ID: 1190322391

View in Genome Browser
Species Human (GRCh38)
Location X:49186655-49186677
Sequence GTGGCCAACTGGACTGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190322380_1190322391 22 Left 1190322380 X:49186610-49186632 CCTGGGGCTTGAAGGTTCTGTAG No data
Right 1190322391 X:49186655-49186677 GTGGCCAACTGGACTGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190322391 Original CRISPR GTGGCCAACTGGACTGAGAG GGG Intergenic
No off target data available for this crispr