ID: 1190311867

View in Genome Browser
Species Human (GRCh38)
Location X:49122587-49122609
Sequence CCTTCAATGGGGAAGGGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 177}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190311857_1190311867 0 Left 1190311857 X:49122564-49122586 CCTTCCACCTTCTTCCTCTTCTT 0: 1
1: 5
2: 42
3: 365
4: 2452
Right 1190311867 X:49122587-49122609 CCTTCAATGGGGAAGGGTAAAGG 0: 1
1: 0
2: 0
3: 12
4: 177
1190311859_1190311867 -7 Left 1190311859 X:49122571-49122593 CCTTCTTCCTCTTCTTCCTTCAA 0: 1
1: 0
2: 18
3: 277
4: 2114
Right 1190311867 X:49122587-49122609 CCTTCAATGGGGAAGGGTAAAGG 0: 1
1: 0
2: 0
3: 12
4: 177
1190311858_1190311867 -4 Left 1190311858 X:49122568-49122590 CCACCTTCTTCCTCTTCTTCCTT 0: 2
1: 32
2: 277
3: 1646
4: 7228
Right 1190311867 X:49122587-49122609 CCTTCAATGGGGAAGGGTAAAGG 0: 1
1: 0
2: 0
3: 12
4: 177
1190311855_1190311867 10 Left 1190311855 X:49122554-49122576 CCCACTCTATCCTTCCACCTTCT 0: 1
1: 0
2: 2
3: 56
4: 646
Right 1190311867 X:49122587-49122609 CCTTCAATGGGGAAGGGTAAAGG 0: 1
1: 0
2: 0
3: 12
4: 177
1190311856_1190311867 9 Left 1190311856 X:49122555-49122577 CCACTCTATCCTTCCACCTTCTT 0: 1
1: 0
2: 8
3: 76
4: 1003
Right 1190311867 X:49122587-49122609 CCTTCAATGGGGAAGGGTAAAGG 0: 1
1: 0
2: 0
3: 12
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190311867 Original CRISPR CCTTCAATGGGGAAGGGTAA AGG Intronic
901913772 1:12481650-12481672 CTTTCAAGGGGGATGGGGAAAGG + Intronic
903982971 1:27203305-27203327 CCTACAATGAGAAAAGGTAAAGG - Intergenic
904967763 1:34391934-34391956 ACTTCAATGGGAAAGGGGAAAGG + Intergenic
905380719 1:37559658-37559680 CCTTCAGCTGGGAAGGGGAAGGG - Intronic
907267746 1:53272970-53272992 CCTGAAAGGGGGAAGGGGAAAGG + Intronic
907587356 1:55633069-55633091 CCTTCAAATGGCAAGGGTCAGGG - Intergenic
907942903 1:59106272-59106294 CCTTCCATGCAGAAGGGCAAGGG + Intergenic
909039281 1:70630219-70630241 CCTTAAATGGTGAAGGCTCAGGG - Intergenic
909820254 1:80052152-80052174 CCTTAAATGGAGAAGGCTTAGGG - Intergenic
910664179 1:89706777-89706799 CTTTCTATGGGGGAGGGGAAGGG - Intronic
910712650 1:90197557-90197579 CCTTCCATGGGGAAGGGGGATGG + Intergenic
911257380 1:95647725-95647747 CCTTCTAAGGTGAAGGATAAGGG - Intergenic
911498462 1:98658710-98658732 CCTCCAGTGTGGCAGGGTAAGGG - Intergenic
911941789 1:104056934-104056956 ACTTCACTGGGGAAGTGCAAGGG + Intergenic
912643596 1:111370203-111370225 CATTCATGGTGGAAGGGTAAAGG - Intergenic
916581688 1:166114942-166114964 CTATCAATGGAGAAGGCTAAAGG - Intronic
916934005 1:169609191-169609213 CATGGGATGGGGAAGGGTAATGG - Intronic
919393806 1:197020720-197020742 GCTTGAAGGGGGAAGGGTGAGGG - Intergenic
920201699 1:204263457-204263479 CCTTCCCTGGGGAAGGGCCATGG + Intronic
920946907 1:210537839-210537861 CTTTCAATTGAAAAGGGTAAAGG - Intronic
921297985 1:213722620-213722642 CCTCCACTGGGGAAGGGAGATGG - Intergenic
1064289508 10:14020818-14020840 CATTCAAGGGGGAAAGGTTAGGG + Intronic
