ID: 1190320770

View in Genome Browser
Species Human (GRCh38)
Location X:49178010-49178032
Sequence CGCCACGCGGAGTACTGTGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 17}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190320770_1190320779 5 Left 1190320770 X:49178010-49178032 CCATCACAGTACTCCGCGTGGCG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1190320779 X:49178038-49178060 CGTAGCAGGCGCAGCAGTGGGGG 0: 1
1: 0
2: 0
3: 11
4: 162
1190320770_1190320774 -9 Left 1190320770 X:49178010-49178032 CCATCACAGTACTCCGCGTGGCG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1190320774 X:49178024-49178046 CGCGTGGCGGGCCTCGTAGCAGG 0: 1
1: 0
2: 0
3: 0
4: 34
1190320770_1190320780 8 Left 1190320770 X:49178010-49178032 CCATCACAGTACTCCGCGTGGCG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1190320780 X:49178041-49178063 AGCAGGCGCAGCAGTGGGGGCGG 0: 1
1: 0
2: 6
3: 75
4: 574
1190320770_1190320777 3 Left 1190320770 X:49178010-49178032 CCATCACAGTACTCCGCGTGGCG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1190320777 X:49178036-49178058 CTCGTAGCAGGCGCAGCAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1190320770_1190320778 4 Left 1190320770 X:49178010-49178032 CCATCACAGTACTCCGCGTGGCG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1190320778 X:49178037-49178059 TCGTAGCAGGCGCAGCAGTGGGG 0: 1
1: 0
2: 1
3: 1
4: 85
1190320770_1190320776 2 Left 1190320770 X:49178010-49178032 CCATCACAGTACTCCGCGTGGCG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1190320776 X:49178035-49178057 CCTCGTAGCAGGCGCAGCAGTGG 0: 1
1: 0
2: 0
3: 2
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190320770 Original CRISPR CGCCACGCGGAGTACTGTGA TGG (reversed) Exonic
902754273 1:18538938-18538960 CACCACTCTGAGTGCTGTGAGGG - Intergenic
908501084 1:64744831-64744853 CGCCACCCGGACACCTGTGAGGG - Intergenic
915740330 1:158114019-158114041 CGCCAGGCTGAGTTCCGTGAAGG - Intergenic
1066455112 10:35565662-35565684 TGCCACGTGGAGTCCAGTGAGGG - Intronic
1076605759 10:131689060-131689082 CACCACGCTGAGAACTGTGGGGG - Intergenic
1091387595 12:104726-104748 CGCCACGCGGGGTACCCTGGAGG + Intronic
1091520635 12:1237568-1237590 CTCCACTTGGATTACTGTGAAGG - Intronic
1091640311 12:2230992-2231014 TGCCACGCGGACTATTGGGAGGG + Intronic
1097730459 12:63123098-63123120 GGCATCTCGGAGTACTGTGAAGG + Intergenic
1131442378 15:92468656-92468678 CACCACGCCTAGTGCTGTGATGG - Exonic
1161979371 19:7622618-7622640 CGCCGGGCCGAGTACTTTGATGG - Exonic
1165135046 19:33662551-33662573 CCCCACGGGGAATGCTGTGAGGG + Intronic
932749647 2:74363264-74363286 AGCCACGGGGAGGACTGGGATGG - Intronic
1170705964 20:18745181-18745203 TGCCACACGGGGCACTGTGAAGG - Intronic
982944734 4:161606056-161606078 CACCACGTGGAGTACAGCGAAGG + Intronic
1060545778 9:124458246-124458268 CGCCACCTGGAGGGCTGTGAGGG + Intronic
1061645103 9:131994796-131994818 GGCCACTGGGACTACTGTGATGG - Intronic
1190320770 X:49178010-49178032 CGCCACGCGGAGTACTGTGATGG - Exonic