ID: 1190312631

View in Genome Browser
Species Human (GRCh38)
Location X:49127860-49127882
Sequence ATGTATTTAAAGGTGAGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190312628_1190312631 14 Left 1190312628 X:49127823-49127845 CCACTTTGCTTTTCAAGGTACAA No data
Right 1190312631 X:49127860-49127882 ATGTATTTAAAGGTGAGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190312631 Original CRISPR ATGTATTTAAAGGTGAGGCA CGG Intergenic
No off target data available for this crispr