ID: 1190311869

View in Genome Browser
Species Human (GRCh38)
Location X:49122589-49122611
Sequence TTCAATGGGGAAGGGTAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 251}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190311859_1190311869 -5 Left 1190311859 X:49122571-49122593 CCTTCTTCCTCTTCTTCCTTCAA 0: 1
1: 0
2: 18
3: 277
4: 2114
Right 1190311869 X:49122589-49122611 TTCAATGGGGAAGGGTAAAGGGG 0: 1
1: 0
2: 1
3: 17
4: 251
1190311858_1190311869 -2 Left 1190311858 X:49122568-49122590 CCACCTTCTTCCTCTTCTTCCTT 0: 2
1: 32
2: 277
3: 1646
4: 7228
Right 1190311869 X:49122589-49122611 TTCAATGGGGAAGGGTAAAGGGG 0: 1
1: 0
2: 1
3: 17
4: 251
1190311856_1190311869 11 Left 1190311856 X:49122555-49122577 CCACTCTATCCTTCCACCTTCTT 0: 1
1: 0
2: 8
3: 76
4: 1003
Right 1190311869 X:49122589-49122611 TTCAATGGGGAAGGGTAAAGGGG 0: 1
1: 0
2: 1
3: 17
4: 251
1190311855_1190311869 12 Left 1190311855 X:49122554-49122576 CCCACTCTATCCTTCCACCTTCT 0: 1
1: 0
2: 2
3: 56
4: 646
Right 1190311869 X:49122589-49122611 TTCAATGGGGAAGGGTAAAGGGG 0: 1
1: 0
2: 1
3: 17
4: 251
1190311857_1190311869 2 Left 1190311857 X:49122564-49122586 CCTTCCACCTTCTTCCTCTTCTT 0: 1
1: 5
2: 42
3: 365
4: 2452
Right 1190311869 X:49122589-49122611 TTCAATGGGGAAGGGTAAAGGGG 0: 1
1: 0
2: 1
3: 17
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190311869 Original CRISPR TTCAATGGGGAAGGGTAAAG GGG Intronic
901241054 1:7693672-7693694 TTCCATGGGGAAGAGGACAGTGG - Intronic
901279052 1:8018099-8018121 TTCAATGGGGAATTGTGAATGGG + Intronic
901595555 1:10382728-10382750 TTGGGTGGGGAAGGGTAAATGGG + Intergenic
902272558 1:15315014-15315036 GTCAACGGGGAAGGGAAATGGGG - Intronic
902435697 1:16397065-16397087 TTAATTGGAGAAGGGTATAGAGG + Exonic
903995964 1:27305773-27305795 CTCAATGGGGAAGCCTATAGGGG - Intronic
905454568 1:38079203-38079225 TCCAGTGAGGAAGGGTAAGGAGG - Intergenic
905499031 1:38421126-38421148 ATCAATGGGCAAAGGGAAAGTGG + Intergenic
905979123 1:42207515-42207537 TTCAATGGTAAATGTTAAAGAGG + Intronic
906204133 1:43978327-43978349 TTCACAGAGGAAGGGTAAAGAGG + Intergenic
906516904 1:46444812-46444834 TTCACTGTGGAAGGGTAACCAGG + Intergenic
907572960 1:55500717-55500739 ATCAGTGGGGAATGGGAAAGAGG + Intergenic
907668158 1:56451163-56451185 GTCAGTGGGGAAGGAGAAAGAGG - Intergenic
907695962 1:56729307-56729329 TGCATTGGGGATGGGAAAAGTGG + Intronic
908840753 1:68277957-68277979 ATGAATGGGGATGGGTGAAGTGG - Intergenic
909502019 1:76345220-76345242 TTAAAATGGGAAAGGTAAAGAGG - Intronic
909768617 1:79390999-79391021 TTCACTGGGGAAGGGTTAACAGG - Intergenic
