ID: 1190318779

View in Genome Browser
Species Human (GRCh38)
Location X:49167164-49167186
Sequence TTTTTAGCCCGGCCCGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 27}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190318779_1190318787 22 Left 1190318779 X:49167164-49167186 CCCTGGACGGGCCGGGCTAAAAA 0: 1
1: 0
2: 0
3: 4
4: 27
Right 1190318787 X:49167209-49167231 GTGCCCCCATTTTCCGTACATGG 0: 1
1: 0
2: 0
3: 6
4: 49
1190318779_1190318784 -3 Left 1190318779 X:49167164-49167186 CCCTGGACGGGCCGGGCTAAAAA 0: 1
1: 0
2: 0
3: 4
4: 27
Right 1190318784 X:49167184-49167206 AAAAGGCTGTTAGAACCTTTGGG 0: 1
1: 0
2: 0
3: 10
4: 220
1190318779_1190318783 -4 Left 1190318779 X:49167164-49167186 CCCTGGACGGGCCGGGCTAAAAA 0: 1
1: 0
2: 0
3: 4
4: 27
Right 1190318783 X:49167183-49167205 AAAAAGGCTGTTAGAACCTTTGG 0: 1
1: 0
2: 0
3: 11
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190318779 Original CRISPR TTTTTAGCCCGGCCCGTCCA GGG (reversed) Intronic
908225486 1:62052051-62052073 TTTGTAGCCCAGCACTTCCAGGG + Intronic
921738836 1:218660117-218660139 TTTTTAGCCTGACCCGTCACAGG + Intergenic
922167849 1:223130517-223130539 TTCTCAGACCGGCCCATCCAAGG - Intronic
924114861 1:240735258-240735280 TTATTAGTCAGGCCCCTCCAGGG - Intergenic
1068254414 10:54490972-54490994 TTTTTAGCCCACCCTGGCCAGGG + Intronic
1095516263 12:43009215-43009237 TTTTTAGCTCTGCCTGTTCAAGG - Intergenic
1114856754 14:26456048-26456070 TTTTTAGCCCAGCTCTTTCAGGG + Intronic
1121947478 14:98136964-98136986 TTTTTAGGATGGCTCGTCCAGGG - Intergenic
1125204625 15:37139131-37139153 TTTTTTTCCCAGCCCTTCCAAGG + Intergenic
1137409379 16:48214797-48214819 TTTTTAGCCATGCCCCTCAAAGG - Intronic
1149347168 17:55750910-55750932 TTTCTAGGCCCGCCCCTCCAGGG + Intergenic
1159431757 18:68361702-68361724 TTTAAAGCCCAGCCCGGCCATGG - Intergenic
1163398689 19:17078769-17078791 TTTGAAGCCCGGCCTGTACAGGG + Intronic
927293414 2:21426319-21426341 TTTTTAGCCCTGCTCCTCCAAGG + Intergenic
928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG + Intronic
928992757 2:37252234-37252256 TTTTTAGCAGGGCCAGTGCAGGG - Exonic
1180874692 22:19169672-19169694 TTTCTTCCCCGGCCCGTCCAAGG - Intergenic
1181600410 22:23948695-23948717 TTTATAGCCAGTCCTGTCCAAGG - Intergenic
1181608100 22:23992632-23992654 TTTATAGCCAGTCCTGTCCAAGG + Intergenic
951985671 3:28617724-28617746 GTTATACCCCGGCCCATCCAAGG - Intergenic
967686249 3:192420017-192420039 TTTTTACCCTGGCCTTTCCAGGG - Intronic
968986473 4:3878048-3878070 TTTTTACCTTGGCCCATCCAAGG - Intergenic
968992219 4:3922067-3922089 TTTCTAGCCAGGCCCTTCCTGGG - Intergenic
972602862 4:40588020-40588042 TTTTTTGCCTGGCCAGTTCATGG + Intronic
993582111 5:89675849-89675871 TTTTTGGCCAGGCACTTCCAAGG + Intergenic
999753507 5:154647554-154647576 TTCTTAGCCCGGCCCCGCCAGGG + Intergenic
1006340492 6:33443845-33443867 GTTATGGCCCCGCCCGTCCACGG + Exonic
1026603859 7:71799332-71799354 TTTTAAGCCAGGCTCGTCCTGGG + Intronic
1035658033 8:1325827-1325849 TTTTTTGCAAGGACCGTCCATGG + Intergenic
1037401392 8:18498481-18498503 TCTTCAGCCCGACCCTTCCAAGG + Intergenic
1060257010 9:122040093-122040115 TTTTTATCCCTGCCAGTTCAAGG - Intronic
1190318779 X:49167164-49167186 TTTTTAGCCCGGCCCGTCCAGGG - Intronic