1065286503 10:24192356-24192378 GCTTCAGTGGGAAAGGATAAGGG + Intronic
1069330055 10:67280805-67280827 TCTTCATTGGGGGAGGGAAATGG - Intronic
1071292427 10:84197318-84197340 ACCTCAATGGGGAAGGGTATCGG - Intronic
1073852665 10:107638966-107638988 CCTACAATGGGGCGGGGCAAAGG - Intergenic
1073931844 10:108585456-108585478 CCTTTATTGGGGAAGGGTCTTGG - Intergenic
1077697543 11:4408047-4408069 CAAGCAATGGGGAAGGGGAAAGG + Intergenic
1077907092 11:6543062-6543084 CCTCACATGGGGAAGAGTAAGGG + Intronic
1078548947 11:12267334-12267356 CCAGAAATGGGGAAGGCTAAGGG - Intergenic
1082835863 11:57649778-57649800 CCTTCAATTGGGAAGGGGATGGG + Exonic
1083106189 11:60360736-60360758 CCTCCACTGGCGAAGGGGAAAGG + Intronic
1083659042 11:64243725-64243747 CCAGAAATGGAGAAGGGTAATGG - Intronic
1083666316 11:64276738-64276760 CCTTCTCTGGGGAAGGGAAGGGG + Intronic
1084162527 11:67357467-67357489 CCCTAAATGGGGAAGGGCAAAGG - Intronic
1084893306 11:72247825-72247847 GCTTCACTGGGGAAGGGGTATGG - Intergenic
1085181791 11:74542639-74542661 CCTTAAATGGTGAAGGTTCAGGG - Intronic
1085951073 11:81331934-81331956 CCTTAAGTGGGGAAGGGGACAGG - Intergenic
1086061130 11:82700989-82701011 CCTTCGATGGGGAAGGGTGTTGG - Intergenic
1086993754 11:93333405-93333427 CCTTCCATAGGGAAGGAGAAAGG + Intronic
1087294300 11:96351947-96351969 CAGTCAAGGAGGAAGGGTAAAGG - Intergenic
1090025790 11:123166544-123166566 CCCACACTGGGGAAGGGTCACGG - Intronic
1090417612 11:126551327-126551349 CCTGCGATGGGGCAGGGGAAAGG + Intronic
1091027588 11:132155858-132155880 CCTACAATGGGGATGTGCAAAGG + Intronic
1094778854 12:33765979-33766001 CCTTCAAATGGGAAGGATGAAGG + Intergenic
1095881263 12:47139369-47139391 CCTGCACTGGGGGAGGGTCAGGG + Intronic
1096462977 12:51832866-51832888 CCTGCAGTGGGGAAGGCTGAGGG - Intergenic
1099698620 12:86055758-86055780 CCTAAAATGGGTGAGGGTAAAGG + Intronic
1102869312 12:116401169-116401191 CAATCATGGGGGAAGGGTAAAGG + Intergenic
1104611996 12:130236487-130236509 CTTTCAGTGGTGAAGGGTCAAGG - Intergenic
1110131995 13:72021106-72021128 CCTTAAATGGCGAAGGCTCAGGG - Intergenic
1110140266 13:72120723-72120745 CAATCAATGGGAAAGGTTAAAGG - Intergenic
1114577964 14:23730506-23730528 ACTACAATGGGGAAGAGTGAAGG - Intergenic
1117875569 14:60248316-60248338 CCTCCAATGAGGTAGGTTAAGGG - Intronic
1119377704 14:74208025-74208047 TCTCCAATTGGGAAGGGGAAGGG - Intergenic
1119481694 14:74962086-74962108 GCTGCAATGGGGATGGGAAAGGG - Intergenic
1123938448 15:25205248-25205270 GCTTCAATGGGGTTGGGTCAAGG + Intergenic
1124622864 15:31286947-31286969 CCAACAATGGGGATGGTTAATGG - Intergenic
1127775768 15:62263368-62263390 GCTTCAAGGGAGAAGGCTAAGGG + Intergenic
1128170550 15:65508359-65508381 CCTTTATTGGGGAAGGGCAAAGG + Intronic
1128346334 15:66854738-66854760 CATTCACTGGGGAAGGGGGAGGG + Intergenic
1133572583 16:7056172-7056194 CCTTCTTTGGGGAAGGGTAGGGG - Intronic
1134109581 16:11506789-11506811 CCATCAATGGGGAGGGGCAGAGG + Intronic
1135343288 16:21666708-21666730 CTTTCAGTGGGGAAGGGGTATGG + Intergenic
