ID: 1190311868

View in Genome Browser
Species Human (GRCh38)
Location X:49122588-49122610
Sequence CTTCAATGGGGAAGGGTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 255}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190311858_1190311868 -3 Left 1190311858 X:49122568-49122590 CCACCTTCTTCCTCTTCTTCCTT 0: 2
1: 32
2: 277
3: 1646
4: 7228
Right 1190311868 X:49122588-49122610 CTTCAATGGGGAAGGGTAAAGGG 0: 1
1: 0
2: 2
3: 23
4: 255
1190311855_1190311868 11 Left 1190311855 X:49122554-49122576 CCCACTCTATCCTTCCACCTTCT 0: 1
1: 0
2: 2
3: 56
4: 646
Right 1190311868 X:49122588-49122610 CTTCAATGGGGAAGGGTAAAGGG 0: 1
1: 0
2: 2
3: 23
4: 255
1190311859_1190311868 -6 Left 1190311859 X:49122571-49122593 CCTTCTTCCTCTTCTTCCTTCAA 0: 1
1: 0
2: 18
3: 277
4: 2114
Right 1190311868 X:49122588-49122610 CTTCAATGGGGAAGGGTAAAGGG 0: 1
1: 0
2: 2
3: 23
4: 255
1190311856_1190311868 10 Left 1190311856 X:49122555-49122577 CCACTCTATCCTTCCACCTTCTT 0: 1
1: 0
2: 8
3: 76
4: 1003
Right 1190311868 X:49122588-49122610 CTTCAATGGGGAAGGGTAAAGGG 0: 1
1: 0
2: 2
3: 23
4: 255
1190311857_1190311868 1 Left 1190311857 X:49122564-49122586 CCTTCCACCTTCTTCCTCTTCTT 0: 1
1: 5
2: 42
3: 365
4: 2452
Right 1190311868 X:49122588-49122610 CTTCAATGGGGAAGGGTAAAGGG 0: 1
1: 0
2: 2
3: 23
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190311868 Original CRISPR CTTCAATGGGGAAGGGTAAA GGG Intronic
900786474 1:4653545-4653567 CTTCACTGGGGAAAGGTGCAAGG - Intergenic
900902073 1:5523905-5523927 CGTCAAGGGAGAAGGTTAAATGG + Intergenic
901279051 1:8018098-8018120 TTTCAATGGGGAATTGTGAATGG + Intronic
901595554 1:10382727-10382749 TTTGGGTGGGGAAGGGTAAATGG + Intergenic
903342341 1:22662272-22662294 CTTGAATGAGGATGGGTAGATGG - Intergenic
904564935 1:31423204-31423226 ATTAAGTGGGGAAGGGGAAAGGG + Intronic
906024616 1:42662583-42662605 CTTCCTTGGGGAAGGCAAAATGG + Intronic
908670970 1:66547275-66547297 TTTCAATGGGGATGGATATATGG + Intronic
909923741 1:81413903-81413925 CATCAAAGAGGAAGGGGAAAAGG + Intronic
910267350 1:85351798-85351820 GAGCCATGGGGAAGGGTAAATGG + Intronic
911941790 1:104056935-104056957 CTTCACTGGGGAAGTGCAAGGGG + Intergenic
912643595 1:111370202-111370224 ATTCATGGTGGAAGGGTAAAGGG - Intergenic
916581687 1:166114941-166114963 TATCAATGGAGAAGGCTAAAGGG - Intronic
918431602 1:184466565-184466587 CTTAAATGTGGTAGGTTAAAGGG + Intronic
919038265 1:192345421-192345443 CTTCAATGGAAGAGGGTAAATGG - Intronic
920156296 1:203954718-203954740 CTTGACTGTGGAGGGGTAAAGGG + Intergenic
920801992 1:209197263-209197285 CTTCACTGGGGAGATGTAAAGGG - Intergenic
920802123 1:209199271-209199293 CTTCATAGGGGAAGGGGAGATGG - Intergenic