910267351 1:85351799-85351821 AGCCATGGGGAAGGGTAAATGGG + Intronic
910451262 1:87348265-87348287 TTCCCTGGTGAAGGGTGAAGGGG - Exonic
911005711 1:93220570-93220592 GTAAAGGGGGAGGGGTAAAGGGG + Intronic
912643594 1:111370201-111370223 TTCATGGTGGAAGGGTAAAGGGG - Intergenic
915201432 1:154232556-154232578 TTCACTGGGGAAAGTTAAATTGG + Intronic
915850897 1:159321644-159321666 TTCTCTGTGAAAGGGTAAAGTGG + Intergenic
917569960 1:176254945-176254967 TTCAAAGGGGAAGGGGAAGATGG + Intergenic
918077337 1:181180676-181180698 AACAATGGGGAAGGGGAATGAGG - Intergenic
918431603 1:184466566-184466588 TTAAATGTGGTAGGTTAAAGGGG + Intronic
919242450 1:194932424-194932446 ATCAATGGGGAAGGGCATGGCGG - Intergenic
920801991 1:209197262-209197284 TTCACTGGGGAGATGTAAAGGGG - Intergenic
921398394 1:214693368-214693390 TTCAAGGTGGAAGGCAAAAGGGG - Intergenic
921428470 1:215033690-215033712 TTCCATGTGGAAGGATAGAGGGG + Intronic
922439851 1:225645873-225645895 TTGAATGGTGTAGGGTAAAGAGG - Intronic
1067272053 10:44800494-44800516 AAGAATGGGGGAGGGTAAAGGGG + Intergenic
1067551120 10:47237349-47237371 TTCCGTGGGCAAGAGTAAAGTGG - Intergenic
1069111320 10:64450747-64450769 TTGAATTGGGATGGGGAAAGGGG + Intergenic
1069143570 10:64860234-64860256 TTCAAAGAGAAAGGCTAAAGAGG - Intergenic
1069872044 10:71539194-71539216 TTCCCAGGGGAAGGGCAAAGGGG - Intronic
1074619634 10:115105891-115105913 GTCAGTGTGGAAGGGAAAAGTGG + Intronic
1075789942 10:125076874-125076896 TTAAAGGGGGAAGGATGAAGAGG - Intronic
1079015871 11:16868160-16868182 TTCAATGGGAATTGATAAAGGGG - Intronic
1082835865 11:57649780-57649802 TTCAATTGGGAAGGGGATGGGGG + Intronic
1086609928 11:88743350-88743372 TTCTAGGGGGAAGGGGAAAGTGG + Intronic
1088960885 11:114663211-114663233 TGGAAAGGGGAAGGGAAAAGAGG + Intergenic
1095496381 12:42788863-42788885 TTCTAAGGGGAAGGGGAAAATGG - Intergenic
1096279021 12:50235655-50235677 TCTAATGGGGTAGGGTAAAAGGG + Intronic
1096709647 12:53445991-53446013 TGCAAGGGGAAAGGGGAAAGGGG - Intronic
1097980208 12:65730331-65730353 TTCTATTGGGAAGGGTAAGAAGG + Intergenic
1099644620 12:85336688-85336710 TTCAGTGGGGAAATGAAAAGTGG + Intergenic
1100250856 12:92822104-92822126 TACAATGGGGGAGGGTGAAATGG - Intronic
1101049126 12:100842741-100842763 TAGAAGGTGGAAGGGTAAAGGGG + Intronic
1101076055 12:101130847-101130869 GGCAATGGGGAAGGGGAAGGTGG - Intergenic
1102869314 12:116401171-116401193 ATCATGGGGGAAGGGTAAAGGGG + Intergenic
1103614974 12:122146083-122146105 TTCCTTGGGGAAGGGAAAGGAGG + Exonic
1105790097 13:23790217-23790239 TGCAGTAGTGAAGGGTAAAGAGG - Intronic
