ID: 1190320371

View in Genome Browser
Species Human (GRCh38)
Location X:49176344-49176366
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 254}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190320371_1190320389 18 Left 1190320371 X:49176344-49176366 CCTTCTTTCCTCCACTAAGACTG 0: 1
1: 0
2: 3
3: 23
4: 254
Right 1190320389 X:49176385-49176407 TCGGAGAATGGCAGGGAGGTGGG 0: 1
1: 0
2: 2
3: 27
4: 367
1190320371_1190320381 -6 Left 1190320371 X:49176344-49176366 CCTTCTTTCCTCCACTAAGACTG 0: 1
1: 0
2: 3
3: 23
4: 254
Right 1190320381 X:49176361-49176383 AGACTGGGAAAGTGGGGGCAGGG 0: 1
1: 0
2: 6
3: 63
4: 556
1190320371_1190320382 -5 Left 1190320371 X:49176344-49176366 CCTTCTTTCCTCCACTAAGACTG 0: 1
1: 0
2: 3
3: 23
4: 254
Right 1190320382 X:49176362-49176384 GACTGGGAAAGTGGGGGCAGGGG 0: 1
1: 2
2: 2
3: 86
4: 651
1190320371_1190320383 -1 Left 1190320371 X:49176344-49176366 CCTTCTTTCCTCCACTAAGACTG 0: 1
1: 0
2: 3
3: 23
4: 254
Right 1190320383 X:49176366-49176388 GGGAAAGTGGGGGCAGGGGTCGG 0: 1
1: 2
2: 19
3: 166
4: 1495
1190320371_1190320388 17 Left 1190320371 X:49176344-49176366 CCTTCTTTCCTCCACTAAGACTG 0: 1
1: 0
2: 3
3: 23
4: 254
Right 1190320388 X:49176384-49176406 GTCGGAGAATGGCAGGGAGGTGG 0: 1
1: 0
2: 6
3: 39
4: 454
1190320371_1190320387 14 Left 1190320371 X:49176344-49176366 CCTTCTTTCCTCCACTAAGACTG 0: 1
1: 0
2: 3
3: 23
4: 254
Right 1190320387 X:49176381-49176403 GGGGTCGGAGAATGGCAGGGAGG 0: 1
1: 0
2: 2
3: 34
4: 449
1190320371_1190320384 6 Left 1190320371 X:49176344-49176366 CCTTCTTTCCTCCACTAAGACTG 0: 1
1: 0
2: 3
3: 23
4: 254
Right 1190320384 X:49176373-49176395 TGGGGGCAGGGGTCGGAGAATGG 0: 1
1: 1
2: 8
3: 121
4: 1164
1190320371_1190320386 11 Left 1190320371 X:49176344-49176366 CCTTCTTTCCTCCACTAAGACTG 0: 1
1: 0
2: 3
3: 23
4: 254
Right 1190320386 X:49176378-49176400 GCAGGGGTCGGAGAATGGCAGGG 0: 1
1: 0
2: 0
3: 21
4: 435
1190320371_1190320380 -7 Left 1190320371 X:49176344-49176366 CCTTCTTTCCTCCACTAAGACTG 0: 1
1: 0
2: 3
3: 23
4: 254
Right 1190320380 X:49176360-49176382 AAGACTGGGAAAGTGGGGGCAGG 0: 1
1: 0
2: 1
3: 49
4: 489
1190320371_1190320385 10 Left 1190320371 X:49176344-49176366 CCTTCTTTCCTCCACTAAGACTG 0: 1
1: 0
2: 3
3: 23
4: 254
Right 1190320385 X:49176377-49176399 GGCAGGGGTCGGAGAATGGCAGG 0: 1
1: 0
2: 0
3: 85
4: 1671
1190320371_1190320390 26 Left 1190320371 X:49176344-49176366 CCTTCTTTCCTCCACTAAGACTG 0: 1
1: 0
2: 3
3: 23
4: 254
Right 1190320390 X:49176393-49176415 TGGCAGGGAGGTGGGAAGTCTGG 0: 1
1: 0
2: 3
3: 76
4: 648
1190320371_1190320391 27 Left 1190320371 X:49176344-49176366 CCTTCTTTCCTCCACTAAGACTG 0: 1
1: 0
2: 3
3: 23
4: 254
Right 1190320391 X:49176394-49176416 GGCAGGGAGGTGGGAAGTCTGGG 0: 1
1: 0
2: 4
3: 83
4: 723

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190320371 Original CRISPR CAGTCTTAGTGGAGGAAAGA AGG (reversed) Intronic