920979577 1:210820741-210820763 TTACAATGGGGAGGGGAAAAAGG + Intronic
921428469 1:215033689-215033711 CTTCCATGTGGAAGGATAGAGGG + Intronic
922081975 1:222306196-222306218 CTTGAAGGGGGAAAGGGAAAAGG + Intergenic
923239231 1:232064238-232064260 CTTCAAATGAGGAGGGTAAAAGG + Intergenic
924294208 1:242569083-242569105 TTTCTGTGGGGAAGGATAAAAGG - Intergenic
1063046604 10:2398713-2398735 CTTCAAAGGAGAGGGGTTAAGGG + Intergenic
1065286504 10:24192357-24192379 CTTCAGTGGGAAAGGATAAGGGG + Intronic
1066236009 10:33485394-33485416 CTTCACTGGGAAAGAATAAATGG - Intergenic
1066396214 10:35025002-35025024 CTTTAATGGGGAAAGGTTGATGG + Intronic
1066452090 10:35539012-35539034 GTTCAATGGGGAAAGGATAAAGG - Intronic
1066517632 10:36181466-36181488 CTGCAAGGAGGAAGGGGAAAAGG + Intergenic
1067075787 10:43181018-43181040 CAGCAGTGGGGAAGGGGAAAAGG - Intronic
1067795677 10:49319971-49319993 CTTCCAGGGGGGAGGGGAAATGG + Intronic
1071712324 10:88061609-88061631 CACCAATAGGGAAGGGTCAAAGG + Intergenic
1072890701 10:99321686-99321708 CTTAAATGGGTAGGGGGAAAAGG - Intergenic
1073638193 10:105220735-105220757 CATCAATGGGGAAGAGAAAGAGG - Intronic
1074342524 10:112647171-112647193 CTTCCATGGGCATGTGTAAACGG + Intronic
1075656911 10:124168037-124168059 CTAAACAGGGGAAGGGTAAATGG + Intergenic
1082835864 11:57649779-57649801 CTTCAATTGGGAAGGGGATGGGG + Intronic
1082914849 11:58422132-58422154 CCTGAATGAGGAAGGCTAAATGG - Intergenic
1083106190 11:60360737-60360759 CTCCACTGGCGAAGGGGAAAGGG + Intronic
1083720588 11:64601735-64601757 CTTCAATACTGAAGGGGAAAAGG + Exonic
1084162525 11:67357466-67357488 CCTAAATGGGGAAGGGCAAAGGG - Intronic
1084368387 11:68718946-68718968 CTTCCATGAGGAAGAGTACATGG - Intronic
1084445588 11:69201843-69201865 CTGCAAAGGGGAAGGGAACATGG + Intergenic
1085951072 11:81331933-81331955 CTTAAGTGGGGAAGGGGACAGGG - Intergenic
1091938750 12:4455053-4455075 CTTCAAGGGAGAAGAGAAAAGGG - Intergenic
1092206649 12:6618669-6618691 CTTCTCTGGGGGAGGGAAAAGGG - Intergenic
1094484053 12:30909968-30909990 CTTCAATGGGGGATGGGGAAGGG + Intergenic
1095772464 12:45976135-45976157 CATAAAGGGGGAAAGGTAAAGGG + Intronic
1096279020 12:50235654-50235676 CTCTAATGGGGTAGGGTAAAAGG + Intronic
1096709648 12:53445992-53446014 CTGCAAGGGGAAAGGGGAAAGGG - Intronic
1096845775 12:54405656-54405678 CGTCAATGGGGACGGGTGAGTGG - Exonic
1099698621 12:86055759-86055781 CTAAAATGGGTGAGGGTAAAGGG + Intronic
1102869313 12:116401170-116401192 AATCATGGGGGAAGGGTAAAGGG + Intergenic
1103567296 12:121823105-121823127 CTTCATTGGGGGAGGGCAAGAGG - Exonic
1104130463 12:125888771-125888793 CTTCTTTGGGGTAGGGCAAAAGG - Intergenic