1106137102 13:26981552-26981574 TTTGATGGGGAAGGGGACAGAGG + Intergenic
1106970173 13:35130238-35130260 TTTAAAAGAGAAGGGTAAAGTGG + Intronic
1107001380 13:35549652-35549674 TTCAAGCAGGAAGGGCAAAGTGG + Intronic
1107511604 13:41091211-41091233 TTCAGTGGGGAAGGGTAGGAGGG + Intergenic
1109801869 13:67390580-67390602 CCCACTGGGGAAGGGGAAAGGGG - Intergenic
1110932780 13:81243461-81243483 TGAAATAGGGAAGGGGAAAGTGG - Intergenic
1112247086 13:97745229-97745251 TGCAATGGGGAGGTGGAAAGGGG - Intergenic
1112783824 13:102930073-102930095 ATCAATGGAGAAGAGTGAAGAGG - Intergenic
1113831632 13:113300139-113300161 TTCAAGTGGAAAGGGTAAGGCGG - Intronic
1113843041 13:113371250-113371272 TCCACTGGGGAAGGGAGAAGAGG - Intergenic
1114768515 14:25402316-25402338 TTTAATGGGGAAAAATAAAGGGG - Intergenic
1116310169 14:43315108-43315130 TTCAATGGGGAAAGTTATAAAGG + Intergenic
1118906417 14:70027003-70027025 ATCAATGGGGTGGGGTGAAGTGG + Intronic
1120709148 14:87775034-87775056 ATAAATGAGGAAGGGGAAAGAGG + Intergenic
1120746232 14:88154449-88154471 TACAACGGGGAAGGGAAAATGGG + Intergenic
1121933012 14:97990529-97990551 CTCAATGGAGTAGGATAAAGGGG - Intergenic
1121935605 14:98015685-98015707 TTTAATGGAGAAGCCTAAAGGGG - Intergenic
1122345032 14:101053410-101053432 TTTTATGGGGAAAGGGAAAGCGG + Intergenic
1126016224 15:44353787-44353809 CTTATTGGGGAAGGGTAAGGGGG + Intronic
1128658757 15:69482727-69482749 TTCACAGGGAAAGGGCAAAGAGG + Intergenic
1130948700 15:88568586-88568608 TTTAATGGGGAATGGGAGAGAGG - Intergenic
1139229735 16:65272213-65272235 TTCAATGTGGGAGGGTAGTGTGG - Intergenic
1139314440 16:66056365-66056387 TTTTAGGGGGTAGGGTAAAGGGG + Intergenic
1139714617 16:68802880-68802902 TACAATGGGGAAGGGTCTTGTGG - Intronic
1140054271 16:71511711-71511733 TCAAATTGGGAAGAGTAAAGTGG - Intronic
1141291743 16:82724119-82724141 TACAATTGTGCAGGGTAAAGAGG + Intronic
1141315328 16:82957125-82957147 GTCAGTGGGAAAGGGGAAAGGGG + Intronic
1142180128 16:88664243-88664265 TTAAAAGGGGAAGGGGAAAATGG - Intergenic
1144259323 17:13502644-13502666 TAAAATGGGGAAGGGTAATAGGG - Intronic
1146518333 17:33507032-33507054 TTCACTGGGGCAGGGTCAAGGGG + Intronic
1147492091 17:40879167-40879189 TTCCAAGGGCAAGGCTAAAGGGG - Intronic
1149287569 17:55181933-55181955 TCCTATGAGTAAGGGTAAAGTGG + Intergenic
1151799610 17:76370333-76370355 GTCAGTGGGGAAGGGGAAGGAGG - Intronic
1155677118 18:28442408-28442430 TTTAATGTGGGAGGGTGAAGTGG + Intergenic
1156782584 18:40869001-40869023 TAAAATGGGGGAGGGTAAAAAGG - Intergenic