900554018 1:3270809-3270831 CAGTCCCAGGGGAGGAAAGTCGG + Intronic
901263357 1:7890174-7890196 CACTCTTAATGGAGGGAGGAGGG - Intergenic
901706362 1:11076488-11076510 CAGTGGTGGTGGAGGAAAAACGG - Intronic
902820839 1:18942282-18942304 TAGTCTTTGTGGGGGAATGAAGG - Intronic
903262662 1:22139739-22139761 CAGCCTCAGTGCAGGGAAGAGGG + Intronic
903700665 1:25246310-25246332 AAATCTTTTTGGAGGAAAGAGGG - Intronic
904544448 1:31257488-31257510 CAGTCATAGTGGAAGGCAGAGGG - Intergenic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
904891609 1:33783709-33783731 CAGTGTTAGTGTAGGAAAGATGG + Intronic
904981855 1:34510484-34510506 CAATATTAGTGGAGGTAAGGTGG + Intergenic
905208750 1:36358762-36358784 CAGTGTTTGGCGAGGAAAGATGG - Exonic
910258261 1:85271455-85271477 CAGTCTTGGTGGAAGGGAGATGG + Intronic
912067403 1:105761235-105761257 CACTGACAGTGGAGGAAAGAAGG + Intergenic
912245325 1:107956113-107956135 CACTCATAGTGCAGGAGAGAAGG + Intronic
912445773 1:109735107-109735129 CAGTCTTACTGCAGGCAAGTGGG - Exonic
912482202 1:109991804-109991826 AAGTCTAAGTGAATGAAAGATGG - Intronic
914838521 1:151228449-151228471 CTGTCTTTGTGGAGGAAAAGGGG - Intronic
915400761 1:155620041-155620063 GAGTGTTAGTGGAGGAATCATGG + Intergenic
915796055 1:158734794-158734816 TAGTCTTGGTGGAGGAGAGGAGG - Intergenic
918118934 1:181520956-181520978 CATTCTTCCTGGAGGAGAGAGGG - Intronic
920892593 1:210005177-210005199 CAGGCTTAGTAGGGGAAAGATGG + Intronic
921098976 1:211911957-211911979 CAGCTTTGGTGGAGGAAAGAAGG - Intergenic
921961423 1:221039009-221039031 CAGACTTAGTGGAAGAAGGGAGG - Intergenic
923095230 1:230770263-230770285 CAGTCTGAGGGCAGGAGAGACGG + Intronic
924121102 1:240798927-240798949 TAGACTTACTGGAGTAAAGATGG - Intronic
1064467170 10:15595578-15595600 CATTCAAAGTGGAGGAAAAATGG - Intronic
1065432815 10:25676568-25676590 CAGTCTAAGGGCAGGAAAGGTGG + Intergenic
1065817227 10:29493174-29493196 CCTTCTCAGTGGAGGAAAGACGG + Intronic
1065955618 10:30691269-30691291 CCTTCTCAGTGGAGGAAAGACGG - Intergenic
1069882455 10:71602259-71602281 TAGTGTTCATGGAGGAAAGATGG + Intronic
1070404974 10:76086430-76086452 CATTCTCAGTGGAGGAAACTAGG - Intronic
1070703853 10:78622973-78622995 AAATCTTAGGGAAGGAAAGAAGG + Intergenic
1070992331 10:80743310-80743332 CAGTATTAGTTGAAGAAAGTAGG + Intergenic
1073544248 10:104335640-104335662 CAGTCCAGGTGGAGGAAGGAGGG - Intronic
1074203352 10:111259230-111259252 CAGGCACAGTGGAGGAGAGAAGG - Intergenic
1074434040 10:113418593-113418615 AAGTCTTTGTGAAAGAAAGAAGG + Intergenic
1074686022 10:115963183-115963205 CATTCTTCCTGGAGAAAAGAGGG + Intergenic
1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG + Exonic
1075550908 10:123391614-123391636 CAGTCTGAGTTGGGGGAAGAGGG + Intergenic
1076990280 11:269648-269670 CCATCCTAGTGGAGGTAAGAAGG + Intergenic