1107414582 13:40188724-40188746 CTTCAAGGAGGAGGGGGAAAGGG + Intergenic
1107511603 13:41091210-41091232 ATTCAGTGGGGAAGGGTAGGAGG + Intergenic
1107840639 13:44453160-44453182 ATTCAAAGGAGAAGGTTAAAGGG - Intronic
1108147831 13:47498402-47498424 CTTCACTGGTGGAGGCTAAAAGG - Intergenic
1108712518 13:53047520-53047542 CCTCTATGGGTAAGGATAAAGGG - Intronic
1109344442 13:61098468-61098490 CTTCAAGTGAGAAGGGAAAATGG - Intergenic
1109797835 13:67340392-67340414 CTTAAATGGGGAAAGGGAACAGG - Intergenic
1115333788 14:32225276-32225298 ATGGAATGGGGAAGGGCAAAGGG - Intergenic
1115696821 14:35908377-35908399 TATAAATGGGGGAGGGTAAAGGG + Intronic
1116039258 14:39666060-39666082 CCTTAATGTGGAAGAGTAAATGG + Intergenic
1116306344 14:43262254-43262276 CCTCACTGGGGAAGCGCAAAGGG + Intergenic
1117258018 14:54000054-54000076 CTTCCATGGGGCAGGGTGGAGGG + Intergenic
1117333975 14:54741012-54741034 CCTCCACAGGGAAGGGTAAAGGG - Intronic
1117385409 14:55207513-55207535 CTTGAATGGAGAAGTGGAAAGGG - Intergenic
1119139605 14:72254427-72254449 CTTCAATGTGAAAGGGGATAAGG - Intronic
1119481693 14:74962085-74962107 CTGCAATGGGGATGGGAAAGGGG - Intergenic
1120251743 14:82067129-82067151 CTTTAATGGGGAGGGCTACAAGG + Intergenic
1120580502 14:86242000-86242022 ATTCAAAGGGGAAGGGTGAGAGG - Intergenic
1120746231 14:88154448-88154470 TTACAACGGGGAAGGGAAAATGG + Intergenic
1125258398 15:37793856-37793878 CTTCAAAGGAAAAGGCTAAATGG + Intergenic
1126961673 15:54003479-54003501 CTTCAAAGGGGACAGGTAAGAGG - Intergenic
1127391404 15:58507837-58507859 CTTCATAGGGGAAGGGGAGATGG + Intronic
1128153039 15:65375403-65375425 CTGCATTGGGGAAGGGGAGATGG + Intronic
1128874574 15:71191738-71191760 CTCATATGTGGAAGGGTAAAAGG - Intronic
1130025878 15:80270116-80270138 CTGTAATGGGGAAGGGGAAGAGG + Intergenic
1133741211 16:8652865-8652887 CCTGAATGGGGAAGGGCAAAAGG + Intergenic
1134339607 16:13333078-13333100 CTTCACTGGAGAAGGGGGAAAGG + Intergenic
1135880894 16:26255256-26255278 TATAAATGGGGGAGGGTAAAGGG + Intergenic
1136570887 16:31095906-31095928 CTTGAATGTGGAGGGGTAGATGG - Intronic
1136668998 16:31839358-31839380 TTTCACTGGGGTCGGGTAAAGGG - Intergenic
1137648475 16:50096896-50096918 CTTCAATGGGTAAGTGTATGGGG - Intronic
1138778018 16:59748652-59748674 CTTCATCTGGGAAGGCTAAAGGG + Intronic
1141355040 16:83337453-83337475 CTTCAAGGGGGCATGGTAGATGG - Intronic
1144000442 17:11049288-11049310 CATCAAAGGGAAAGAGTAAAGGG - Intergenic
1144259324 17:13502645-13502667 ATAAAATGGGGAAGGGTAATAGG - Intronic
1146050159 17:29543855-29543877 CTTCAATGGGGAAGACCAGAAGG + Exonic
1146518332 17:33507031-33507053 CTTCACTGGGGCAGGGTCAAGGG + Intronic
1146588791 17:34109715-34109737 CCTCAATGAGGAAGGCTTAATGG - Intronic
