ID: 1190323422

View in Genome Browser
Species Human (GRCh38)
Location X:49191661-49191683
Sequence GGGCGCCGGGAGGCGCGCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 756
Summary {0: 1, 1: 0, 2: 8, 3: 83, 4: 664}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190323409_1190323422 11 Left 1190323409 X:49191627-49191649 CCGTAGGCGTCCCCGGGTGCCGG 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1190323422 X:49191661-49191683 GGGCGCCGGGAGGCGCGCGCAGG 0: 1
1: 0
2: 8
3: 83
4: 664
1190323405_1190323422 26 Left 1190323405 X:49191612-49191634 CCGTAGCCTGCATCGCCGTAGGC 0: 1
1: 0
2: 0
3: 3
4: 32
Right 1190323422 X:49191661-49191683 GGGCGCCGGGAGGCGCGCGCAGG 0: 1
1: 0
2: 8
3: 83
4: 664
1190323414_1190323422 -1 Left 1190323414 X:49191639-49191661 CCGGGTGCCGGTTGTTTCTCGGG 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1190323422 X:49191661-49191683 GGGCGCCGGGAGGCGCGCGCAGG 0: 1
1: 0
2: 8
3: 83
4: 664
1190323418_1190323422 -8 Left 1190323418 X:49191646-49191668 CCGGTTGTTTCTCGGGGGCGCCG 0: 1
1: 0
2: 0
3: 6
4: 37
Right 1190323422 X:49191661-49191683 GGGCGCCGGGAGGCGCGCGCAGG 0: 1
1: 0
2: 8
3: 83
4: 664
1190323412_1190323422 0 Left 1190323412 X:49191638-49191660 CCCGGGTGCCGGTTGTTTCTCGG 0: 1
1: 0
2: 1
3: 2
4: 44
Right 1190323422 X:49191661-49191683 GGGCGCCGGGAGGCGCGCGCAGG 0: 1
1: 0
2: 8
3: 83
4: 664
1190323406_1190323422 20 Left 1190323406 X:49191618-49191640 CCTGCATCGCCGTAGGCGTCCCC 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1190323422 X:49191661-49191683 GGGCGCCGGGAGGCGCGCGCAGG 0: 1
1: 0
2: 8
3: 83
4: 664
1190323403_1190323422 27 Left 1190323403 X:49191611-49191633 CCCGTAGCCTGCATCGCCGTAGG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1190323422 X:49191661-49191683 GGGCGCCGGGAGGCGCGCGCAGG 0: 1
1: 0
2: 8
3: 83
4: 664
1190323411_1190323422 1 Left 1190323411 X:49191637-49191659 CCCCGGGTGCCGGTTGTTTCTCG 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1190323422 X:49191661-49191683 GGGCGCCGGGAGGCGCGCGCAGG 0: 1
1: 0
2: 8
3: 83
4: 664

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190323422 Original CRISPR GGGCGCCGGGAGGCGCGCGC AGG Exonic
900013695 1:135556-135578 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
900014395 1:138260-138282 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
900043765 1:491539-491561 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
900044260 1:493462-493484 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
900065202 1:726542-726564 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
900065668 1:728368-728390 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
900227564 1:1540227-1540249 GTGGGCCAGGCGGCGCGCGCGGG + Intronic
900314864 1:2051471-2051493 GGGCTCCTGGAGACGCGCACAGG - Intronic
900512822 1:3068502-3068524 GGGGGCCGGGAGGCGCGAGGGGG + Intergenic
900524566 1:3122182-3122204 GGAGGCCGGGAGGAGTGCGCAGG - Intronic
900633499 1:3651068-3651090 GGGCGCCCGGAGGTACGAGCAGG - Intronic
901007608 1:6179551-6179573 CGGCGGCGGGACGCGAGCGCGGG + Intronic
901242655 1:7704294-7704316 GGGGAACGGGAGGCCCGCGCGGG + Intronic
901426201 1:9183360-9183382 GTGGGCAGGGAGGCGCGGGCAGG + Intergenic
901551155 1:9997209-9997231 GGGCGGCCGGAGGCTCGGGCCGG - Exonic
902323606 1:15684399-15684421 GAGGGCCGGGCGGCGGGCGCCGG + Exonic
902350118 1:15847982-15848004 CAGCGCCGGGAGGCGGGTGCCGG - Exonic
903349755 1:22710716-22710738 GGGGGCCGGGACGCGCGCGGGGG + Intergenic
903466391 1:23554971-23554993 GGGCGCCGGGAGGGGCGGGGCGG + Intergenic
903750317 1:25617159-25617181 GGGCGCCGGGAGCTGGGAGCCGG - Intergenic
903778788 1:25808999-25809021 GGGCGGCGGGAGGCACGTACTGG - Intronic
903950628 1:26994068-26994090 GGGGGCGGGGGGCCGCGCGCTGG + Exonic
904181363 1:28668882-28668904 GGGGGCGGGGGGGCGGGCGCGGG + Intronic
904563362 1:31413224-31413246 GGGCGCCCGGCGCCGGGCGCGGG - Intronic
904772134 1:32886432-32886454 GGGCGGCAGGAGGGGCGGGCGGG - Exonic
905037815 1:34929322-34929344 CGGGGCCGGGAGCCGAGCGCCGG + Intronic
905174037 1:36125227-36125249 GGGCGGCAGGAGGGGCGCGTCGG + Intergenic
905692711 1:39955030-39955052 GGGGGCAGGGAGGCGGGCGACGG + Intergenic
905867195 1:41382685-41382707 GGGCGCCCGGAGGCGGGAGGCGG - Exonic
906130755 1:43453841-43453863 GGGCGGCGGGCGGCGGGCGGCGG + Exonic
906130760 1:43453848-43453870 GGGCGGCGGGCGGCGGGCGGGGG + Exonic
906197182 1:43936406-43936428 GGGGGCCGCGCGGCGCGGGCTGG + Exonic
906204333 1:43979171-43979193 GGCCGCGGGGGCGCGCGCGCGGG + Intronic
907513863 1:54981015-54981037 GCGCGCAGGGAGCCGGGCGCAGG - Exonic
912878953 1:113390403-113390425 GCGCGCCGGGCGCCGCGCGGCGG + Intergenic
912993481 1:114511101-114511123 GGGCGGCGGGCGGCGCGGGGCGG - Exonic
913047858 1:115089307-115089329 GGGGGCCGGGTGGCGGGCGCGGG - Intronic
914197970 1:145459997-145460019 GGGTGCCAGGAGGCTCGCCCAGG - Intergenic
914477072 1:148033129-148033151 GGGTGCCAGGAGGCTCGCCCAGG - Intergenic
914513464 1:148354034-148354056 GGGGGCCGGGAGGCTCGCCCAGG - Intergenic
914753146 1:150549304-150549326 GGCCGCCGAGGGGCGCGGGCTGG + Intergenic
914869149 1:151458889-151458911 GGGCCGCGGGAGCCGCGCGAAGG - Intronic
915629203 1:157138556-157138578 GCGGGCCGGGAGGAGCGCGCAGG - Intergenic
916226995 1:162498135-162498157 GGGCGCCGGGGGGCGAGCCAGGG - Exonic