1077498767 11:2899470-2899492 CAGGCTGACTGGAGGAAGGAAGG - Exonic
1078421110 11:11213701-11213723 CAGTATGATTGGAGGAAAGGAGG - Intergenic
1079534704 11:21499320-21499342 CATTATCAGTGGAGTAAAGATGG - Intronic
1080254944 11:30280256-30280278 CAGTCTGAGTAGAAGAAAAAGGG - Intergenic
1081090201 11:38855559-38855581 CAGTGATAGTGGAGGTAATAAGG - Intergenic
1083612231 11:64009776-64009798 CAGTCTCAGGGGAGCAGAGAAGG - Intronic
1085840442 11:80005611-80005633 GAGTCTGAGTGGAGGAGAAAGGG - Intergenic
1087219726 11:95533276-95533298 CAGTTTTAGTGGAGGCCACATGG + Intergenic
1090885098 11:130868827-130868849 CATTGTGAGTGTAGGAAAGATGG + Intergenic
1091005598 11:131950379-131950401 CAGAGATAGTGGAGGTAAGATGG - Intronic
1091857997 12:3754263-3754285 CAGCCTTATGTGAGGAAAGAAGG + Intronic
1092034854 12:5324238-5324260 CAGACACAGTGCAGGAAAGAAGG - Intergenic
1092951865 12:13511082-13511104 TAGACTTGGTGGAAGAAAGATGG + Intergenic
1094587943 12:31795116-31795138 CTGCCTAAGTGGAGGAAATAAGG + Intergenic
1097448715 12:59709838-59709860 CAGCCTAAGGGGAGGAAAGCTGG - Intronic
1097681574 12:62654606-62654628 AAGTTTTAGAGGAGGAACGAAGG - Intronic
1097997748 12:65908059-65908081 CACTCTTTGTGGAGAAAAGAAGG + Intronic
1098024115 12:66184852-66184874 TAGTTTTAGTGGAGTAAAGTGGG + Intergenic
1098967995 12:76814272-76814294 AAGTAGTAGTGGGGGAAAGATGG + Intronic
1099155763 12:79173994-79174016 CAGTCTAGGAGGAGTAAAGAAGG + Intronic
1099570233 12:84307991-84308013 AAGTCTTAGTGGAGGAAATAAGG + Intergenic
1099669991 12:85679128-85679150 TAGGCTCAGTGGTGGAAAGAGGG - Intergenic
1100010853 12:89951634-89951656 CAGGCTTTGTGAAAGAAAGAAGG + Intergenic
1100556320 12:95697522-95697544 GAATCTTAGTATAGGAAAGATGG - Intronic
1101207062 12:102499084-102499106 CAAACTCAGTGGTGGAAAGAAGG - Intergenic
1101580001 12:106034120-106034142 CAGTCTTTCTGGAGGAAATTAGG + Intergenic
1102818607 12:115888803-115888825 CCTTCTTAAAGGAGGAAAGAAGG + Intergenic
1106303004 13:28486459-28486481 CAGTCATACTGGAGGAAACCAGG + Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107777801 13:43864902-43864924 CAGTCTTCTGGGAGGAAAGAGGG + Intronic
1109983849 13:69948776-69948798 CAGACTTTGTAGATGAAAGATGG - Intronic
1110326805 13:74225838-74225860 CAGTCTAAGAAGAGGAAAGAGGG + Intergenic
1110819320 13:79896329-79896351 CAGTCATGGTGGAAGACAGAGGG + Intergenic
1111244306 13:85515349-85515371 CAGGGTCAGTGGAGGAAAGCGGG + Intergenic
1115778867 14:36747378-36747400 CATTACTAGTGGAAGAAAGATGG + Intronic
1117206607 14:53449967-53449989 GAGCCTTGCTGGAGGAAAGAAGG + Intergenic
1117764406 14:59065554-59065576 CAGTTTTATTGGAGGAAAGGAGG + Intergenic
1118996755 14:70843467-70843489 CCTTTTTATTGGAGGAAAGAAGG + Intergenic
1121189228 14:92010196-92010218 CAGTTTCAGTGGTAGAAAGAAGG - Intronic
1121334947 14:93071713-93071735 CAGAGTTTGTGGAGGAAAAAAGG - Intronic
