ID: 1190319723

View in Genome Browser
Species Human (GRCh38)
Location X:49172795-49172817
Sequence CTAGGTTACGGGCAGCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190319723_1190319731 -1 Left 1190319723 X:49172795-49172817 CCCTCAGGCTGCCCGTAACCTAG No data
Right 1190319731 X:49172817-49172839 GAAGGGAAAAGAGGAAACTGAGG No data
1190319723_1190319735 27 Left 1190319723 X:49172795-49172817 CCCTCAGGCTGCCCGTAACCTAG No data
Right 1190319735 X:49172845-49172867 AACTCTACTCCTTACTTGTTGGG No data
1190319723_1190319734 26 Left 1190319723 X:49172795-49172817 CCCTCAGGCTGCCCGTAACCTAG No data
Right 1190319734 X:49172844-49172866 CAACTCTACTCCTTACTTGTTGG No data
1190319723_1190319729 -10 Left 1190319723 X:49172795-49172817 CCCTCAGGCTGCCCGTAACCTAG No data
Right 1190319729 X:49172808-49172830 CGTAACCTAGAAGGGAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190319723 Original CRISPR CTAGGTTACGGGCAGCCTGA GGG (reversed) Intronic