919726948 1:200890971-200890993 GGGCAGCAGGAGGCGCTCGCCGG + Intergenic
920278839 1:204828599-204828621 GGGCGCGGGGGCGCGCACGCAGG + Intergenic
920348444 1:205321794-205321816 GGGCGCCGGGGGGCGTGTCCAGG - Intergenic
920704775 1:208243315-208243337 GAGCGCCGGCAGGTGCGCGGTGG + Intronic
922262068 1:223951755-223951777 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
922526515 1:226308725-226308747 CGGCGCCGAGAGACGCCCGCCGG - Intronic
922734155 1:227970657-227970679 GGCCGCCGGGAGGCAGGAGCTGG - Intergenic
922734200 1:227970823-227970845 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
922734945 1:227973760-227973782 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
922841767 1:228648129-228648151 GGGACCCGGGAGCCGCTCGCCGG + Intergenic
923055881 1:230425889-230425911 GGGCGCGCGGAGGAGGGCGCCGG - Intergenic
923107913 1:230868572-230868594 GGGCTCCGGGTGGCGCGGGGCGG - Exonic
923744337 1:236686568-236686590 GGGCGGCGGGCGGCGGGCGCGGG - Exonic
924343713 1:243055834-243055856 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
924527230 1:244863571-244863593 GCGCGGCGGGAGGCCCGCGCGGG - Intronic
924775206 1:247111462-247111484 GGGGACCGGCAGGCGCGCGAAGG + Exonic
1064022913 10:11823710-11823732 GGGCGCGGCGGGGAGCGCGCTGG + Intronic
1064167767 10:13001497-13001519 GGCAGCTGGCAGGCGCGCGCGGG + Exonic
1064354361 10:14604176-14604198 GGGCGCGGGGAGGCGGGCGGCGG - Intronic
1064981900 10:21173934-21173956 GGGCTGCGGGCGGCGGGCGCCGG + Intronic
1065025065 10:21534017-21534039 GGGCGCGGGGGCGCGCACGCGGG - Intergenic
1065025292 10:21534824-21534846 GGGCGCAGGCCGGCGCGCCCCGG - Intronic
1066733185 10:38451376-38451398 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1066963649 10:42242481-42242503 GGGCGCGAGGCGGGGCGCGCGGG - Intergenic
1067111881 10:43407264-43407286 GCGGGACGCGAGGCGCGCGCTGG - Intronic
1067227424 10:44385094-44385116 CGGCGGTGGGAGGCGCGCGCCGG + Intronic
1067694174 10:48523630-48523652 GGGCGGCGCAGGGCGCGCGCCGG + Intronic
1069615344 10:69803000-69803022 GGGCGCGCGGAGGCTCGCGGAGG + Intronic
1069818339 10:71212623-71212645 GGGCTCCGAGAGGCGCGCACTGG + Exonic
1070256010 10:74813651-74813673 GGGGTCCGGGAGGCAGGCGCGGG + Intergenic
1070257772 10:74826043-74826065 GGGCGCGGGCGGGCGCGCGCGGG - Intronic
1070328238 10:75401454-75401476 GGGCTCCGGGAGGCGCGGGGCGG + Exonic
1070328544 10:75402867-75402889 GGGCGCCGAGAGGGGCGCGCAGG + Intergenic
1070610005 10:77926613-77926635 GGGCGCCGGGAGCCGTGAGGCGG + Intergenic
1071527418 10:86366524-86366546 GGGCGCAGGGGCGGGCGCGCGGG - Intergenic
1071546786 10:86535638-86535660 GGGGGCGGGGAGGCCCGGGCAGG - Intergenic
1072491015 10:95906085-95906107 GGGGGGCGGGGGGCGCGGGCAGG + Intronic
1072670482 10:97425910-97425932 GGGCGGCGGGCGGCGGGCGGCGG - Intronic
1072710577 10:97713589-97713611 GGAAGCCGGGAGGAGCGCGCGGG + Intronic
1073098914 10:100997088-100997110 GGGCGCCGGGAGCTGGGAGCCGG + Intronic
1073137683 10:101228882-101228904 GGGCGCCGGACGGCGCGGGCAGG + Exonic
1075801854 10:125159420-125159442 GCGGGCCGGGCGGCGGGCGCGGG - Intronic
1076650215 10:131982134-131982156 GGGCGGGGCGAGGGGCGCGCAGG + Intergenic
1076657811 10:132036448-132036470 GGGGGCCGCGGGGCGCGCGTAGG - Intergenic
1076722106 10:132397221-132397243 GGGAGCATGGAGCCGCGCGCCGG + Exonic
1076793399 10:132787889-132787911 GAGGCCCAGGAGGCGCGCGCGGG + Intergenic
1076825338 10:132964450-132964472 GAGCGCAGGGAGGCGGCCGCAGG - Intergenic
1076850029 10:133088160-133088182 GGGCGGCGGGAGGGACGCGCGGG + Intronic
1076880312 10:133236566-133236588 GGAGCCCGGGAGGCGGGCGCTGG - Intergenic
1076909205 10:133379066-133379088 AGGCGCGGGGAGGCGCGGGGAGG - Intergenic
1076909209 10:133379076-133379098 AGGCGCGGGGAGGCGCGGGGAGG - Intergenic
1076909213 10:133379086-133379108 AGGCGCGGGGAGGCGCGGGGAGG - Intergenic
1076909259 10:133379176-133379198 AGGCGCGGGGAGGCGCGGGGAGG - Intergenic
1076970039 11:127770-127792 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1076970592 11:129937-129959 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1077065543 11:639577-639599 GGGCGGCGGGCGGGGCGCGGGGG - Intronic
1077097171 11:803975-803997 GGGAGCCGGGAGGGGCGGCCTGG + Intronic
1077107887 11:849797-849819 GGGCGCGGGGCGGGGCGCGCGGG + Intronic
1077214620 11:1390237-1390259 GGGCGCCCGGGCGCGCGGGCAGG - Intronic
1077226930 11:1442690-1442712 GGGTGCCGGGAGGCTCAGGCAGG - Intronic
1078594585 11:12674985-12675007 GGGCGCGGGGAGGCGGGTGTGGG - Intronic
1080283820 11:30586150-30586172 GGGCGGCGAGGGGCGCGAGCGGG + Intronic
1081502629 11:43681118-43681140 GGGAGCCAGGAGGGGCCCGCGGG - Intronic
1083428434 11:62601484-62601506 GGGGTCCGGGAGGCTCGCGGGGG + Exonic
1083781000 11:64917245-64917267 GGGCGTCCGGAGGCGCGGCCTGG - Exonic
1083965771 11:66042865-66042887 TGGCGCCACGTGGCGCGCGCGGG - Exonic
1083993133 11:66258549-66258571 GGGTGCGGGCAGGCGGGCGCCGG - Exonic
1084010870 11:66347684-66347706 GGGCGGCGGGCGGCGGGCGGCGG - Exonic
1084010873 11:66347691-66347713 GGGCGGCGGGCGGCGGGCGGCGG - Exonic
1084165459 11:67373090-67373112 GGGCGGCGGGAGGCGAGGGGAGG - Intronic
1084310207 11:68312474-68312496 CGGCTCCGGGGGGCGCCCGCGGG + Intergenic
1084588873 11:70078863-70078885 GCGTGCCGGGAAGGGCGCGCCGG + Intronic
1084758123 11:71251922-71251944 GGCCGCCAGGTGGCGCGCGGGGG - Intronic
