
1047794975 8:128246053-128246075 ATTCTTCCATCAATGGGCACTGG + Intergenic
1048264793 8:132976297-132976319 CTGCATCATTCCATGGGGAAAGG + Intronic
1050799177 9:9587626-9587648 CTAATTCCCTCACTGGGGAATGG + Intronic
1052789723 9:32864172-32864194 CTTCTGCCTTGAATCGGGATTGG - Intergenic
1052839914 9:33284077-33284099 ATTCTTCCTGTATTGGGGAAAGG + Intergenic
1053184076 9:36000285-36000307 TTTTTTCGTTTAATGGGGAATGG - Intergenic
1055153012 9:73025683-73025705 GTTCTTCCTTCCATTGGTAATGG - Intronic
1055707399 9:79020664-79020686 CTTCTTCCTTTAATAGTGATGGG - Intergenic
1055978810 9:81980458-81980480 CTTGTTCCTTTATTGGAGAATGG + Intergenic
1056136759 9:83637360-83637382 CCTCTTCCTTCTATGGAGAGTGG + Intronic
1058072454 9:100615350-100615372 CTTCTTCCTCCAATGTGGCCTGG - Intergenic
1059973596 9:119692826-119692848 ATTCTCCCTTCATTGTGGAATGG + Intergenic
1060374377 9:123105479-123105501 CTTCTTCCTGCTATGGAGAAGGG - Intergenic
1060397288 9:123325147-123325169 CTTCTGCCTTCAATGTGGCTAGG + Intergenic
1061633409 9:131889003-131889025 CTTGTTACTTCTAGGGGGAAGGG - Intronic
1203474627 Un_GL000220v1:140651-140673 CTTCTTCGTGAAAGGGGGAAAGG - Intergenic
1203492245 Un_GL000224v1:118231-118253 CTTCTTCCCACAATAGAGAATGG + Intergenic
1203504868 Un_KI270741v1:60103-60125 CTTCTTCCCACAATAGAGAATGG + Intergenic
1187627838 X:21136348-21136370 CTTGTTCTCTGAATGGGGAAAGG - Intergenic
1187956387 X:24523169-24523191 CTGTTTCCTTCCATGGGGGAAGG + Intronic
1188134071 X:26472434-26472456 CTGCATCCTCCAATGGTGAAAGG - Intergenic
1188587596 X:31796931-31796953 CTTCTTCCATTCATGGTGAAGGG - Intronic
1188922411 X:35993456-35993478 ATTCTTTCTTCTATTGGGAATGG + Intergenic
1190311865 X:49122581-49122603 CTTCTTCCTTCAATGGGGAAGGG + Intronic
1191665378 X:63697014-63697036 CTTTTTCCTGCAGTGGGGAATGG - Intronic
1193290172 X:79763242-79763264 CTTCTTCCTTCAATCTTGGAAGG + Intergenic
1193320656 X:80117542-80117564 CTTCTTTATTAGATGGGGAAGGG - Intergenic
1195454819 X:105055929-105055951 TTTCTTCTTTCAAAGGTGAAAGG + Intronic
1201076157 Y:10190887-10190909 CTTCTTCCTGAAAAGGGGAAAGG - Intergenic
1202193263 Y:22267195-22267217 CTTATTCCTTTAATGGAGCAGGG + Intergenic