1148026895 17:44594809-44594831 ATCCAATGGGGGAGGTTAAAAGG - Intergenic
1148148338 17:45380149-45380171 CTTCATTGCAGAAGGGTAACAGG - Intergenic
1149269485 17:54961082-54961104 CTTCCATAGGGGAGGGTATAAGG - Intronic
1149298215 17:55280504-55280526 CTTGAGTGGGTAAGGGTGAAAGG + Intronic
1149347143 17:55750783-55750805 CTTCCAGAGGGAAGGGAAAAAGG - Intergenic
1151425074 17:74025761-74025783 CTTCAGTGGGAAAGTATAAAAGG - Intergenic
1155075480 18:22350193-22350215 CTTCAAAGGAAATGGGTAAATGG + Intergenic
1155609111 18:27643462-27643484 CTTCAATGAGGACGGGTTAAAGG + Intergenic
1156097317 18:33551257-33551279 TATAAATGGGGGAGGGTAAAGGG + Intergenic
1157015201 18:43703883-43703905 CTTCAAGGGAGAAGGGAGAAAGG - Intergenic
1162520024 19:11174212-11174234 GTTCAATGGGGTGGGGTATATGG - Intronic
1163293751 19:16398531-16398553 CTTCCATGGGGCAGTGTGAAAGG - Intronic
1164828929 19:31305488-31305510 CTTAGATGGAGAAAGGTAAAAGG + Intronic
1165326324 19:35116430-35116452 CTTCTATGGGGCAGGGTCAGGGG - Intronic
1166385618 19:42378910-42378932 CTTAAAGGGGGAAGGGGGAAGGG + Intergenic
926671844 2:15583913-15583935 CTTTAGTGGGGAAGGGTGAGGGG + Intergenic
927822046 2:26275579-26275601 CTGCAAAGGGCAAGTGTAAAAGG - Intronic
928173172 2:29016444-29016466 TATCACTGGGGAAGGGTGAAGGG + Intronic
929956460 2:46462160-46462182 CTTAAACGGGGAGAGGTAAAGGG + Intronic
930855949 2:56018270-56018292 CTGCAATGGCGAAGGGCAAGAGG + Intergenic
932331972 2:70902986-70903008 ATTAAATGGGGAAGGGCAGAGGG - Intronic
933557363 2:83847920-83847942 CTTTATAGGGGAAGGGGAAATGG + Intergenic
933840923 2:86284947-86284969 CTGCCCTGGGGAAGGGGAAATGG + Intronic
934094088 2:88582468-88582490 CTCCAATGGGAAAGGGAATATGG + Intronic
935817082 2:106856438-106856460 CTTGAGTGTGGAAGGGAAAAGGG + Intronic
936251854 2:110873695-110873717 CTGCCATGGGAGAGGGTAAAAGG + Intronic
936641051 2:114313320-114313342 CTGCACTGGGGAAAGGGAAATGG + Intergenic
938085707 2:128400081-128400103 TCTCAATGGGGGAGGATAAAGGG - Intergenic
942254447 2:174081628-174081650 GTTCAGTGGGGGAGGGGAAAGGG - Intronic
944374737 2:199028651-199028673 CTTCACTGGGGAAGTGCAAGGGG + Intergenic
944787441 2:203087400-203087422 CTTCAATGTAGAAGGGGATAAGG - Intronic
945218470 2:207460449-207460471 CTTCAAGGAAGAAGGGCAAAGGG - Intergenic
946128857 2:217589278-217589300 CATATATGGGGGAGGGTAAAGGG - Intronic
947011210 2:225569039-225569061 CTTCATAGGGGAAGGGGAAATGG + Intronic
947257853 2:228184879-228184901 ATTAAAGGGAGAAGGGTAAAGGG + Intergenic
947454689 2:230243229-230243251 CTGGATTGGAGAAGGGTAAATGG - Intronic
947772534 2:232682007-232682029 CTTTGATGGGGAATGGTAAAGGG - Exonic
