ID: 1190314683

View in Genome Browser
Species Human (GRCh38)
Location X:49142875-49142897
Sequence GTTCTAGTGTGTACATACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190314683_1190314689 29 Left 1190314683 X:49142875-49142897 CCAGAGTATGTACACACTAGAAC No data
Right 1190314689 X:49142927-49142949 GCATCTTGGTGAAGTCTACTTGG No data
1190314683_1190314686 15 Left 1190314683 X:49142875-49142897 CCAGAGTATGTACACACTAGAAC No data
Right 1190314686 X:49142913-49142935 ACCTCCACATTTGGGCATCTTGG 0: 7
1: 3
2: 3
3: 19
4: 126
1190314683_1190314684 6 Left 1190314683 X:49142875-49142897 CCAGAGTATGTACACACTAGAAC No data
Right 1190314684 X:49142904-49142926 ATACTTGTTACCTCCACATTTGG 0: 12
1: 10
2: 6
3: 15
4: 102
1190314683_1190314685 7 Left 1190314683 X:49142875-49142897 CCAGAGTATGTACACACTAGAAC No data
Right 1190314685 X:49142905-49142927 TACTTGTTACCTCCACATTTGGG 0: 21
1: 43
2: 30
3: 23
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190314683 Original CRISPR GTTCTAGTGTGTACATACTC TGG (reversed) Intergenic
No off target data available for this crispr