1124766432 15:32489654-32489676 CAGTTTAAGTGGTGGGAAGAAGG - Intergenic
1124809628 15:32922217-32922239 CAGTTTTATGGAAGGAAAGAAGG + Intronic
1126425038 15:48518271-48518293 CAGTCTTAGTGGTGGGAATTTGG - Intronic
1128575590 15:68772333-68772355 CAGATTCAGTGGAGGGAAGATGG - Intergenic
1129432633 15:75511672-75511694 AAGTCTAAGTTGGGGAAAGACGG - Intronic
1130721420 15:86389344-86389366 CAATCTTGGTGGAAGAAACATGG + Intronic
1133654253 16:7844451-7844473 CAGTCTAAGTGGGAAAAAGAAGG + Intergenic
1135562630 16:23488235-23488257 CAGCCTTCCTGGGGGAAAGAAGG - Intronic
1136091074 16:27920465-27920487 CAGCCATGGTGGAGGACAGAAGG - Intronic
1138465703 16:57188074-57188096 TAGTATTCGTGGAGGAAAAAAGG - Intronic
1139003870 16:62547500-62547522 CAGGCTTAGAGGAGGAAGAAGGG - Intergenic
1142601723 17:1056308-1056330 CAGGCTGAGTGGAGGAGAGAAGG - Intronic
1143114790 17:4576385-4576407 CAGGGTTAGTGGAGGTAAGGAGG + Intergenic
1143390044 17:6555063-6555085 CAGGCACGGTGGAGGAAAGAGGG + Intronic
1144025146 17:11270907-11270929 CAGCCTCAGGGAAGGAAAGAGGG - Intronic
1144569118 17:16384658-16384680 CCGTCTTAGTGAAGGTAAAAGGG - Intergenic
1144576972 17:16435541-16435563 CAGTCTTGGTGGAGGCAGCAGGG - Intronic
1147535829 17:41322901-41322923 CAGACATAGAGGAGGGAAGATGG - Intergenic
1147904976 17:43816726-43816748 CAGCATTAGTGGAGGGAAGCGGG + Intronic
1147978302 17:44260268-44260290 GAGCCATAGTGGAGGAAAGTGGG + Intronic
1150233494 17:63573365-63573387 CAGCCTTTGTGGAGGAGAAACGG - Intronic
1152120935 17:78417767-78417789 GAGACTCAGTGGAGGAGAGAGGG + Intronic
1153043593 18:836232-836254 CAGTTTTAGTAGAAGAATGAGGG + Intergenic
1153335997 18:3925405-3925427 TAGTCTAAGTGGAGGTAAGTAGG - Intronic
1153942685 18:9991256-9991278 CAGTCTCTGTGGAGGCGAGAGGG - Intergenic
1155282247 18:24251339-24251361 CAGTCTTAGTGGTGGCCACATGG + Intronic
1156482409 18:37444664-37444686 CAGTTTCAGAGGAGGAAGGAGGG + Intronic
1157131494 18:45011810-45011832 CAGTCTCAGAAGATGAAAGATGG + Intronic
1157491486 18:48126885-48126907 CAGCCTTAGGGCAGGGAAGAAGG + Intronic
1158572560 18:58609393-58609415 CAGTCTTAAAGGAGGACACAGGG - Intronic
1159863888 18:73682137-73682159 CAGTCTCTGTGGAGCAAACAAGG + Intergenic
1161977591 19:7615104-7615126 CAGGCTGGGTGGAGGGAAGATGG + Intronic
1165004244 19:32791575-32791597 CAGTCTTAGAAGATGAAAGCAGG + Intronic
1165719576 19:38069528-38069550 CAGTCTTAGGTGAGGACAGAAGG - Intronic
1166017384 19:39992934-39992956 CAGTCATAGTGGAAGGCAGAGGG - Intronic
1166422819 19:42652021-42652043 CAGTGTCAGGGGAGGAGAGAGGG - Intronic
927532441 2:23820341-23820363 AAGTCTTAGTGTAGTTAAGATGG + Intronic
928040198 2:27867688-27867710 CAGTCCTAGAGGAAGAAAAAAGG + Intronic
928904740 2:36356705-36356727 GAGACTTTCTGGAGGAAAGAGGG + Intronic
929057912 2:37894454-37894476 CTGTCTTGATGGAGGAAAGCTGG - Intergenic