947859456 2:233348424-233348446 CTTTAAGGGAGCAGGGTAAAGGG + Intergenic
1168974719 20:1955683-1955705 CTTCATCGGGGAAGGGGAAATGG - Intergenic
1169046692 20:2538711-2538733 GTTCTATGGGAAAGGGAAAACGG - Intronic
1170909383 20:20549515-20549537 CAGCACTGGGGGAGGGTAAATGG + Intronic
1172414561 20:34753923-34753945 CTTCAATGAGAAAGGGTAAGAGG + Intronic
1172534407 20:35661194-35661216 CTTCAAAAGGGAAAGGTAAATGG + Intronic
1173144117 20:40510259-40510281 CTTAACTGGAGAAGGGTGAAAGG - Intergenic
1174370562 20:50084554-50084576 CTTCTCTGGGGAATGGTAAGAGG + Intronic
1174992582 20:55527621-55527643 CTTCCATGAGGAAGAGGAAAGGG - Intergenic
1175518160 20:59582127-59582149 CTTCCCTGGGGAAGGGCGAAAGG - Intronic
1177517336 21:22172241-22172263 CTACCATGGGTTAGGGTAAAGGG - Intergenic
1179160267 21:38890348-38890370 CTTCACAGGGGAAGGGAAAATGG - Intergenic
1181624680 22:24115230-24115252 CTTAAATGGGGAAGGGGACATGG + Intronic
1183387406 22:37522859-37522881 CTTCGCTGGGGAAGGGGAGACGG + Intergenic
1184522145 22:45001096-45001118 CTCCCATGGTGTAGGGTAAAAGG - Intronic
949234059 3:1787236-1787258 CTTAAATGTGGAAGAATAAAGGG - Intergenic
949279321 3:2327923-2327945 CTTCAGTGGGGAAGGGGTGAGGG - Intronic
951633955 3:24752656-24752678 CTCCAATGGAGAATGGTGAAAGG - Intergenic
951889448 3:27554818-27554840 CTTCAAAGGGGAAGTGGAGACGG + Intergenic
952219647 3:31312463-31312485 CATCATTGGTGAAGGGTCAAGGG - Intergenic
953424477 3:42782055-42782077 CTTCATAGGGGAAGGGGAGATGG - Intronic
954824190 3:53357039-53357061 ATGCAATGGGGAAGGATCAAAGG - Intergenic
955034260 3:55250905-55250927 TTTCAGTGTGGAAGGGAAAAAGG + Intergenic
955624864 3:60907734-60907756 CCTCAAGGGGGAAGAGTAATTGG + Intronic
956577826 3:70774725-70774747 ATTCAATGGGGAAGAAAAAAGGG - Intergenic
956858567 3:73300086-73300108 TGATAATGGGGAAGGGTAAAGGG + Intergenic
957144687 3:76408875-76408897 CTTCAGTGGGCAAGGGGAAGAGG - Intronic
959523923 3:107354725-107354747 CTTCAGTAAGAAAGGGTAAATGG - Intergenic
959631928 3:108516778-108516800 CTTCAAAGAGGAATGTTAAACGG + Intronic
960060454 3:113314741-113314763 TATAAATGGGGGAGGGTAAAGGG + Intronic
960328486 3:116326818-116326840 CTTCGGTGTGTAAGGGTAAAAGG - Intronic
960387443 3:117036962-117036984 CTACATTGAGGAGGGGTAAATGG - Intronic
960530152 3:118755239-118755261 ATGCAATAGGGAAAGGTAAAAGG + Intergenic
961709168 3:128813857-128813879 CTTCAAGGAGGGAGGGGAAAGGG - Exonic
964175305 3:153820678-153820700 CTTCATAGGGAAAGGGGAAATGG - Intergenic
964835070 3:160929372-160929394 CTTAACTGGGGAAGGGAAACTGG - Intronic
966157125 3:176928873-176928895 CTTCAAGGGGGAAGGGAACCAGG + Intergenic
966570917 3:181441970-181441992 CTACAATGGGGAAAAGTACACGG - Intergenic