1157051104 18:44166228-44166250 TTCAATGTGGAAGAATGAAGAGG - Intergenic
1157476842 18:48029183-48029205 ATCCATGGGGTAGGGTAGAGTGG + Exonic
1159903679 18:74071669-74071691 AGCAATGGGGAAGGGTGAGGCGG - Intergenic
1160071702 18:75634861-75634883 TTCATGGTGGAAGGGCAAAGGGG - Intergenic
1160510479 18:79450812-79450834 TTCCTTGGGGAAGGGGAGAGTGG + Intronic
1161751894 19:6104171-6104193 ATGAATGGGGCAGGGGAAAGAGG - Intronic
1161980996 19:7630264-7630286 TTAAGTGGGGATGGGTAATGAGG + Intronic
1165326323 19:35116429-35116451 TTCTATGGGGCAGGGTCAGGGGG - Intronic
1165378490 19:35460876-35460898 TTCACTGAGGAAGAGAAAAGAGG + Intergenic
1166385619 19:42378911-42378933 TTAAAGGGGGAAGGGGGAAGGGG + Intergenic
1166624169 19:44334890-44334912 GTCAATGGAGAAGGGAAATGTGG + Intronic
1166987388 19:46669372-46669394 TTCAAGGGGAAAGGGAAATGGGG + Intergenic
925117662 2:1394129-1394151 TTCAATGTGGAAGGTGATAGTGG - Intronic
928298186 2:30103543-30103565 TTTAGTGGGGAAGAGAAAAGGGG + Intergenic
929306875 2:40373456-40373478 TTTTAGGGGGAAGGGGAAAGAGG - Intronic
929430266 2:41880359-41880381 AACCATGGGGATGGGTAAAGGGG - Intergenic
932348012 2:71008111-71008133 TGCTATGAGGAAAGGTAAAGTGG - Intergenic
937377522 2:121347867-121347889 TTCACTGGGGAAAGGTAGAGAGG - Intronic
937427670 2:121813587-121813609 GGCAATGGGGAAGGGAAATGTGG + Intergenic
938085706 2:128400080-128400102 CTCAATGGGGGAGGATAAAGGGG - Intergenic
938101005 2:128498260-128498282 TTCAAAGGGGAAAGGAGAAGAGG + Intergenic
938895603 2:135747119-135747141 TGCAATGAGGAAGGCCAAAGTGG + Intronic
940442064 2:153727890-153727912 GTCAGTGGGTAAGGGGAAAGTGG - Intergenic
941382598 2:164814199-164814221 TCAGATGGGGAAGGGTAGAGGGG - Intronic
941607577 2:167619251-167619273 TTCAATGGGGAGGGGACAGGGGG - Intergenic
943355081 2:186845037-186845059 TTCAAAGGGAAAGGATAATGAGG + Intronic
946128856 2:217589277-217589299 ATATATGGGGGAGGGTAAAGGGG - Intronic
946381124 2:219349806-219349828 TTTGATGGGGAAAAGTAAAGTGG + Intergenic
947859457 2:233348425-233348447 TTTAAGGGAGCAGGGTAAAGGGG + Intergenic
948138208 2:235652886-235652908 TTGAATGGGGCAGGGTGTAGAGG + Intronic
948397104 2:237653062-237653084 ATCATGGTGGAAGGGTAAAGGGG - Intronic
948621547 2:239238406-239238428 TCCAATGGGAAGGGGTCAAGAGG + Intronic
1168974718 20:1955682-1955704 TTCATCGGGGAAGGGGAAATGGG - Intergenic
1169976217 20:11331463-11331485 TTAAATGGTGTAGGATAAAGTGG - Intergenic
1170487043 20:16828868-16828890 TTCAGTGGGGAAGTGGGAAGGGG + Intergenic
1170565563 20:17601274-17601296 TTCAATGGGGAAAGGACAGGAGG + Intronic
1173392287 20:42646075-42646097 AGCAATGGGGATGGGTATAGTGG - Intronic