1136852937 16:33627655-33627677 CCTGGATTGGGGATGGGTAAAGG + Intergenic
1137648476 16:50096897-50096919 TCTTCAATGGGTAAGTGTATGGG - Intronic
1137998646 16:53249345-53249367 TGTTAAATGGGGAAGGATAAAGG + Intronic
1138911086 16:61399620-61399642 TCTTCAAAGGTGAAGGGAAAAGG - Intergenic
1139003172 16:62539094-62539116 CCTTCTTAGGGAAAGGGTAATGG - Intergenic
1141361072 16:83395561-83395583 CCTTCAATGTGGGAGGGTTGGGG - Intronic
1141574118 16:84953199-84953221 CCAGCAATGTGGAAGGGAAATGG - Intergenic
1142127310 16:88416634-88416656 GCTTCATTGGGAAAGAGTAATGG + Intergenic
1203114533 16_KI270728v1_random:1476075-1476097 CCTGGATTGGGGATGGGTAAAGG + Intergenic
1144000443 17:11049289-11049311 CCATCAAAGGGAAAGAGTAAAGG - Intergenic
1146518331 17:33507030-33507052 TCTTCACTGGGGCAGGGTCAAGG + Intronic
1146762747 17:35492568-35492590 CCTTCATAGAGGAAGGGGAACGG - Intronic
1148815723 17:50326583-50326605 CCTAAGATGGGGGAGGGTAACGG - Intergenic
1149561022 17:57608121-57608143 CCTTCAATCTGGCAGGGGAAGGG - Intronic
1151561343 17:74871541-74871563 CCTTCACAGGGGAAGGGGGAGGG + Intronic
1158111182 18:53942797-53942819 CCTTAAATGGTGAAGGCTCAGGG + Intergenic
1158862070 18:61602488-61602510 GCTTCAAGGGAGAAGGGTGAGGG - Intergenic
1165326227 19:35116019-35116041 CCTTGAATGGGGAAGGTTCTGGG - Intronic
1165326325 19:35116431-35116453 GCTTCTATGGGGCAGGGTCAGGG - Intronic
1166987386 19:46669370-46669392 CTTTCAAGGGGAAAGGGAAATGG + Intergenic
1167608593 19:50495020-50495042 CCTTTTCTGGGGAAGGGTACAGG - Intergenic
926113727 2:10197954-10197976 CCTCCAATGGGGCAGGGTCCAGG + Intronic
926155603 2:10452251-10452273 CATTCAAAGGGCAAGGTTAAAGG - Intergenic
926270717 2:11364017-11364039 CCTTTCATGGGGACGTGTAATGG + Intergenic
926671843 2:15583912-15583934 GCTTTAGTGGGGAAGGGTGAGGG + Intergenic
929178001 2:39001569-39001591 CCTTCTTTGGGGGAGGGTCAGGG - Intronic
929956459 2:46462159-46462181 CCTTAAACGGGGAGAGGTAAAGG + Intronic
930510251 2:52335439-52335461 CCTTCAAGGGAAAAGGGTGAGGG + Intergenic
932331973 2:70902987-70903009 CATTAAATGGGGAAGGGCAGAGG - Intronic
933090206 2:78108757-78108779 CCTTAAATGGTGAAGGCTCAGGG + Intergenic
938869895 2:135464213-135464235 CCTTCAAAGGGGAAAAGTATAGG + Intronic
940330474 2:152468870-152468892 CATTCAATGGGGAGAGATAATGG + Intronic
940638076 2:156321557-156321579 CCCTCAAGGTGGAAGGGGAAAGG - Intergenic
941158654 2:162009685-162009707 CCTGCAATGGAGAAAGATAAGGG + Intronic
941607579 2:167619253-167619275 CATTCAATGGGGAGGGGACAGGG - Intergenic
943070985 2:183140344-183140366 CCTTAAAAGGGGAAGAGGAAAGG - Intronic
944374736 2:199028650-199028672 ACTTCACTGGGGAAGTGCAAGGG + Intergenic
946174060 2:217912080-217912102 CATGCAGTGGGGGAGGGTAAAGG - Intronic
947772535 2:232682008-232682030 TCTTTGATGGGGAATGGTAAAGG - Exonic
948120505 2:235526362-235526384 CCTTCCATGGGAGAGGGTATGGG + Intronic
1168935508 20:1661888-1661910 CTGTCAATGAGGAAGGGTCATGG - Intergenic
1169048723 20:2558831-2558853 CCCTCACGGGGGAAGGGGAAGGG - Intronic