968621631 4:1605866-1605888 CTCCAGTGGGGAGGGGGAAAGGG - Intergenic
969077830 4:4594272-4594294 CATCAACTGGGAAGGGGAAAAGG + Intergenic
970794777 4:19898328-19898350 CTTCAATGGGGAGGGGAAAATGG - Intergenic
970866082 4:20760266-20760288 GTTCACTGGGGAAGGATGAATGG + Intronic
971762360 4:30782889-30782911 CTTCAAGGGAGAAGGGCAAGGGG + Intronic
972501056 4:39678152-39678174 CATAAATGAGGGAGGGTAAAGGG - Intergenic
972718191 4:41669751-41669773 CTTCAATTGGGATGGGGAAATGG + Intronic
974242691 4:59271520-59271542 CTAGAATGGGTAAAGGTAAAAGG - Intergenic
975330403 4:73106269-73106291 CTTCACTGTGGAATGGGAAAGGG + Intronic
976617016 4:87088383-87088405 CTGCAATGGGGAAGGGCAACGGG + Intronic
976745955 4:88403235-88403257 CTTCAGTGGGTCAGGGTAGAGGG - Intronic
978057697 4:104292868-104292890 CTTCAATGAGGAGTGTTAAATGG - Intergenic
978713377 4:111812235-111812257 TTTCAATGGGGAAGTGGATAGGG + Intergenic
979111045 4:116757280-116757302 CATAAATTGGAAAGGGTAAAGGG + Intergenic
979234136 4:118380579-118380601 GTTTAAGGGGGAAGGTTAAAGGG - Intergenic
980206558 4:129726592-129726614 ATTCAATGCAGAAGGGGAAATGG - Intergenic
981600548 4:146483333-146483355 CATAAATGGGGTAAGGTAAATGG + Intronic
981919610 4:150073121-150073143 CTTTAATGGGGAAGGGTATAAGG - Intergenic
982751255 4:159165071-159165093 CTTTTTTGGGGAAGGGGAAAAGG + Intronic
982906974 4:161086947-161086969 CTTAAGTGGGGAAGGGGACAGGG + Intergenic
983226311 4:165089293-165089315 CTTCAAGGGAAAAGGGTAAAGGG + Intronic
984513823 4:180713431-180713453 CTTCAATGGGAAGAGGAAAAGGG + Intergenic
984617188 4:181912175-181912197 CAGCAATGAGGAAGGGGAAAAGG + Intergenic
985968154 5:3353315-3353337 CTTCCATGGGGCAGGGAGAAGGG + Intergenic
989138719 5:38181398-38181420 TTACATGGGGGAAGGGTAAACGG - Intergenic
990355395 5:54961592-54961614 CTCCAATGGTGAAGGCTAAGTGG - Intergenic
990904222 5:60786523-60786545 AATAAATGGGCAAGGGTAAAAGG + Intronic
991711150 5:69409832-69409854 CTGCCAGGGGGAAGGGAAAATGG - Intronic
994219614 5:97180810-97180832 ATTAGATGTGGAAGGGTAAAGGG + Intronic
994255349 5:97587143-97587165 CATCAAGGGGGAAGAGCAAAGGG - Intergenic
996507671 5:124286552-124286574 CTTCAATGGGGAGAGAGAAAGGG + Intergenic
996815224 5:127566718-127566740 CTTCATAGGGGAAGGGAAGATGG - Intergenic
996870523 5:128187190-128187212 CAAAAATGGGGAAGGGGAAATGG + Exonic
997974830 5:138434944-138434966 ATGCAAAGGGGAAGGGTACATGG - Intronic
998440482 5:142157206-142157228 CTTAAATGGGGGAGGGGAAGTGG - Intergenic
998755885 5:145379189-145379211 CTTCACTGGGGAAGGGGCCAAGG + Intergenic
1000524463 5:162339310-162339332 CTTCATGGTGGAAGGGAAAAAGG - Intergenic
1002513405 5:179738652-179738674 GTTCAAGTGGGAAGGGCAAAGGG - Intronic