1085294828 11:75425477-75425499 GGCCTCCGGGAGGGGCGCGGCGG + Exonic
1085574417 11:77589747-77589769 AGGCGCGGGGAGGCGCGGGGAGG - Exonic
1087755193 11:102047645-102047667 GGGCGTCGAGGGGCCCGCGCGGG + Intronic
1087795775 11:102453364-102453386 GGGCGGGTGGGGGCGCGCGCAGG + Intronic
1088462241 11:110093524-110093546 GGGCGCCAGGCGGAGGGCGCCGG + Intronic
1089207112 11:116773103-116773125 GGCCACCGGGACGCGCTCGCAGG + Intergenic
1089622252 11:119728806-119728828 CGGCGCCGGGAGGAGAGCGGAGG - Exonic
1089729644 11:120512051-120512073 GGGAGCGGGGAGGAGGGCGCGGG - Intronic
1090664497 11:128905589-128905611 GGGTGGCGGGAGGGGCGCTCTGG + Exonic
1090817860 11:130314672-130314694 GGGGCCCGGGAGCCGCGCGCTGG + Exonic
1091399712 12:174646-174668 GGGGGCCGAGAGGGGAGCGCCGG + Exonic
1091594369 12:1865746-1865768 GGGCGCGGGGAGGCGGTTGCGGG + Intronic
1091888090 12:4031307-4031329 GGGCGCGGGGAGGCGCGGGCGGG - Intergenic
1091916491 12:4274326-4274348 AGGAGCCGGGAGGCCGGCGCGGG - Intronic
1092169341 12:6363526-6363548 GGGCCCCGTGAGGCGGGGGCGGG + Exonic
1093728722 12:22544264-22544286 GAGCGCGCGGGGGCGCGCGCGGG + Intronic
1094048765 12:26196154-26196176 AGGCGCTGGGAGCCGCGAGCAGG - Intronic
1094607306 12:31959670-31959692 GGACGGCGGGACGCGCGAGCCGG - Intronic
1096548283 12:52356273-52356295 GGGCGCCGGGAGGGACGGGAGGG - Intergenic
1096793648 12:54060610-54060632 GGGCGCGGGGCGGGGAGCGCGGG + Intergenic
1096804770 12:54133906-54133928 GGGCAGCGGGAGGCGTGCGAGGG - Intergenic
1097046250 12:56189528-56189550 AGGCGGCGGGAGGCGGGCGGAGG - Exonic
1097166448 12:57088938-57088960 GGGGCCGGGGAGGCGGGCGCTGG - Exonic
1097245339 12:57604885-57604907 GGGGCCCGGGGGGCGCGCGGTGG - Intronic
1097245376 12:57604965-57604987 GGGAGCCCGGAGCCGCGCGCGGG - Intronic
1097281355 12:57846812-57846834 GAGAGCCGGGAGGCGCGCGGGGG - Intergenic
1098255451 12:68611127-68611149 GGGTGCGGCGAGGCGCGGGCCGG + Intronic
1098740738 12:74170977-74170999 GGGGGGCGGGAGGCGCAGGCGGG - Intergenic
1101173058 12:102119931-102119953 GGGCCCCGGGAGGTGGGAGCGGG - Intronic
1101606064 12:106248183-106248205 GGGGGCCGGGAAGCCGGCGCGGG + Intronic
1101641058 12:106586058-106586080 AGGGCCCAGGAGGCGCGCGCCGG - Intronic
1101910536 12:108857576-108857598 GGCCTCCTGGAGCCGCGCGCGGG + Exonic
1102025838 12:109714013-109714035 TGGCCCCGGGCGGCGCGCGGGGG - Intergenic
1102101321 12:110281127-110281149 GGGAGCCGGGAGGAGGGGGCGGG + Intronic
1102394651 12:112575500-112575522 GGGGGCGGGGAGACCCGCGCAGG + Intronic
1102658179 12:114501349-114501371 AGGAACCGGGAGGCGCGCCCTGG + Intergenic
1102937669 12:116911220-116911242 GGGCGCGGGGAGGCCCCCGGCGG + Exonic
1103294847 12:119877280-119877302 CGGCGGCGGGAGGCGCGGGGCGG - Exonic
1103488110 12:121296467-121296489 GGGCGTGGGGAGGCGCACGTGGG + Intronic
1103509710 12:121466551-121466573 GGGTTCCGGGTGGCCCGCGCCGG + Intronic
1103698545 12:122835650-122835672 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
1103698548 12:122835657-122835679 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
1103800315 12:123533620-123533642 GGGCAGCGGGCGGCGGGCGCGGG + Exonic
1103800597 12:123534430-123534452 TGGCTCGGGGAGGCGCGCCCTGG - Intergenic
1104020498 12:124988967-124988989 GGGCGCCAGCAGGCGGGCCCCGG - Exonic
1104021155 12:124993535-124993557 GGCTTCCGGGAGGCGGGCGCGGG + Intergenic
1104983247 12:132583158-132583180 TGGGGCGGGGATGCGCGCGCGGG - Exonic
1105472133 13:20703886-20703908 GGGCGAGGGGAGGCGCCCGCCGG + Intronic
1106241951 13:27920078-27920100 GGGAGCCGGGAGTCGGGAGCTGG - Exonic
1106241957 13:27920092-27920114 GGGAGCCGGGAGCCGGGAGCCGG - Exonic
1106241960 13:27920099-27920121 GGGCACCGGGAGCCGGGAGCCGG - Exonic
1106602572 13:31200268-31200290 GGACGGCGGGACGCGCGCGCCGG - Intronic
1109284878 13:60397641-60397663 GGGCCCCGGGCGGCGGGCGGCGG + Intronic
1110119482 13:71865390-71865412 GGGAGCGGGGAGACGCGCTCCGG - Intronic
1111951346 13:94711689-94711711 GGGCGCCGGGCTGCACGCGGGGG - Exonic
1112494809 13:99896168-99896190 GGGCTCCGGGCGGCCCGCGGCGG - Exonic
1113541793 13:111115194-111115216 GGGCGCGGGGCGGCGCGGGCCGG + Intronic
1113541823 13:111115292-111115314 GGGCGGCGGCGGGCGCCCGCAGG + Exonic
1113653982 13:112056933-112056955 GGGCTCCGGGAGGTGCCCGTGGG + Intergenic
1113874262 13:113584804-113584826 CGGCGCGGAGAGGCGCGGGCTGG - Exonic
1114452596 14:22836959-22836981 GCCCGCCGGGAGGCGAGCCCGGG + Intronic
1114674697 14:24432224-24432246 GGGCACCGGGAGGCTCACGGTGG - Exonic
1115203121 14:30874597-30874619 GAGCCCCGGGCGGCGGGCGCGGG + Intronic
1115610706 14:35046380-35046402 GCGCGGCGCGAGGCGGGCGCTGG + Intronic
1116273873 14:42805761-42805783 GGGCGGCGGGAGGAGCGGGGGGG + Intergenic
1117963961 14:61188506-61188528 CGGAGCCGGGAGGCGCCCGGAGG - Intronic
1118030352 14:61812628-61812650 GGGCGCGGGGCGGCGCGGGGCGG + Intergenic
1118206496 14:63728091-63728113 GGGCGGGGCGCGGCGCGCGCGGG - Intergenic
1118220701 14:63852902-63852924 GGCCGCCGAGGGGCGAGCGCGGG + Intergenic
1118389977 14:65287652-65287674 GGGAGCCGGGCTGCGCGCTCAGG + Intergenic
1118796963 14:69152724-69152746 GGGTGCGGGGAGGCGCGGGGAGG + Intronic