929746068 2:44660193-44660215 CTGTCTTAGTGGAAGACAGCTGG + Intronic
930148913 2:48038277-48038299 CAGACATAATGGAGGACAGAAGG - Intergenic
930403889 2:50929540-50929562 CAGTTTTGATGGAGGAGAGAGGG - Intronic
930912159 2:56641960-56641982 CAGTCTCAGTGGTGGAACTAGGG + Intergenic
931061722 2:58536885-58536907 CTGTTTTAGTGGAGAAAAGCAGG + Intergenic
931216288 2:60248023-60248045 AAGTGTTAGAGGAGGAAGGAAGG + Intergenic
933866706 2:86525441-86525463 TAGTCTTAATGGAGAAAAGCGGG - Intronic
938949183 2:136241517-136241539 CAGACTTGGTGGAGGTGAGAAGG - Intergenic
940935472 2:159489457-159489479 GAATCTTAGGGGAGGAAAAATGG + Intronic
942794013 2:179794744-179794766 CAATCATAATAGAGGAAAGAGGG + Intronic
942934465 2:181538204-181538226 CAGTCTTTATGGAGGAAGCATGG - Exonic
943452887 2:188067224-188067246 AAGTCATGCTGGAGGAAAGAAGG + Intergenic
944934537 2:204554149-204554171 AAGACGTAGAGGAGGAAAGAAGG - Intronic
945005020 2:205395857-205395879 CAGAGTTAGTGGAGGAGAAACGG - Intronic
945741061 2:213661906-213661928 CAGTCTTTGAGGAGGAAAGATGG - Intronic
946041146 2:216783814-216783836 CAGCCTTGGTGGAGCAGAGAGGG + Intergenic
946442148 2:219705573-219705595 CATTTTTAGTGGAGAGAAGAAGG + Intergenic
946466549 2:219917106-219917128 AAGTCTTAGTGGATAAAGGAGGG + Intergenic
948075939 2:235165266-235165288 CAGTGGGAGTGGTGGAAAGAAGG - Intergenic
948093331 2:235314179-235314201 CAGGCTGTGTGTAGGAAAGATGG - Intergenic
1169694215 20:8369195-8369217 GAGTCTCAGTGTAGGAAAGGTGG + Intronic
1171937288 20:31286832-31286854 AAGTGGAAGTGGAGGAAAGATGG - Intergenic
1172801757 20:37581063-37581085 TTGACTTTGTGGAGGAAAGATGG - Intergenic
1173999891 20:47366854-47366876 GAGTCTTAGTAATGGAAAGATGG - Intergenic
1174895293 20:54442772-54442794 CAATCATAGTAGAAGAAAGACGG - Intergenic
1176908684 21:14535932-14535954 CAGACTAAGTGAAGGAAGGAGGG + Intronic
1177194463 21:17888138-17888160 CATTCTTATTTGTGGAAAGAGGG + Intergenic
1181085738 22:20438549-20438571 CAGTCCTAGTTGAGGAGTGAAGG + Intronic
1181590998 22:23884536-23884558 GGGTCTTAGGGGAGCAAAGAGGG + Intronic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1184056976 22:42059270-42059292 CAGTCAAAGTGAAGGAATGATGG - Exonic
949569119 3:5274662-5274684 CAGTCTTTGGGGAGGCAAGAGGG + Intergenic
949776052 3:7633610-7633632 CAGGAGTAGTGGAGGATAGAAGG - Intronic
950689402 3:14643708-14643730 CAGTTTTAAAGGAGGAATGAGGG - Intergenic
951266049 3:20568383-20568405 CAATCTCAGAGGAGGAGAGAAGG - Intergenic
951435354 3:22656798-22656820 CAGTCTTAGTGGTGTGAACAGGG - Intergenic
951749515 3:26018820-26018842 AAGTTCTAGTGGAAGAAAGATGG - Intergenic
951825137 3:26859865-26859887 CAGTCCTCCTGGAGGAGAGAGGG + Intergenic
951983800 3:28595501-28595523 CAGTCTGAGGAAAGGAAAGAGGG + Intergenic
952268498 3:31809779-31809801 CCGTATCAGTGGAGAAAAGATGG + Intronic