1004032698 6:11886720-11886742 TTACAATGGGGGAGGGTAAAGGG + Intergenic
1004141226 6:13019778-13019800 CTTTAATGGGGGTGGGTGAAAGG + Intronic
1004454167 6:15776152-15776174 CTTCACTGGGGAAAGGTAAGTGG - Intergenic
1006890923 6:37427497-37427519 CATAAATGGGGAAGGGTGAAGGG - Intergenic
1007401046 6:41602486-41602508 CTTCAAGGGGGCAGAGTAAGGGG - Intergenic
1008613557 6:53205704-53205726 CTTCATAGGGGAAGGGGAGATGG - Intergenic
1009270390 6:61606405-61606427 CTTTGAAGGGGAAGGGCAAAAGG - Intergenic
1009449771 6:63787497-63787519 GTTCAATGGGAAAAGGGAAATGG - Intronic
1011882222 6:92043400-92043422 CTTCAATAGGGATGGGGGAAGGG - Intergenic
1013171467 6:107640124-107640146 CTTCATTGGGGAAGCCAAAAGGG + Intronic
1013294134 6:108743582-108743604 CTCCAGTGGGGTAGGGTGAAGGG + Intergenic
1015059875 6:128950296-128950318 GTTCAAAGCAGAAGGGTAAAGGG + Intronic
1015588577 6:134801300-134801322 ATTCAGTGAGGAAAGGTAAAGGG - Intergenic
1015824833 6:137300590-137300612 CTTCAAGGAAGAAGGGCAAAGGG + Intergenic
1016897431 6:149067016-149067038 CTTCATAGGGAAAGGGGAAATGG + Intronic
1017662196 6:156685943-156685965 CTACAGTGGGAAAGGGAAAAAGG - Intergenic
1018181638 6:161228324-161228346 CTTGAATGGGGAAGGCCACATGG - Intronic
1019211342 6:170407874-170407896 CTTTTATGGAGAAGGGGAAATGG - Intergenic
1021388441 7:20061565-20061587 TTTCAATGGGAAAGAATAAATGG + Intergenic
1021691950 7:23239309-23239331 CTCCAGTGGGCAAGGGTACAGGG - Intronic
1024057732 7:45675310-45675332 TATAAATGGGGAAGGATAAAGGG - Intronic
1025582951 7:62742709-62742731 CCTCACTGGGGAAGTGTAAGTGG - Intergenic
1026684314 7:72495166-72495188 CTTCAAATGGGAATGGAAAATGG - Intergenic
1030457639 7:109794417-109794439 GTGCAATGGGGAAAGGGAAATGG - Intergenic
1032649942 7:133867425-133867447 CCTCAATGGGAAGGGGTAAGAGG - Intronic
1033121711 7:138672211-138672233 CCTGAATGGGGAAGGACAAAGGG - Intronic
1035320086 7:158022988-158023010 CCTCAATGGGAAATGGGAAAGGG + Intronic
1035481255 7:159187897-159187919 TATAAATGGGGGAGGGTAAAAGG + Intergenic
1037659646 8:20915764-20915786 CTTCAGTGGGGAAGGGGACCAGG - Intergenic
1037951511 8:23021435-23021457 CATCAAGGGGGAAGAGTAGATGG - Exonic
1041992373 8:64008817-64008839 CTGCAATGGTGAAGGGGAAAAGG + Intergenic
1043698124 8:83247318-83247340 GTTGAATGGGGAAGGGAAGAAGG - Intergenic
1044194373 8:89356705-89356727 CTTGAATGGGGAATTGTTAAAGG - Intergenic
1044580480 8:93821203-93821225 TTTAAATGTGAAAGGGTAAATGG + Intergenic
1046634481 8:116658544-116658566 CTTCAATGAGGGAGGGGAGATGG + Intronic
1048030416 8:130626344-130626366 CTTCTACAGGGATGGGTAAAGGG - Intergenic
1048032321 8:130644366-130644388 CTTCAATAGGGCATAGTAAATGG + Intergenic
1048884208 8:138896340-138896362 TTTAAAAGGGGAAGGGTAAAGGG + Intronic