1118932383 14:70254949-70254971 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1118932386 14:70254956-70254978 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1118932389 14:70254963-70254985 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1118932392 14:70254970-70254992 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1118932395 14:70254977-70254999 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1118932398 14:70254984-70255006 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1118932401 14:70254991-70255013 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1118932404 14:70254998-70255020 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1119539327 14:75428276-75428298 GGGCGCCGGGACGGGCGGGGCGG + Intronic
1120167880 14:81220308-81220330 GAGCGCCGGGCGGCGGGCGCGGG - Intronic
1120881296 14:89417011-89417033 GGGCGGCGGGGGGCGGCCGCGGG + Intronic
1121622515 14:95360424-95360446 GGGGGCTGGGGGGCGCGCGCGGG - Intergenic
1122418215 14:101560494-101560516 GGGCGCGGGGCAGCGGGCGCGGG - Intergenic
1122543377 14:102509726-102509748 GGGCGGCGGGCGGCGGGCGGCGG + Exonic
1122558078 14:102592243-102592265 AGGCTGCGGGAGGCGTGCGCGGG + Intergenic
1122620822 14:103056926-103056948 GGGCGTGGGGATGCGCGGGCTGG + Intronic
1122621025 14:103057675-103057697 GGGAGCAGGGAGCCGGGCGCGGG - Intergenic
1122719960 14:103716237-103716259 GGGCGCCGGGAGGCGGGGTGCGG + Intronic
1122866140 14:104604837-104604859 GCGTCCCGGGAGGGGCGCGCGGG - Exonic
1122975178 14:105168128-105168150 GAGCGGAGGGAGGCGCGGGCCGG + Intronic
1122975444 14:105168921-105168943 GCGCCCTGGGGGGCGCGCGCCGG - Intergenic
1123004470 14:105314718-105314740 GGGCGCCGGGCGGGGCGGGGCGG + Exonic
1123630773 15:22258277-22258299 GGGCGCCGGGGGCCGCGGCCGGG - Intergenic
1123684307 15:22786572-22786594 GGTGACCGGGAGGCGCGGGCGGG - Intronic
1124118495 15:26868172-26868194 GGGCGGCGGGAGGCGCCGCCCGG + Intronic
1124652484 15:31483937-31483959 GGGCCCGGAGAGGCGCGCTCCGG + Exonic
1125603396 15:40927574-40927596 GATCGCCGGGAGGCACGCCCCGG + Intergenic
1125689610 15:41585496-41585518 GGCCGCGGGGAGGAGCGCGGCGG + Intergenic
1127931648 15:63600994-63601016 GGGCCGCGGCGGGCGCGCGCGGG - Intronic
1128067863 15:64775615-64775637 CGGCGGCGGGGGGCGGGCGCCGG + Intergenic
1128078223 15:64841584-64841606 GGGTGGCGGGAGCGGCGCGCAGG - Intergenic
1128322596 15:66703581-66703603 CGGAGCCGGGAGGCCCGGGCTGG + Exonic
1128582152 15:68818130-68818152 GGGCGCTGGCAGGCGGGCGGCGG - Intronic
1128635431 15:69299396-69299418 GGGCGGCGGGAGGGGGGCGGTGG - Intronic
1128743179 15:70097022-70097044 CGGGGCCGGGCGGCGGGCGCGGG + Exonic
1129193482 15:73951259-73951281 GGGAGCTGGGAGGGCCGCGCAGG - Intronic
1129468669 15:75738391-75738413 GGACCCCGGGAGGGGCGCGAGGG + Intergenic
1129539403 15:76338474-76338496 GGGCGCCGGGAAGCGGGCCGGGG - Exonic
1129853977 15:78811320-78811342 GGTCGCCGGGAGCTGCACGCCGG - Exonic
1129948240 15:79560594-79560616 TGGCGCGGGGAGGCGCGGGCCGG + Intergenic
1130085970 15:80778995-80779017 GGGCGCCCCGGGGCGCGAGCGGG + Intergenic
1130224594 15:82047125-82047147 GGGCGCTGCGGAGCGCGCGCCGG + Intergenic
1130362704 15:83206772-83206794 GGGCACCGGGAATCGCGCTCAGG + Intronic
1130994238 15:88895229-88895251 CGGCGCGGGGATGCGGGCGCCGG - Intronic
1131133075 15:89912582-89912604 GGGCGCCGGGAGCGGCGGACTGG + Intronic
1132255696 15:100373901-100373923 GGGCGTCGGGAGGCGGGGGGAGG + Intergenic
1132320133 15:100919464-100919486 GGCCGCCGGGGGGCGCCGGCAGG - Intronic
1132326386 15:100973633-100973655 GGTCGCGGGGCGGCGAGCGCAGG + Intronic
1132480669 16:164882-164904 GGGCGCGGGGCGGGGCGGGCCGG + Intronic
1132513585 16:355369-355391 AGGGGCAGGGAGGCGCGCGGGGG + Intergenic
1132527717 16:425898-425920 CGGCGCGGGCGGGCGCGCGCGGG - Exonic
1132684728 16:1157569-1157591 GAGCCCGGGGAGGCGGGCGCAGG - Intronic
1132712829 16:1276923-1276945 GGGGGCCAGGAGCCGCCCGCAGG + Intergenic
1132779513 16:1614813-1614835 GCGCGCCGGGGGGCGCGGGGGGG - Exonic
1132897834 16:2237312-2237334 GGCCGCAGGGAGGGGCGCGCGGG + Intronic
1133026625 16:2991457-2991479 GGCCGCAGGGAGGGGCGGGCAGG + Intergenic
1133212962 16:4273211-4273233 GGGGGCCGGGGGCCGCGGGCGGG + Intergenic
1133220120 16:4316182-4316204 GGGCGCGGGGAGCCGAGCGGGGG - Intronic
1133227871 16:4351154-4351176 GGGGGCCGGGCGGCGAGCTCCGG - Intronic
1135023837 16:18984134-18984156 GGGCGGCAGGGAGCGCGCGCGGG + Intronic
1135325582 16:21523499-21523521 GGTCCCCAGGAGGCGGGCGCAGG - Intergenic
1136362604 16:29790608-29790630 GGGGACCCGGAGGCGAGCGCTGG + Intergenic
1136408910 16:30065358-30065380 CGGCCCCGGGCCGCGCGCGCTGG + Intronic
1136454024 16:30370285-30370307 GGGCGCGGCTCGGCGCGCGCCGG + Intergenic
1136458495 16:30395621-30395643 GGGCGGCCGGCGGCGCGGGCAGG + Intronic
1136519552 16:30786937-30786959 GGGGCCCGGGAGGCGGGGGCCGG - Intronic
1136843137 16:33555045-33555067 GGGCGCGAGGCGGGGCGCGCGGG - Intergenic
1137300255 16:47142994-47143016 GGGCTCCGGGGGCGGCGCGCGGG - Intronic
1137548324 16:49419133-49419155 GGGCGCCGGGAAGCGGGAGAGGG - Intergenic
1138327946 16:56191279-56191301 GGGGCGGGGGAGGCGCGCGCCGG - Intergenic
1138503339 16:57462845-57462867 GGGCGCCGGGAGGCCCAAGCCGG + Intronic
1138651360 16:58463373-58463395 GGGGGCCTGGAGGGGCGGGCAGG + Intronic
1139529889 16:67537842-67537864 GGGCGCCGGGACGCCCGGGCCGG + Intronic
1139826645 16:69762450-69762472 GGGCGGCGGGCGGCGCGGGGTGG + Intronic
1140209571 16:72959825-72959847 GGGTGGCGGGGGGCGCGCGCTGG + Exonic