1174735510 20:52962154-52962176 TACAATGGGGAAAAGGAAAGAGG + Intergenic
1176233205 20:64042333-64042355 TTTAATGGGGAGGGGAAGAGCGG - Intronic
1177734481 21:25072001-25072023 GTCAATTGGGAGGGATAAAGAGG + Intergenic
1179160266 21:38890347-38890369 TTCACAGGGGAAGGGAAAATGGG - Intergenic
1179510823 21:41872168-41872190 GCAAATGGGGAAGGGGAAAGGGG - Intronic
1181624681 22:24115231-24115253 TTAAATGGGGAAGGGGACATGGG + Intronic
1182070752 22:27462125-27462147 TGGAAAGGGGAAGGGTATAGAGG + Intergenic
949279320 3:2327922-2327944 TTCAGTGGGGAAGGGGTGAGGGG - Intronic
950670944 3:14525094-14525116 TTGAGTGTGGAGGGGTAAAGAGG + Intronic
950726152 3:14918356-14918378 TACCATGGGGAAGGGGAAGGAGG + Intronic
951531230 3:23699953-23699975 TGCAATGGGGAAGAGCAATGGGG + Intergenic
951910930 3:27749521-27749543 TCCAAAGGAAAAGGGTAAAGAGG + Intergenic
952166212 3:30751925-30751947 TTGAATGGCAAAGGGTAATGAGG + Intronic
952649888 3:35713023-35713045 TTCAGTGGGGATGGGTAATAAGG + Intronic
953332669 3:42066833-42066855 TTCAATGAGAAAGGCTAATGGGG + Intronic
954565343 3:51595283-51595305 CTCTATGGGAAAGGGTAATGAGG + Intronic
954997349 3:54893884-54893906 TTGAAAGGGCAGGGGTAAAGTGG - Intronic
955793582 3:62612466-62612488 ATGAATGGGGAAGGGGCAAGTGG - Intronic
959108126 3:102089512-102089534 TTCAATGGGGAAGGAAAACCAGG - Intergenic
959145185 3:102535497-102535519 ATCAATGAGGAAAGGTAATGTGG - Intergenic
959686522 3:109153316-109153338 TTCAATGGTAAAGGGTATAACGG - Intergenic
959856186 3:111161690-111161712 TTCCATGGAGCAGGGTACAGGGG - Intronic
959893014 3:111577877-111577899 TAAAATGGAGAAGGGTAAACAGG - Intronic
960884109 3:122376806-122376828 TCCAAAGGGCAAGGGTAAGGAGG + Intronic
961709167 3:128813856-128813878 TTCAAGGAGGGAGGGGAAAGGGG - Exonic
961771959 3:129256532-129256554 GTCACTGAGGAAGAGTAAAGTGG - Intronic
962654777 3:137531991-137532013 TTCTAGGAGCAAGGGTAAAGGGG - Intergenic
963416377 3:145000565-145000587 TTCAATGAAGAGGGGAAAAGTGG - Intergenic
964779129 3:160315691-160315713 TACAATGGCAAAGGGAAAAGAGG - Intronic
965118113 3:164517803-164517825 TTCAGTGGGGAAAGATAAAAAGG - Intergenic
965904737 3:173689728-173689750 TTGAATGGGGCAAGGTAGAGTGG - Intronic
966848929 3:184152510-184152532 TTTAAGAGGGAAGGGTAAGGTGG + Intronic
968621630 4:1605865-1605887 TCCAGTGGGGAGGGGGAAAGGGG - Intergenic
969388981 4:6876627-6876649 TGGAATGGAGAAGGGAAAAGAGG - Intronic
971499225 4:27300550-27300572 GTCAATGTGGAAGGGAAATGTGG - Intergenic
972322130 4:37981702-37981724 TTGAGTGGGGAGGGGTAAGGTGG + Intronic