952988666 3:38811814-38811836 CAGTATGAGAGGAGGAAAAAGGG - Intergenic
953700595 3:45192638-45192660 AAGTCTTCATGGAGGAAGGAAGG - Intergenic
954928292 3:54256968-54256990 CAGTCCAAGTGGATGAAGGAAGG - Intronic
955871995 3:63449092-63449114 CAGTATTGGGAGAGGAAAGAAGG + Intronic
956588828 3:70891989-70892011 CAATCTTAGTGTACGAAAGATGG + Intergenic
958460864 3:94393509-94393531 CACTCTCAGTGGTGGAAAGTTGG - Intergenic
958721255 3:97846567-97846589 GAGTGTTAGTGGTGGAAAGTAGG + Intronic
959916651 3:111823980-111824002 CACTCTTAATAGAGGAAAGGAGG - Intronic
960022194 3:112967304-112967326 CAGGCTTAATGAAGGACAGAGGG - Intronic
960390016 3:117065872-117065894 GATTCTTAGCGGAGGAAAAAGGG + Intronic
961017224 3:123477732-123477754 CATTTTTAGAGGAGGAAACAGGG + Intergenic
961587861 3:127948859-127948881 CAGTGAAAGGGGAGGAAAGAGGG + Intronic
961684746 3:128621996-128622018 CAGTCCTTGTGGAGGAAAAAGGG - Intronic
961734036 3:128989430-128989452 GAGTCTTAGAGGAGCAAAGCTGG + Intronic
962873721 3:139519702-139519724 CAGTCTTAGTGGAGCAGAAAAGG + Intronic
965105062 3:164344546-164344568 CAGTCTAAGTGAAAGAAAGGAGG + Intergenic
965785074 3:172326976-172326998 CAGAAATAGAGGAGGAAAGAAGG + Intronic
966496058 3:180582050-180582072 CAGGCTTAGGGGAGGAATGGAGG + Intergenic
967470314 3:189853193-189853215 CAGACTTTGTGGAACAAAGACGG - Intronic
968819329 4:2837773-2837795 CAGTCTAGGTGGAGGGAACAGGG - Exonic
970092621 4:12427299-12427321 CAGTCTGAGGGGAGTCAAGAGGG + Intergenic
970268402 4:14315691-14315713 AAGTCTTCGTGGAGAAAGGAGGG - Intergenic
971154564 4:24067677-24067699 CAGTTTAATTGGAGGACAGACGG - Intergenic
971418818 4:26457143-26457165 CAGTCTTTGTGGATGAAGGGTGG - Intergenic
972435526 4:39030467-39030489 AATTCTTAGTGGGGGACAGATGG - Intronic
972603643 4:40594159-40594181 CAGTGCTGGTGGAGGAAACAGGG - Intronic
973037961 4:45431209-45431231 TATTCTTTGTGGAGGAATGATGG - Intergenic
977015344 4:91685319-91685341 CTGTGTTAGTAGAGAAAAGAAGG - Intergenic
977493666 4:97746369-97746391 CAGTCTCAGTGGATAAAACAGGG - Intronic
978200194 4:106016758-106016780 CAGTACAAGGGGAGGAAAGAAGG + Intergenic
978310929 4:107384179-107384201 CAGTATTAGTTGAAGAAAGTAGG + Intergenic
979799876 4:124895038-124895060 CTGTATTAGTGGAGGCAAAATGG + Intergenic
981165145 4:141549283-141549305 CATTCTTGGTGGAGCCAAGATGG + Intergenic
982090600 4:151876816-151876838 CAGAGTTTCTGGAGGAAAGATGG - Intergenic
986543008 5:8866770-8866792 AAGTGTTAGTGTAGGAAAAAGGG + Intergenic
987087020 5:14480230-14480252 AAGACTCAGTGGGGGAAAGAAGG + Intronic
987367996 5:17167161-17167183 GAGTGTCAGAGGAGGAAAGATGG + Intronic
987875767 5:23678706-23678728 CAGTCTAAGTCCAAGAAAGAGGG + Intergenic
990018651 5:51098514-51098536 CATTCTTGGTGGGGGATAGAGGG + Intergenic
990881211 5:60541276-60541298 AAGTCTTACTGAAAGAAAGAGGG + Intergenic
991050117 5:62263887-62263909 CAGTCTTGGTGGGGATAAGAGGG - Intergenic