1141150176 16:81559048-81559070 GGGCGGCAGGAGGGGCGCCCAGG - Intronic
1141922244 16:87143918-87143940 GGGCTCTGGGAGGTGCGGGCAGG - Intronic
1141972271 16:87492296-87492318 GGGCGCCGGGGGCCGCGGCCGGG + Intergenic
1142240284 16:88941639-88941661 CGGCGCGGGGAGGCGCAGGCGGG + Intronic
1142409520 16:89908700-89908722 GGGAGCCGGGAGGTGGGAGCTGG - Intronic
1142409525 16:89908714-89908736 GGGAGCTGGGAGGCGGGAGCCGG - Intronic
1142449656 16:90167545-90167567 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1142450638 16:90171362-90171384 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1203153302 16_KI270728v1_random:1855343-1855365 GGGCGCGAGGCGGGGCGCGCGGG - Intergenic
1142456924 17:62329-62351 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1142457432 17:64300-64322 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1142697694 17:1643062-1643084 GGGCGCCGGGAGGAGGGGTCAGG - Intronic
1142863316 17:2776523-2776545 GGGCACCGGGAGGCGGTGGCAGG - Intergenic
1143321181 17:6070298-6070320 GGGCGGCGGGAGGTGCGCACCGG + Intronic
1144909952 17:18672662-18672684 CGGCGGCGGGAGCCGCACGCTGG - Intronic
1146439006 17:32877198-32877220 CGGAGCCGGGAGGCCCGGGCGGG - Intergenic
1146656642 17:34638593-34638615 GGGGGACGGGAGGCGGGCCCGGG - Exonic
1147429551 17:40363052-40363074 GGGCGCCGGGAGGGCAGGGCCGG + Exonic
1148109285 17:45135738-45135760 GGGCGCCGCGGGGCACACGCTGG + Intronic
1148128363 17:45248137-45248159 GGGCGCCGGGACCCGCGGGAGGG - Intergenic
1148150818 17:45395721-45395743 GTGAGCCGGGCGGCCCGCGCGGG - Intronic
1148542630 17:48492626-48492648 GCGCGCCCGGAGAGGCGCGCGGG + Intergenic
1148555807 17:48578002-48578024 GGGCTCCGGGAGGAGGGCCCCGG + Exonic
1148899685 17:50866467-50866489 GGGTGCCGGGCGGGGAGCGCGGG - Intronic
1149678661 17:58488355-58488377 GGGCGCCGGCAGGAGCGGGCAGG - Exonic
1149993764 17:61396592-61396614 GGGCTCCGGGAGGTGCGGTCCGG + Intergenic
1150373680 17:64662406-64662428 CGGGGCCGGCGGGCGCGCGCAGG + Intergenic
1151477897 17:74354205-74354227 GGCCGCCCGGCGGCGCTCGCGGG + Exonic
1151821940 17:76501342-76501364 GGCCGCAGGGAGGTGAGCGCGGG - Exonic
1152049022 17:77958509-77958531 ATGGGCCGGGAGGGGCGCGCGGG + Intergenic
1152069809 17:78128853-78128875 GGGCGCCCGGAGGAGGGCGGGGG - Intronic
1152551996 17:81034777-81034799 GGGGGCGGGGAGGCGGGGGCGGG - Intergenic
1152593112 17:81223211-81223233 GGGCGGCGGGAGGAGCTGGCCGG + Intergenic
1152606278 17:81292534-81292556 GGGCGCAGGGAGACGCCAGCAGG - Intronic
1152677302 17:81648217-81648239 GCGCGCGGGGAGGACCGCGCTGG + Exonic
1152703832 17:81833014-81833036 GGGCGCCTGGGAGCGCGCGTGGG - Intronic
1152724199 17:81937179-81937201 GGTCGCCGGGTGGGGCGCGACGG - Exonic
1152727570 17:81955364-81955386 GGGCCCCGGGAGCCCCACGCCGG - Intronic
1152781456 17:82228934-82228956 GGGGTCCGGGCGGGGCGCGCAGG + Intronic
1152783688 17:82237398-82237420 AGGCGCCGGGAGGGTCGCGGCGG - Exonic
1152793260 17:82293298-82293320 GGGCGCGGGGAGGGGAGGGCGGG + Intergenic
1153636402 18:7117304-7117326 GGGCGCCCGGAGCGGGGCGCCGG - Intronic
1153644090 18:7179004-7179026 GGGCGGCGTGCGGCGCTCGCGGG - Intergenic
1153872645 18:9334807-9334829 GGACGGCGGGAGGCGCGGCCTGG + Exonic
1153900630 18:9614550-9614572 GGGAGCCGGTGGACGCGCGCGGG + Exonic
1156275731 18:35581530-35581552 GGGCGCCGCAGGGCGCCCGCAGG - Intronic
1157496718 18:48161845-48161867 GGCCGCGGGGAGGGGCGCCCGGG - Intronic
1157610107 18:48950626-48950648 GGGGGCCCGGGGGCGCCCGCCGG + Exonic
1159289348 18:66396076-66396098 GGGCGTGGGGAGGCTCGGGCAGG - Intergenic
1159670194 18:71212605-71212627 GGGCGGTGGGCGGGGCGCGCGGG + Intergenic
1160025328 18:75211462-75211484 GAGCGCCCGGAGCGGCGCGCCGG + Intronic
1160025375 18:75211621-75211643 GGGCTGCGGGCGGAGCGCGCGGG - Intronic
1160163324 18:76491547-76491569 GGGGGGCGGGGGGCGGGCGCCGG + Intronic
1160204657 18:76822746-76822768 GGGCGCCGGGAGCGGCGGGGCGG + Intronic
1160646837 19:197688-197710 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1160691234 19:461391-461413 AGGCCCCGGGAGGCGCGGCCAGG + Intergenic
1160730583 19:640081-640103 GGCCGCCGGGATCCACGCGCAGG - Exonic
1160788761 19:913223-913245 GGGCGCCCGGAGGCGGGCAGGGG + Exonic
1160791366 19:925268-925290 GGGCGTGGGGAGGTGCGCGCTGG - Intergenic
1160810798 19:1012207-1012229 GGGAGCCGGGAGCCCCGCCCAGG + Intronic
1160851408 19:1194664-1194686 GGCCGCCAGGTGGCGGGCGCGGG - Intronic
1160904404 19:1445705-1445727 GGGCGCCGAGCTGGGCGCGCGGG - Intergenic
1161210365 19:3062432-3062454 GGGAGCGGGGAGGCGGGCGGCGG - Intronic
1161222089 19:3122477-3122499 GGGCCCCGGGAGGCGGCCCCCGG - Exonic
1161262512 19:3345637-3345659 GGGCGGCGGGAGGGGGGGGCGGG - Intergenic
1161764553 19:6199548-6199570 GAGGGGCGGGAGGGGCGCGCAGG - Intronic
1161851395 19:6739695-6739717 GGGCGGCGGGCGGCGGGCGGCGG + Exonic
1162435236 19:10654304-10654326 GCGGGCGGGCAGGCGCGCGCCGG - Exonic
1162778590 19:12995391-12995413 GGGCGCGGGGAGGGGCGGGCAGG - Intergenic
1163282066 19:16324472-16324494 GGTCCCCGGGATGCTCGCGCAGG + Intergenic
1163427015 19:17245518-17245540 GGGCCCCGGCGGGGGCGCGCGGG + Exonic
1163587891 19:18173737-18173759 GGGCATCGGGAGGCGGGCCCGGG + Exonic
1163655661 19:18543514-18543536 GGGGGCGGGGAGGGGGGCGCAGG - Exonic
1163672210 19:18636174-18636196 GGGCGCTGGCAGGCGTGCCCCGG - Intergenic
1163804134 19:19385947-19385969 GGGCGGCGCGGGGCGCGCTCGGG - Exonic