972700105 4:41486072-41486094 ATCAATGGGCAAGGATCAAGAGG + Intronic
972718192 4:41669752-41669774 TTCAATTGGGATGGGGAAATGGG + Intronic
973123534 4:46554500-46554522 TTCAATGGGTAAGTAAAAAGTGG - Intergenic
973977844 4:56280957-56280979 TTGAATAGGGAATGGTGAAGAGG + Intronic
974016200 4:56651545-56651567 ATCAATGGGCAAGGGTAATGAGG - Intronic
974303502 4:60100523-60100545 TTCAGTTGTGAAGGATAAAGAGG + Intergenic
976299232 4:83502239-83502261 TTCAGTGGGGCTGGGTACAGTGG - Intronic
978392495 4:108241911-108241933 TACCATGGGGAAGGGTTATGAGG + Intergenic
978713378 4:111812236-111812258 TTCAATGGGGAAGTGGATAGGGG + Intergenic
978903499 4:113979973-113979995 GCGAATGGGGAAGGGTAAAGCGG + Intergenic
980206557 4:129726591-129726613 TTCAATGCAGAAGGGGAAATGGG - Intergenic
981590886 4:146359550-146359572 TTCACAGAGGAAGTGTAAAGGGG + Intronic
981695263 4:147553087-147553109 GTCAGTGGGGAAGGGAAATGTGG + Intergenic
983143535 4:164184403-164184425 TTCAATGTGGAAGCTAAAAGTGG - Intronic
984173956 4:176393492-176393514 TTCAATGGGGAAGGGCTAAATGG - Intergenic
985181602 4:187271167-187271189 TTCCATGGGGAAGGCAAAAATGG - Intergenic
986082896 5:4412515-4412537 TTAAATTTGGAAGGGTAGAGAGG + Intergenic
987050335 5:14143325-14143347 TTCAATGGGGAAGGAAGGAGGGG - Intergenic
989138718 5:38181397-38181419 TACATGGGGGAAGGGTAAACGGG - Intergenic
989676732 5:43981750-43981772 TTCCCTGGGGCAGGGTAAGGTGG - Intergenic
991115174 5:62946616-62946638 TGCAATGGTGAATGGTAAAAAGG - Intergenic
991191013 5:63873768-63873790 TTAAATAGGGAAGGGTTAATAGG - Intergenic
991331578 5:65498442-65498464 GTAACTGGGGAAAGGTAAAGAGG - Intergenic
992056498 5:72996564-72996586 TTAATTGGGGAAGGGGACAGTGG - Intronic
993147246 5:84111135-84111157 ATCATGGGGGAAGGGCAAAGGGG - Intronic
994337008 5:98578794-98578816 TAAAAGGGGGAAGGGTAGAGAGG - Intergenic
996573223 5:124955286-124955308 TTCAGTGGGAAATGGTACAGTGG + Intergenic
997974829 5:138434943-138434965 TGCAAAGGGGAAGGGTACATGGG - Intronic
998053166 5:139053258-139053280 ATCAATGTGGTAGAGTAAAGGGG - Intronic
998543269 5:143003511-143003533 TTCTATGGGGCAGGGTTTAGGGG - Intronic
998656912 5:144191478-144191500 TTCTATGTAGAAGGGAAAAGTGG - Intronic
1003982780 6:11405071-11405093 TAGAATGGGGAAGGGGATAGGGG + Intergenic
1004479433 6:16004764-16004786 TTTAATGGGGCCGGGTACAGTGG - Intergenic
1006095854 6:31656286-31656308 TTGACTGGGGAGGGGCAAAGAGG + Intronic
1006185000 6:32176458-32176480 TTGAATGGGTACGGGAAAAGGGG - Intronic
1007156123 6:39745820-39745842 TTCAATGAGGAAGGAAATAGTGG - Intergenic
1007401045 6:41602485-41602507 TTCAAGGGGGCAGAGTAAGGGGG - Intergenic