991557215 5:67909123-67909145 CAATCTTAGTAAAGGAAAAAAGG + Intergenic
992750557 5:79857007-79857029 CAGTCAGAGAGGAGGAAAGATGG + Intergenic
994894376 5:105683633-105683655 CAGTTAAAGTGGATGAAAGAAGG - Intergenic
996193176 5:120570357-120570379 TACTCTTGATGGAGGAAAGAGGG + Intronic
996266642 5:121549221-121549243 CTGAATTAGTGGAGGAAAGAAGG - Intergenic
996763342 5:127009100-127009122 CAGTTTTTGTGGAGGAAATTTGG - Intronic
997033986 5:130164997-130165019 CAGTATTGGTGGAGTATAGAGGG + Intronic
998250759 5:140550611-140550633 CAGTCTTGGTGGTGGTAAGAAGG + Exonic
999629499 5:153555552-153555574 GAGTCTTAGTGGAATAAGGAAGG - Intronic
999940141 5:156533245-156533267 CAGTTTGAGTGGAGAAAAAATGG - Intronic
999968076 5:156831357-156831379 CAGCTTTAGTTGAGGAAATATGG + Intergenic
1000245769 5:159447281-159447303 ATGTGTTTGTGGAGGAAAGAAGG + Intergenic
1000513950 5:162217459-162217481 CAGTATTAGTGAAAGAGAGAGGG - Intergenic
1002392648 5:178927943-178927965 CAGTCATAGTGGAGGGCAAAAGG + Intronic
1003405605 6:5824736-5824758 CACACTTAGGGGAGGCAAGAAGG + Intergenic
1003722435 6:8718678-8718700 CAGTATTTCTGGAGAAAAGAAGG - Intergenic
1004079393 6:12376481-12376503 AAGTCTAACTGGAGGAAATATGG - Intergenic
1005398066 6:25404321-25404343 CATTCTCAATGGAGGCAAGAAGG + Intronic
1005985653 6:30872904-30872926 CAGTGTCAGTGGAGGTAACATGG - Intergenic
1008624074 6:53300721-53300743 CAGACGGAGTGGAGGACAGAAGG - Intronic
1010157715 6:72814037-72814059 CAGGATCAGAGGAGGAAAGAGGG + Intronic
1011077356 6:83451192-83451214 TAGGCTCAGTTGAGGAAAGAGGG - Intergenic
1011226596 6:85114954-85114976 CAGTCCTAGGGGAAGAAAGTGGG + Intergenic
1011497061 6:87947301-87947323 TATTCTTAGTGAAGGACAGATGG + Intergenic
1012199935 6:96393428-96393450 CAGCCTTGGTGGAGGAAGGGGGG - Intergenic
1014741321 6:125150904-125150926 CACTCTTAGTGGAGATACGAAGG - Intronic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1015293316 6:131562162-131562184 CTCTCTTAGGTGAGGAAAGAAGG + Intergenic
1016011252 6:139139534-139139556 CATTCCTAGTGGAGGAGGGAAGG + Intronic
1017647962 6:156556419-156556441 CAGTCATAGTGGAGTAGAGTGGG + Intergenic
1018984667 6:168627193-168627215 CAGTCTTACTAGAGGAGAAATGG - Intronic
1020360429 7:7321620-7321642 AAGTCTAAGAGGAGGAAAGACGG + Intergenic
1020724764 7:11798108-11798130 CTGTCTTAATGGAACAAAGATGG - Intronic
1022968025 7:35492607-35492629 CAGACTTTGTGGAGGAAGGAAGG - Intergenic
1023475884 7:40577283-40577305 TACTCTGAGTGGAGGAGAGAGGG + Intronic
1027531223 7:79335657-79335679 CATCCTTAGTGGACAAAAGATGG + Intronic
1028038366 7:86015442-86015464 CAGGCTCAGAGGGGGAAAGATGG - Intergenic
1029075926 7:97934106-97934128 CAGTCTGACTGGAGGAGAGTGGG + Intergenic
1032780490 7:135161828-135161850 CAGTCAGAGTGGAGGAGTGAGGG - Intronic
1033389430 7:140912453-140912475 CTGTCTTAGAAGAGGTAAGAGGG - Intronic