1165040233 19:33063796-33063818 GGGCGGCGGGTGGCGGGTGCCGG - Intronic
1165040238 19:33063810-33063832 GGGCGGCGGGCGGCGGGCGGCGG - Intronic
1165058526 19:33194131-33194153 GCGCGGCGGGGGGCGCGGGCGGG + Intronic
1165129553 19:33623127-33623149 GGGCGGCGGGAGTCCCGCACTGG - Intronic
1165311370 19:35030913-35030935 GGGCGGCGGGAGTGGCGCTCGGG + Intronic
1165888950 19:39099170-39099192 GGACGGTGGGGGGCGCGCGCAGG + Intronic
1166112218 19:40629575-40629597 GGGCCCCGAGTGGCGGGCGCGGG - Exonic
1166304192 19:41928391-41928413 GAGCGCGGGCGGGCGCGCGCCGG + Intronic
1166361641 19:42255031-42255053 GGGCGCCGGGAGCCGCGGCCCGG - Exonic
1166544292 19:43625019-43625041 GGGCGCCAGGTGGCGGGGGCGGG - Intronic
1166780641 19:45340849-45340871 GGGTGCCGGGAGTGGGGCGCGGG + Intronic
1166783035 19:45352180-45352202 GGGTGCCGGGAGGGGGACGCAGG + Intronic
1166797979 19:45439675-45439697 GGGCGTCGGGACGCGTCCGCCGG - Intronic
1167264632 19:48477595-48477617 GGGCACAGGGAGGGGTGCGCAGG - Intronic
1167391260 19:49196644-49196666 GGGAGCCGGGCGGCGCCGGCTGG - Exonic
1167441906 19:49513510-49513532 GGGCGGCGGGAGGCGGCCCCAGG + Intronic
1167643841 19:50695417-50695439 GGGGGCCGGGAGGGGAACGCGGG + Intronic
1167706263 19:51082937-51082959 GGGCGGCGGGAGGTGGGGGCAGG - Intronic
1168075643 19:53979787-53979809 GGGGGCCGGGAAGGGGGCGCAGG + Intronic
1168144857 19:54415389-54415411 GGGGGGAGGGAGGCGCGGGCCGG - Intronic
1168297303 19:55383739-55383761 GGGCCCGGGGCGGCGGGCGCGGG - Exonic
1168315191 19:55481985-55482007 GCGGGGCGGGAGGCGCGGGCGGG - Exonic
925169840 2:1743911-1743933 GGGCGGCGGGAGGCGAGCGGGGG + Intronic
925376280 2:3388336-3388358 GGGGGCCGGGGAGCCCGCGCCGG - Exonic
925959537 2:9003087-9003109 GGTCGCTCAGAGGCGCGCGCGGG + Intronic
926190065 2:10721669-10721691 GGGCGACGGGCGGCGGGTGCGGG - Exonic
926190122 2:10721846-10721868 GGCCGCGGGGAAGCGCGCGGAGG - Intronic
927709047 2:25313987-25314009 GGGCGCCGGGAGGCAGGCTGGGG + Exonic
927881436 2:26692644-26692666 GGGGGGCGGGGGGCGGGCGCGGG + Intergenic
927881504 2:26692840-26692862 GGGCGCCGGGGGGCCGGCGGCGG + Exonic
927900621 2:26815766-26815788 GGCCGCCGGGTGGGGGGCGCCGG + Intergenic
928094084 2:28393403-28393425 GGGGGCGGGAGGGCGCGCGCAGG + Exonic
929452630 2:42047692-42047714 GGCGGCCAGGAGGCGCGCGGGGG - Intergenic
929646970 2:43637486-43637508 GGGCGCCGGGAGGAGCGGGAAGG + Intronic
929756354 2:44768676-44768698 GGGCTCCGGGACGCGGCCGCCGG + Intronic
929874036 2:45781634-45781656 GGGGGCCGGGGGGCGGGCGCGGG - Intronic
929966707 2:46542495-46542517 GGCCGCGCGGAGGGGCGCGCAGG - Intronic
930046286 2:47175956-47175978 AGGGGGCGGGAGGAGCGCGCGGG - Intronic
930700650 2:54456194-54456216 GGGCGGGGAGAGGAGCGCGCGGG - Intergenic
931321343 2:61177310-61177332 GGACGCGGGGACGCGCGGGCGGG - Intergenic
932036564 2:68252271-68252293 CGGCGCCGCGGGGCCCGCGCCGG + Exonic
932779180 2:74549334-74549356 GGGCGCCGGGCGGAGCAGGCCGG - Intronic
933278219 2:80304613-80304635 GGGCGGCGGGCGGCGGGCGGCGG + Exonic
933278222 2:80304620-80304642 GGGCGGCGGGCGGCGGGCGGTGG + Exonic
934921162 2:98346575-98346597 GGGCGCCGGGAGGTGTGCTGGGG + Intronic
934978345 2:98821926-98821948 CGGCGTCGGGGGGCGCGGGCTGG + Exonic
936452872 2:112646292-112646314 GGTCCCCGGGCGGCGCGCGCGGG + Intronic
936512116 2:113157204-113157226 CGGCGCCGTGCGGGGCGCGCAGG + Intergenic
937993302 2:127675613-127675635 GGGCGCCGGGCGGGGCGTCCCGG - Intronic
938073950 2:128322281-128322303 GGGCGCCGGGCTGCGCGCCGTGG + Intergenic
938466291 2:131527858-131527880 GGGCGACGGAAGGCGCGAGGCGG - Exonic
939153950 2:138502206-138502228 GGGCGCAGTGAGGCGCGAGCAGG - Intronic
939612948 2:144332342-144332364 CGGCCCCGCGAGGCGGGCGCCGG + Intronic
939629424 2:144515992-144516014 GGTCCCCGCGAGGCGCGGGCTGG + Intronic
941029257 2:160493230-160493252 GGGGGCCCGGGGACGCGCGCAGG - Intronic
941808673 2:169734330-169734352 GGGCGCCGCGTGCCGCCCGCGGG - Intronic
941979038 2:171434563-171434585 GGGCCCATGGAGGCGCGGGCCGG - Exonic
942046665 2:172102847-172102869 GGGCTCTGGGAGGCGGGAGCAGG + Exonic
942450818 2:176107102-176107124 TGGCGCCGAGACGCGCGCGCTGG - Intronic
945225845 2:207530389-207530411 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
946843206 2:223837660-223837682 GGGAGCGGGGAGGAGGGCGCGGG - Intronic
946966471 2:225042403-225042425 GACCGGCGGGAGGCGCGCCCCGG - Exonic
947860647 2:233354916-233354938 GCGCCCCGGGCGCCGCGCGCTGG + Intronic
949079865 2:242088461-242088483 GGGCGCGGGGGGGCGGGGGCGGG - Intergenic
1168757118 20:325572-325594 GGGCGGGGAGCGGCGCGCGCGGG + Exonic
1168760702 20:347807-347829 GGGAGCCGGGAGGAGCTCGGTGG - Intronic
1169081636 20:2800734-2800756 GAGGGCCGGGAGGAGCGAGCGGG + Intergenic
1169113349 20:3046804-3046826 GGGCACCGCGACGCGGGCGCTGG + Intronic
1170889809 20:20367885-20367907 GGGCGACCAGGGGCGCGCGCGGG + Intergenic
1171012790 20:21517609-21517631 GGACGCCGGGAGGCCTGCGCAGG + Intergenic
1172483265 20:35284333-35284355 GGTGGCGGGGAGGCGTGCGCAGG - Intronic
1173673000 20:44810700-44810722 GCGCGCGGGGAGGCAGGCGCCGG + Intergenic
1175397329 20:58675364-58675386 GGGCGCCGGGAGGCACGTCCAGG - Intronic
1175429284 20:58891012-58891034 GGGCGCCGGGCGACGCGGTCCGG + Intronic
1175517245 20:59577457-59577479 GGCCGCGGGGAGGCGCCGGCGGG - Intergenic
1175859549 20:62143095-62143117 GGGCGCCCGCGGGCGTGCGCGGG - Intronic