1169308295 20:4513730-4513752 CCATGAATGGGGAAAGGCAATGG - Intergenic
1169742334 20:8908411-8908433 GCTTCAAGGGAGAAGGGTAGGGG + Intronic
1172358753 20:34297701-34297723 CATTCAATGGGGAAAGGTGTTGG - Intronic
1173198722 20:40938177-40938199 CCTTCACTGGGGTGGGGTTAGGG + Intergenic
1173837978 20:46138296-46138318 CCTTCACTGGGGCAGGGGATGGG - Intergenic
1174581500 20:51575198-51575220 TCTTCAAAGGGCAAAGGTAAAGG - Intergenic
1174892306 20:54409117-54409139 CTTTGAATGGGAGAGGGTAAGGG - Intergenic
1174892393 20:54410225-54410247 CATTCAATGCGAGAGGGTAAGGG - Intergenic
1176926334 21:14753841-14753863 CCTTCAAGAGGGAAGGAGAAAGG + Intergenic
1177282322 21:18997609-18997631 CATTCTATGGGGAAAGATAAAGG - Intergenic
1183256215 22:36764109-36764131 CCTTCCAAGGGAAAGGGTATGGG + Intronic
1183605723 22:38866004-38866026 CCTGGAATGGGGCAGGGGAAGGG - Exonic
1184962439 22:47941310-47941332 CCATCCATGAGGAAGGGGAAAGG + Intergenic
949234060 3:1787237-1787259 CCTTAAATGTGGAAGAATAAAGG - Intergenic
955936729 3:64109541-64109563 GCTGCACTGGGGAAGGGAAAGGG + Intronic
956858566 3:73300085-73300107 CTGATAATGGGGAAGGGTAAAGG + Intergenic
958733375 3:97982152-97982174 CATTCACTGGGGAAGGATAGAGG - Intergenic
961709169 3:128813858-128813880 CCTTCAAGGAGGGAGGGGAAAGG - Exonic
964329617 3:155587901-155587923 ACTTCAATATTGAAGGGTAATGG + Intronic
964432760 3:156623436-156623458 CCTTAAATGGTGAAGGCTCAGGG - Intergenic
966624489 3:182001483-182001505 TCTGGAATGGGGAAGTGTAAAGG + Intergenic
970082470 4:12302913-12302935 CCTTCCATGGGGAAAGGACATGG - Intergenic
970409754 4:15792939-15792961 TCTTAAATGGGGGAGGGAAATGG - Intronic
971250271 4:24968564-24968586 CCTTAAATGGCGAAGGCTCAGGG - Intronic
971762359 4:30782888-30782910 GCTTCAAGGGAGAAGGGCAAGGG + Intronic
974896261 4:67943030-67943052 CCTGCAAGGGGGGAGGGTAAGGG + Intronic
975464237 4:74691665-74691687 CCTTCAACAGGGAAGTGGAAAGG - Intergenic
976617015 4:87088382-87088404 GCTGCAATGGGGAAGGGCAACGG + Intronic
982906973 4:161086946-161086968 CCTTAAGTGGGGAAGGGGACAGG + Intergenic
983226310 4:165089292-165089314 TCTTCAAGGGAAAAGGGTAAAGG + Intronic
986522592 5:8636944-8636966 CTTTGAATGGTGAGGGGTAAAGG + Intergenic
987036819 5:14027538-14027560 ACTTGAATGGGGAAGGGTCTTGG - Intergenic
989987309 5:50716147-50716169 CCTTCTATGGAGAAGGGAAGAGG + Intronic
990109173 5:52302763-52302785 CTGTCAATGGGGAAGGCTGATGG + Intergenic
990748075 5:58981758-58981780 CCTTCATTCGTGAAGGGTATGGG + Intronic
991048958 5:62252592-62252614 CCTGGATTGGGGATGGGTAAAGG - Intergenic
991218570 5:64185034-64185056 CCATCAACGGGTAAGGGAAAGGG - Intronic
994587543 5:101729058-101729080 CCTCCAAGTGGGAAGGGGAAAGG - Intergenic
995852855 5:116564107-116564129 CCTTTAATGTGGTTGGGTAACGG + Intronic
996111982 5:119576861-119576883 CCTGCTATGGGAAAAGGTAAAGG - Intronic
997466471 5:134091284-134091306 CCTTCAGTGAGGAAGGGGGAAGG - Intergenic
998649139 5:144098246-144098268 CCTACCCTGGGGATGGGTAAGGG - Intergenic