1050584292 9:7094306-7094328 CTTAAGTTGGGAAAGGTAAAAGG + Intergenic
1051208032 9:14710497-14710519 ACACAATGGGGAAAGGTAAATGG + Intergenic
1051774155 9:20616088-20616110 CTTCAATTTGTAAGTGTAAAAGG + Intronic
1052034272 9:23662337-23662359 CTTTACTGGGGGAGGGTACAGGG - Intergenic
1052424028 9:28280582-28280604 CTACACTGAGGAAGAGTAAAAGG - Intronic
1052473174 9:28925536-28925558 CTTCCCTGGGGAAGGATAACTGG + Intergenic
1055331575 9:75189540-75189562 TTTCCATGGGGAAGAGTAAAGGG - Intergenic
1055449431 9:76417543-76417565 CTTCAAAGGGGAAGAATGAAAGG + Intergenic
1055580295 9:77701597-77701619 TTTAAATGAGGAAGAGTAAAGGG - Intergenic
1058355077 9:104074861-104074883 CTGGAATGGGAAAGGGAAAATGG + Intergenic
1059470164 9:114498856-114498878 CTCCCCTGGGGAAGGTTAAAGGG + Intronic
1059486054 9:114627599-114627621 CTTCTAGGGAGAAGGGAAAAGGG + Intronic
1059965023 9:119605233-119605255 CTTCTGTGGGGAAGGGGAGAAGG + Intergenic
1061248784 9:129414695-129414717 CTTCTGTGGGGAAGGGGCAAAGG + Intergenic
1186759254 X:12706324-12706346 CTTGAGAGGGGAAGTGTAAAGGG + Intronic
1187823533 X:23312731-23312753 CTACAAAGATGAAGGGTAAAGGG + Intergenic
1188284451 X:28311152-28311174 CTTCATAGGAGAAGGGGAAATGG - Intergenic
1188292624 X:28407528-28407550 TTTCAATGGGGAAGGGAGAGGGG + Intergenic
1190311868 X:49122588-49122610 CTTCAATGGGGAAGGGTAAAGGG + Intronic
1190504170 X:51109658-51109680 CTTCACTGGGGAAAGGGAGATGG - Intergenic
1192288496 X:69764679-69764701 CATCAATGAAGAAAGGTAAAGGG - Intronic
1194170832 X:90578789-90578811 CTTCATAGGGGAAGGGGAGATGG - Intergenic
1196143819 X:112295381-112295403 CTTCAAGTGGGAGTGGTAAAAGG - Intergenic
1196510442 X:116504552-116504574 TATAAAAGGGGAAGGGTAAAAGG - Intergenic
1196760908 X:119200074-119200096 CTTCATAGGGGAATGGGAAATGG + Intergenic
1197662515 X:129189327-129189349 CTTCATAGGGGAAGGGGAGAGGG + Intergenic
1198248028 X:134850185-134850207 CTACAATGGGGAGGGGAAATGGG + Intronic
1198697886 X:139363260-139363282 CATCAATGGGGAAGGCAACAGGG - Intergenic
1199217418 X:145276737-145276759 GTTTAATGGTGAAGAGTAAATGG - Intergenic
1199555793 X:149107239-149107261 ATAAAATGGGGGAGGGTAAAAGG - Intergenic
1199693048 X:150323614-150323636 TATAAATGGGGGAGGGTAAAGGG + Intergenic
1199963388 X:152797607-152797629 CATAAATGGAGAAGGGTAAAGGG - Intergenic
1200517066 Y:4156527-4156549 CTTCATAGGGGAAGGGGAGATGG - Intergenic
1201016261 Y:9605328-9605350 CTTCCATGAGGAAGGGACAATGG + Intergenic
1201503970 Y:14677450-14677472 TTTCAATGGGCAAGGGCACAAGG - Intronic
1201545648 Y:15158840-15158862 CTTCACTTGGGAAGTGTAAGGGG - Intergenic
1201553595 Y:15244934-15244956 CATAAATGGGGGAAGGTAAAGGG + Intergenic