1175861890 20:62154831-62154853 GGGCTCCTGGAGGGCCGCGCTGG + Intronic
1175873813 20:62220300-62220322 GGGCGCTGCGCGGGGCGCGCGGG - Intergenic
1175887989 20:62303081-62303103 GGGCGACCGGAGGCGGGGGCAGG + Intronic
1175902912 20:62367019-62367041 GGGCGCGGGGAGCCGCGCGCCGG + Exonic
1176005800 20:62861716-62861738 GGGCGGCGGGAGGCGGGAGGCGG + Exonic
1176077322 20:63254361-63254383 GGGCTCCAGGAGGCTCGCGGAGG + Intronic
1176194395 20:63830826-63830848 CGGCGCGGGGCGGGGCGCGCGGG - Intronic
1176194633 20:63831441-63831463 CGGCGCCGGGAGCCGAGCGAGGG - Intergenic
1176281653 20:64316843-64316865 GGACGCTGGGAGGCGCGCGTGGG + Intergenic
1176566819 21:8392289-8392311 TGGCGCCCGCGGGCGCGCGCAGG - Intergenic
1177775586 21:25562409-25562431 GGGCACCCGCAGGCGCGCGCGGG - Intergenic
1177782850 21:25639370-25639392 TGGGGGCGGGAGGCGCGGGCAGG - Exonic
1178843545 21:36156702-36156724 GGACGCCTGGAGGCGGGCTCAGG - Intergenic
1179209366 21:39312975-39312997 GGGCGGCGGGCGGCGGGCGGGGG + Intronic
1179209369 21:39312982-39313004 GGGCGGCGGGCGGGGGGCGCGGG + Intronic
1179882656 21:44300014-44300036 GGCGGGCGGAAGGCGCGCGCGGG + Intergenic
1180614894 22:17120665-17120687 GGGCCCCGGGAGCCGCTCGGCGG - Exonic
1180649982 22:17369597-17369619 GGGCGCCGGGCGGGGGGCGGCGG - Exonic
1180797148 22:18611508-18611530 GGGCGCCGGAAGGGGCGCGCCGG - Exonic
1180950653 22:19719073-19719095 GGGCGCCTGGGCGCGCGGGCGGG + Intronic
1181029691 22:20143759-20143781 GGGTGCCGGGAGGTGCGGGTGGG + Intronic
1181094416 22:20495813-20495835 GGGAGGCGGGAGGCGCGAGGCGG + Exonic
1181162039 22:20965133-20965155 GGGGGCGGGGAGGCGCGGGCGGG - Exonic
1181224575 22:21383763-21383785 GGGCGCCGGAAGGGGCGCGCCGG + Exonic
1181254057 22:21551050-21551072 GGGCGCCGGAAGGGGCGCGCCGG - Exonic
1181457965 22:23070367-23070389 GGGCGGCGGGCGGCGCGGGAGGG + Exonic
1181478069 22:23180759-23180781 GCGCGCGGGGCGGGGCGCGCCGG - Exonic
1181831612 22:25564797-25564819 GGGCGCCGGGCGGCGCGCGAGGG + Intergenic
1182211369 22:28679914-28679936 GGGCGCGAGGCGGGGCGCGCGGG - Intergenic
1182257052 22:29046788-29046810 GGGCGCCGGGAGGGGAGCTGTGG + Exonic
1182278672 22:29205949-29205971 GGGCGGCTGGCGGCGCGGGCAGG + Exonic
1184276458 22:43411888-43411910 GGGCGTGGGGAGGCGGGCGGCGG + Intronic
1184276822 22:43413316-43413338 CGGCGCCGGGGGGCGGGGGCGGG + Intronic
1184393839 22:44221031-44221053 GGGAGCCGGGAGGAGGGCACTGG + Intergenic
1184796953 22:46738232-46738254 GGGCGGCGGGCGGCGGGCGGCGG + Exonic
1185255214 22:49827786-49827808 GGGCGGCGGGCGGCGGGCGCGGG + Intergenic
1185259544 22:49853879-49853901 GGGCCGCGGGAGGGGCGCGGGGG + Exonic
1185272391 22:49935333-49935355 GGGCGCGGGGTGGGGCGCGGGGG + Intergenic
1185278779 22:49961104-49961126 GGCTGCAGGGAGGCGCGGGCGGG - Exonic
1185278863 22:49961392-49961414 CGGCGGCGGGGGGCGGGCGCGGG + Intronic
1185413482 22:50697721-50697743 GGGCGCGGGGGGGCGCGGGGGGG + Intergenic
950421514 3:12902391-12902413 GGGAGCCGGGTGGCCCGGGCGGG + Intronic
950438493 3:12994155-12994177 GGGCGCGGGGGGGCGGGGGCGGG + Intronic
951544443 3:23810691-23810713 GGGCGCCGGGAGAGGAGAGCTGG + Intronic
952816692 3:37452761-37452783 CGGCGCCTGGAGGCGGGCGGGGG + Intronic
953618225 3:44510733-44510755 GGGCGGCGGGCGGCGGGCGGCGG + Intergenic
953618228 3:44510740-44510762 GGGCGGCGGGCGGCGGGCGGCGG + Intergenic
953618231 3:44510747-44510769 GGGCGGCGGGCGGCGGGCGGCGG + Intergenic
953618234 3:44510754-44510776 GGGCGGCGGGCGGCGGGCGGCGG + Intergenic
954382564 3:50227422-50227444 GGGGGCCGCGAGGCGGGGGCTGG + Intronic
954428044 3:50453964-50453986 GGGCTCCGTGAGGCGGGGGCAGG - Intronic
954468873 3:50674955-50674977 CGGCGCCGGGAGCCGGGCGGCGG + Intergenic
954702022 3:52455543-52455565 GGGCGACGGGCGGCGGGGGCCGG + Exonic
954717463 3:52533740-52533762 GGGCGGCGGGCGGCGCGCGGTGG - Exonic
954717476 3:52533781-52533803 GGGCGGCGGGCGGCGGGCGGCGG - Intronic
954779273 3:53046717-53046739 GGGCGCCGAAGGGCCCGCGCCGG - Intronic
954912505 3:54121774-54121796 GGATGCCGGGAGCCCCGCGCTGG + Intergenic
956414626 3:69013394-69013416 GCGGGCCGGGAGGCGGGCGTCGG - Intronic
956675096 3:71725488-71725510 GGGCGGCGGGCGGCGGGCGGCGG - Intronic
960702546 3:120451498-120451520 GGGCACCGGGAAGTGGGCGCAGG + Intergenic
961574477 3:127823275-127823297 GGGCGGCGGGCGGCGCGGGGAGG + Intergenic
962316791 3:134364178-134364200 GGGCGCCAGGCAGCGCGCACGGG + Intronic
962318776 3:134374601-134374623 GGGGGCCGGGAGGAGGGAGCGGG - Intronic
962919109 3:139935305-139935327 AGGCACCGGGAGGCGAGAGCCGG + Exonic
963107662 3:141660402-141660424 GGGCGCCCGGCGGGGCGGGCAGG + Intergenic
963808642 3:149752497-149752519 AGGCGCCGGGACACGGGCGCCGG - Exonic
965793332 3:172411801-172411823 GGGCTGCGGGAGGCGGGGGCAGG + Intergenic
965881707 3:173395823-173395845 GACCGGCGGGAGGGGCGCGCAGG + Intergenic
966808732 3:183825555-183825577 GGGAGCGGGGCGGCGGGCGCCGG - Exonic
966911450 3:184562359-184562381 CGGCGTCGGGGGGCGCGCCCGGG + Intronic
968092857 3:195909238-195909260 GGCCGCCGGACGGCGCGGGCTGG - Intronic
968092992 3:195909637-195909659 GAGGGCGGGGAGGCGGGCGCGGG - Intronic
968370844 3:198221834-198221856 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
968596883 4:1490316-1490338 GGGCTCCGGGAGGCGGGAGGCGG - Intergenic
968673665 4:1865504-1865526 GGGCTCAGGGAGGCTTGCGCTGG + Intergenic