1010036442 6:71330894-71330916 ATCAATGGGAAAGGGATAAGAGG - Intergenic
1013029594 6:106320264-106320286 TTTCATGGGGCAGGGGAAAGAGG + Intronic
1013294135 6:108743583-108743605 TCCAGTGGGGTAGGGTGAAGGGG + Intergenic
1014670306 6:124295853-124295875 TTTTATGGAGAAGAGTAAAGGGG - Intronic
1014708699 6:124780554-124780576 TTTAATATGGAAGAGTAAAGGGG + Intronic
1015098977 6:129451705-129451727 TTCAAAAGAGAAGGCTAAAGAGG - Intronic
1015195083 6:130516834-130516856 ATCATGGTGGAAGGGTAAAGGGG - Intergenic
1016863115 6:148741544-148741566 TTCCATGGAGAAAGCTAAAGAGG + Intergenic
1020389457 7:7642770-7642792 TTCATTGGGGAAGTGCAAACTGG - Intronic
1020548398 7:9565421-9565443 TTCAGTGGGGAAGGGAAGGGGGG + Intergenic
1021176892 7:17459716-17459738 TTGAATGTGGAAAGGTAAGGAGG - Intergenic
1021388442 7:20061566-20061588 TTCAATGGGAAAGAATAAATGGG + Intergenic
1021594376 7:22299412-22299434 ATAATTGGGGAAGGATAAAGAGG - Intronic
1021688632 7:23211507-23211529 TTCAAATGGGAAGGGAGAAGAGG - Intergenic
1022467383 7:30660894-30660916 TGCAATGGGGCAGGTAAAAGAGG - Intronic
1024007771 7:45239868-45239890 TTCTAGAGGGAAGTGTAAAGTGG + Intergenic
1025725852 7:64058885-64058907 GTCAATAGTGAAGGGTAAAGAGG - Intronic
1025754591 7:64325042-64325064 GTCAATAGTGAAGGGGAAAGAGG - Intronic
1026505847 7:70982407-70982429 TTCACAGGGGATGGGCAAAGTGG - Intergenic
1027626335 7:80549211-80549233 TTCAAAGGGAAAGGTTAAAATGG - Intronic
1028274421 7:88835922-88835944 GTCTATGGGAAAGAGTAAAGAGG + Intronic
1031120385 7:117715219-117715241 TTCTATGGGGAGGAGTACAGAGG + Intronic
1031276858 7:119735744-119735766 TACAATGAGGAAGGTAAAAGTGG - Intergenic
1032143428 7:129355868-129355890 TTCAATGGGGAAAGGTTAAAAGG + Intronic
1032351410 7:131167071-131167093 TACAATGGGGAAGAGGAAACTGG - Intronic
1032791374 7:135245574-135245596 TCCCATGGGGAAGGGGACAGAGG + Intronic
1032943618 7:136824573-136824595 TTCATTTGGGAATGGGAAAGGGG - Intergenic
1033121710 7:138672210-138672232 CTGAATGGGGAAGGACAAAGGGG - Intronic
1034522424 7:151631597-151631619 TTTAATGGGGAAAGTTAAATAGG - Intronic
1034647455 7:152661444-152661466 TTCACTGGGGAAGGGGACAAAGG + Intronic
1039474138 8:37830535-37830557 CTCTAGGGGTAAGGGTAAAGGGG - Intronic
1039923808 8:41911248-41911270 TGCCATGGGGAAGGGAACAGAGG + Intergenic
1041533611 8:58900097-58900119 TTCAAAGAGGAAGGGTCAAATGG - Intronic
1041992374 8:64008818-64008840 TGCAATGGTGAAGGGGAAAAGGG + Intergenic
1042942914 8:74125807-74125829 GTAAATGGGAAAGGGTAAAATGG - Intergenic
1043813201 8:84768419-84768441 TTCCATGGAGGAGGGTACAGTGG - Intronic