1000041494 5:157488192-157488214 CTTTCAATGGGTAATGGCAAAGG - Intronic
1004032697 6:11886719-11886741 GTTACAATGGGGGAGGGTAAAGG + Intergenic
1004934236 6:20491760-20491782 CCTTCATAGAGGAAGGGGAACGG - Exonic
1005092215 6:22069596-22069618 CTTTTAATGGGGAAGAGTGAAGG - Intergenic
1006890924 6:37427498-37427520 ACATAAATGGGGAAGGGTGAAGG - Intergenic
1007401047 6:41602487-41602509 TCTTCAAGGGGGCAGAGTAAGGG - Intergenic
1007515171 6:42405177-42405199 CTTACAATTGGGAAGGGAAAAGG + Intronic
1008533350 6:52485729-52485751 CCTTCATGGTGGAAGGGGAAGGG - Intronic
1009651179 6:66479726-66479748 CCTTAAATGGTGAAGGCTCAGGG + Intergenic
1010510989 6:76719370-76719392 CCTTCAAATGTGAAGAGTAATGG - Intergenic
1011882223 6:92043401-92043423 CCTTCAATAGGGATGGGGGAAGG - Intergenic
1018519810 6:164635378-164635400 TCTGCACTGGGGAAGGGCAAAGG + Intergenic
1018937766 6:168284699-168284721 CCTGAAATAGGGAAGGGGAATGG - Intergenic
1020548396 7:9565419-9565441 CTTTCAGTGGGGAAGGGAAGGGG + Intergenic
1023274379 7:38502484-38502506 CCTTCAATGGGACAGGCTCAGGG - Intronic
1023698058 7:42867672-42867694 TCTTCAATGGAGAAGGTAAATGG - Intergenic
1029639783 7:101813949-101813971 CCTCCCATGGGGAAGGCTCAAGG - Intergenic
1033121713 7:138672212-138672234 CCCTGAATGGGGAAGGACAAAGG - Intronic
1034138066 7:148789885-148789907 CCTTCACTGTGGAAGGGGACAGG + Intronic
1034354427 7:150441896-150441918 CCTGCAAGGGGTAAGGGGAAGGG - Intergenic
1036062364 8:5337869-5337891 CATTCAAAAGGGAAGGGAAATGG - Intergenic
1038892290 8:31739155-31739177 CCTTCAAAGAGAAAGGGTAAAGG - Intronic
1041337120 8:56798837-56798859 CCAGAAATGGGGAAGGGAAATGG + Intergenic
1047240131 8:123079787-123079809 GCTGCAATGGGGAAGGAGAAAGG - Intronic
1048884207 8:138896339-138896361 TTTTAAAAGGGGAAGGGTAAAGG + Intronic
1050080085 9:1906936-1906958 TCATCTCTGGGGAAGGGTAAGGG - Intergenic
1051887444 9:21908905-21908927 CTATAAATGGGGAAGGGGAAGGG - Intronic
1055320518 9:75079726-75079748 CCTTCCTTGGGGAAGGGAATAGG + Intronic
1055331576 9:75189541-75189563 GTTTCCATGGGGAAGAGTAAAGG - Intergenic
1055336469 9:75237470-75237492 CCTTAAATGGTGAAGGCTCAGGG + Intergenic
1055884191 9:81039860-81039882 CCTTCAAGGGGGAAGGGCAGAGG - Intergenic
1059470163 9:114498855-114498877 CCTCCCCTGGGGAAGGTTAAAGG + Intronic
1060421553 9:123472899-123472921 CCTCCAAGGGTGAAGGGCAAGGG - Intronic
1062726273 9:138075797-138075819 CCTGCAATGGAGAAGAGCAATGG - Exonic
1187823532 X:23312730-23312752 CCTACAAAGATGAAGGGTAAAGG + Intergenic
1188292623 X:28407527-28407549 TTTTCAATGGGGAAGGGAGAGGG + Intergenic
1190311867 X:49122587-49122609 CCTTCAATGGGGAAGGGTAAAGG + Intronic
1191025311 X:55907913-55907935 ACTAGAATGGGGAAGGGGAAGGG - Intergenic
1198248027 X:134850184-134850206 ACTACAATGGGGAGGGGAAATGG + Intronic
1199963389 X:152797608-152797630 TCATAAATGGAGAAGGGTAAAGG - Intergenic
1200344905 X:155438438-155438460 CATTCATTGTGGAAGGGGAAGGG - Intergenic
1201545649 Y:15158841-15158863 GCTTCACTTGGGAAGTGTAAGGG - Intergenic