1039396172 8:37227193-37227215 CAGTCTTATTGGACGAGAGAAGG - Intergenic
1039758677 8:40550297-40550319 AAGCCTTAGTGGAAGACAGAGGG - Intronic
1040020612 8:42737531-42737553 GAGTCTTAGAGAAGGAATGATGG - Intergenic
1040713327 8:50216504-50216526 CAGACTTAGGGGATGAAAGCAGG + Intronic
1041858865 8:62488323-62488345 CAGAATTAGCAGAGGAAAGAAGG - Intronic
1043055247 8:75429725-75429747 AAGTCTGAGTTGAAGAAAGAAGG + Intronic
1043618287 8:82155395-82155417 ATGACTTAGTGAAGGAAAGAAGG - Intergenic
1043682453 8:83045728-83045750 CAAGCTTAGTGGAGAAAAGCAGG + Intergenic
1043967496 8:86495410-86495432 TAGTCTTTGTGGAGAACAGAGGG + Intronic
1044485530 8:92748671-92748693 CACTCCAACTGGAGGAAAGAGGG + Intergenic
1046082366 8:109386833-109386855 CAGTTTCAGTGGGGGAAAAAAGG - Intronic
1047731934 8:127735586-127735608 CAGGGAGAGTGGAGGAAAGAAGG - Intronic
1048946731 8:139455660-139455682 CAGCCTTCATGGAGGGAAGATGG - Intergenic
1049099040 8:140566298-140566320 CAGTCATGGTGGAGGACAAAAGG - Intronic
1049794417 8:144489992-144490014 CAGTCTTTGTGAAGGACCGAGGG - Intronic
1050480596 9:6083442-6083464 CAGTATTAGTTGAAGAAAGTAGG + Intergenic
1050544699 9:6700090-6700112 CAATCTTAGTGGAGGGATGGAGG + Intergenic
1052029390 9:23611154-23611176 AAGTCTTAGAGGTGGACAGAAGG - Intergenic
1052281913 9:26742655-26742677 CAGCCTCAGTGGAGAAAAAAGGG - Intergenic
1052351952 9:27467171-27467193 CAGTCTTTGAGGAGGATACATGG - Intronic
1056000615 9:82212537-82212559 CCATCTTAGTGGAGGTAAAACGG - Intergenic
1057595581 9:96413572-96413594 CAGTCTTAGTAGAGGGCACAGGG + Intronic
1057901369 9:98951442-98951464 TAGTGTTAGTGGAGGAAGGCAGG - Intronic
1058597754 9:106633191-106633213 CATTGTAAGTGGAGAAAAGAAGG - Intergenic
1061978424 9:134085568-134085590 CAGTATTAGGGGAGGAGAGAAGG - Intergenic
1186109912 X:6244835-6244857 TACTCTTGGTGGAGGAGAGAAGG + Intergenic
1186185903 X:7019501-7019523 TCGTCTTACTGTAGGAAAGATGG + Intergenic
1187303347 X:18073031-18073053 CAGACTTTGTAGAGGAAAAAGGG + Intergenic
1187665896 X:21609109-21609131 AAGTCTCCGTGGAGGAAAGTCGG - Exonic
1189094994 X:38128836-38128858 CATTTTTAGGGGAGGTAAGAGGG + Intronic
1189512559 X:41677672-41677694 CAGTCTTACTGTAGTAAAAATGG + Intronic
1190320371 X:49176344-49176366 CAGTCTTAGTGGAGGAAAGAAGG - Intronic
1191682100 X:63851428-63851450 TGGACTTAGTGGAGGAAAGCGGG + Intergenic
1192450521 X:71241932-71241954 CTGTCTTAAATGAGGAAAGAGGG + Intronic
1192543463 X:71994235-71994257 CAGCCTGATTGGAGGAAAGATGG + Intergenic
1193512173 X:82416692-82416714 CAGTTTTTGTGGGTGAAAGAGGG - Intergenic
1198925949 X:141795657-141795679 CAGTCTTGATGGAGGCAAGAGGG + Intergenic
1199568028 X:149237011-149237033 AAGTCTTAGTGCAATAAAGAAGG + Intergenic
1199730433 X:150626923-150626945 AAGTCTTAGAGGAGGCAGGAAGG - Intronic
1201240494 Y:11953577-11953599 CAGTCTTCCTGCCGGAAAGATGG - Intergenic