1044770262 8:95623764-95623786 TTCAAGGGGGAAAGGAAAGGGGG + Intergenic
1046569386 8:115943867-115943889 TGCAATGGGGAGATGTAAAGAGG + Intergenic
1048624585 8:136171478-136171500 TTCACTGGTGAAAGGTATAGCGG + Intergenic
1049354306 8:142180010-142180032 TTCAGCGGGGAAGGGGACAGAGG + Intergenic
1051291719 9:15552478-15552500 TACAATGGGGACGGGAAGAGGGG + Intergenic
1052034271 9:23662336-23662358 TTTACTGGGGGAGGGTACAGGGG - Intergenic
1053182177 9:35982186-35982208 TTAAATGGGAAAGGGAAAACTGG - Intergenic
1053183501 9:35994405-35994427 TTAAATGGGAAAGGGAAAACTGG - Intergenic
1055026090 9:71723195-71723217 TATAATGGAGAAGGCTAAAGAGG + Intronic
1055331574 9:75189539-75189561 TTCCATGGGGAAGAGTAAAGGGG - Intergenic
1056383058 9:86073075-86073097 TTCACTGAAGAAGGGTAAAAAGG + Intronic
1056886306 9:90447260-90447282 TTAATTTGGGAAGTGTAAAGAGG + Intergenic
1058654127 9:107204160-107204182 TGCCAAGGAGAAGGGTAAAGGGG - Intergenic
1059147680 9:111916329-111916351 TTGAATGGGGAAAGTGAAAGAGG - Intronic
1059323854 9:113490320-113490342 TTCACTGGAGAAGGGGAAAGTGG - Intronic
1059875171 9:118626810-118626832 TTGAATGGGAAAGGTGAAAGAGG - Intergenic
1060463662 9:123882986-123883008 TTCAGTGGGCAAGGGGAGAGAGG - Intronic
1186302833 X:8219151-8219173 TTCAATGGAAAAGGGAAAACAGG - Intergenic
1187214307 X:17261329-17261351 TTGGAAGGGGAAGGGTACAGGGG + Intergenic
1188127127 X:26383348-26383370 GTCAATGTGGAAGGGAAATGTGG + Intergenic
1188383947 X:29532845-29532867 GTCAATGGGGTAGGGAAGAGAGG - Intronic
1189173314 X:38930413-38930435 GACTATGGGGAAGGGTGAAGAGG - Intergenic
1189652786 X:43208265-43208287 GTCACTGGGGAAGGGAAATGTGG + Intergenic
1190311869 X:49122589-49122611 TTCAATGGGGAAGGGTAAAGGGG + Intronic
1190940763 X:55038539-55038561 TTAAATGGGGAAGTTTAAATAGG + Intergenic
1191133856 X:57043062-57043084 ATCAATGGGGAAAGTGAAAGTGG - Intergenic
1192288495 X:69764678-69764700 ATCAATGAAGAAAGGTAAAGGGG - Intronic
1192294962 X:69837773-69837795 TTCAACAGGGTATGGTAAAGAGG - Intronic
1193871008 X:86798646-86798668 TTCACTGGGGATGGGTGAACTGG + Intronic
1195378428 X:104249799-104249821 CCCAATGGGGCAGGGTAGAGGGG + Intergenic
1195584294 X:106546377-106546399 TTCAATGGGTAATGGTTAAATGG - Intergenic
1195999856 X:110770708-110770730 TTAAAAGGGTAAGGGTAAAAAGG + Intronic
1196236920 X:113292395-113292417 AGCAAGGGGGGAGGGTAAAGGGG + Intergenic
1196510441 X:116504551-116504573 ATAAAAGGGGAAGGGTAAAAGGG - Intergenic
1199693049 X:150323615-150323637 ATAAATGGGGGAGGGTAAAGGGG + Intergenic
1201320511 Y:12693583-12693605 TTCAGTGGGGAGGGGACAAGGGG + Intergenic