968701473 4:2059965-2059987 GGTCCCCGGGAGCCGGGCGCGGG - Intronic
968815132 4:2818128-2818150 CGGGGCCGGGAGGGGCGCGCCGG + Intronic
968835722 4:2963254-2963276 GGGCGCCGGCGGGAGCGCGAGGG - Exonic
968879586 4:3292384-3292406 GGGCCCCGGGACGCCCGCGAAGG - Intergenic
968907980 4:3463334-3463356 GGGCGCCGGGGCGAGCGCGGCGG + Exonic
969113885 4:4859759-4859781 GAGGGGCGGGAGGCGCGCGCGGG + Exonic
969240370 4:5893103-5893125 GGGCGGGGCGTGGCGCGCGCCGG + Intergenic
969285592 4:6200213-6200235 GGGGGGCGGGAGGCGAGCGCTGG - Intronic
969413385 4:7043554-7043576 GGGCGGCGGGCGGCGAGCGGGGG + Exonic
971405624 4:26319477-26319499 GGGCGGCGGGCGGCGGGCGCGGG - Intronic
972671471 4:41216438-41216460 GGGGGCGGGGCGGCGCGCGCAGG + Intronic
973531792 4:51843184-51843206 GGGGACCGCGAGGCGAGCGCGGG + Exonic
975139163 4:70902600-70902622 GGGCGGCGGGCGGCGGGCGGGGG - Intronic
975139168 4:70902607-70902629 GGGCGACGGGCGGCGGGCGGCGG - Intronic
975585070 4:75940918-75940940 GCGGACCGGGAGGCGCGCCCGGG - Exonic
975683397 4:76897514-76897536 GCTCCCCGCGAGGCGCGCGCCGG - Exonic
977206485 4:94169867-94169889 GGGCTGCGCGAGGCGCTCGCGGG + Intergenic
978490052 4:109302760-109302782 GGGCGCCGGGAGGGGGTCGGGGG - Intergenic
978621361 4:110637191-110637213 GAGCGCCGGGGGGAGCGAGCAGG + Intronic
979259318 4:118633557-118633579 GGCCGCCGGGAGGCAGGAGCTGG - Intergenic
979259362 4:118633723-118633745 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
979259537 4:118634386-118634408 GGCCGCCGGGAGGCCGGAGCTGG - Intergenic
979328835 4:119406239-119406261 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
979547107 4:121951392-121951414 GGGGGCGGGAAGGCGCGCGCCGG - Intronic
981475284 4:145180808-145180830 GGTTGGCGGGTGGCGCGCGCAGG - Intergenic
981550283 4:145936627-145936649 GGGGACCGGGAGGGGGGCGCGGG - Intronic
983656482 4:170089987-170090009 GGGCGCGGCGAGGCCCGCGGCGG - Intronic
983940184 4:173529295-173529317 GGGCGCGTGGAGGGGCGCGGAGG - Exonic
983940493 4:173530675-173530697 GGGCGCCGGGAGCCTCGTGACGG + Intergenic
984206346 4:176792409-176792431 GGTCGCCGGGAGGAGCCCGGGGG - Exonic
985064063 4:186104744-186104766 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
988369278 5:30346009-30346031 GGGGGCCGGGGGGGGCGCGGGGG - Intergenic
988578009 5:32444853-32444875 GGGCGCGGGGAAGCCCGCGGGGG + Intergenic
990210889 5:53480645-53480667 GGGCGGCCGGCGGCGAGCGCGGG + Exonic
991711819 5:69415561-69415583 GGGCGCCCAGAGGCTGGCGCGGG + Intronic
992487598 5:77210889-77210911 GGGCGCGGGCGGGCGCGCGGGGG + Exonic
992550139 5:77851987-77852009 GGGAGCCGGGAGCCGGGAGCCGG - Intronic
993502712 5:88680556-88680578 GGGAGCCAGGAGCCCCGCGCGGG - Intergenic
995524997 5:113043738-113043760 GGGCACCGGGTGGCGCCCTCAGG + Intronic
996738319 5:126777098-126777120 GAGGGCCGGGAGGGGCGGGCTGG - Intronic
997454079 5:134004795-134004817 GCGCGCCGGGCCGGGCGCGCAGG - Intronic
998018904 5:138753591-138753613 GGGCCCCGCGAGCCGCGGGCGGG + Intronic
998071089 5:139198430-139198452 GGGCGGGGGGCGCCGCGCGCTGG - Intronic
999272030 5:150302381-150302403 GCGCGCCGGGACGCGCGGGCCGG - Exonic
999462697 5:151771067-151771089 GGGCGCTGCGAGGCGGCCGCGGG - Intronic
1001064988 5:168529360-168529382 GGGCGGCGGGCGGCGGGGGCAGG - Exonic
1001064992 5:168529367-168529389 GGGCGGCGGGCGGCGGGCGGCGG - Exonic
1001822993 5:174724560-174724582 CGGAGACGGGAGGGGCGCGCTGG - Exonic
1002133186 5:177093568-177093590 GGGGGCAGGGACGCGGGCGCCGG + Intronic
1002455484 5:179343902-179343924 GGGCGCCACGAGGCGGGCGTTGG + Exonic
1002638385 5:180619193-180619215 GGGCGCGGGGCGCCGCGGGCGGG - Intronic
1002666891 5:180831615-180831637 GGACGCCGGGAGGCGGGGCCTGG + Intergenic
1002729583 5:181325467-181325489 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1002730078 5:181327390-181327412 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1002784966 6:393381-393403 GGGAGCCGGCGGGGGCGCGCCGG + Intronic
1002896185 6:1381915-1381937 GGGCGCCGGGAGCCGCGAGCAGG + Intergenic
1002925698 6:1604754-1604776 CGGCGCCTGGCAGCGCGCGCCGG - Intergenic
1002926971 6:1610408-1610430 GGGCGGCGGGCGGCGCGGGGCGG + Exonic
1003942669 6:11044367-11044389 GGGGGCGGGGAGGCGCGGGCGGG - Intergenic
1004234235 6:13860157-13860179 GGGCTGCGGGAGGCGCTTGCGGG + Intergenic
1004627885 6:17393806-17393828 GGGCGCCTGGCGGCGGGCGCTGG + Intronic
1004720591 6:18264689-18264711 GGGCGGAGGGATGCGCGCGCGGG + Exonic
1006300740 6:33192519-33192541 GGGCGGCTGGAGGCGGGGGCCGG - Intergenic
1006337444 6:33428004-33428026 CCGCGCCGGGCGGCGCGAGCCGG + Intronic
1006640376 6:35486436-35486458 GCGTGCCGGGGGGCGCGGGCGGG - Intronic
1007444510 6:41895010-41895032 GGGCGGCGGGAGGCGAGAGCCGG - Intronic
1007557789 6:42781910-42781932 GGGCGCGGGGAGCGGCGCCCCGG + Intronic
1007633575 6:43285472-43285494 GGGCCGCGGGTGGCGCGCGTCGG - Exonic
1010001701 6:70955889-70955911 GCACGCCGGGCTGCGCGCGCTGG + Exonic
1011281135 6:85678931-85678953 GTGCGCCTGCGGGCGCGCGCCGG - Intergenic
1012466360 6:99521000-99521022 GGGCGCCAGGAGGCCGGAGCAGG + Intronic
1012939679 6:105403235-105403257 GGGCGCACGGAGGAGCACGCCGG + Intergenic
1013514769 6:110875497-110875519 GGGCGGCGGGCGGCGCGGCCCGG + Intronic
1014798066 6:125748434-125748456 GGGCGCCGGGAGACTGGCGGCGG - Intronic
1015843923 6:137498122-137498144 GGGCACCGAGCGGCGCGCACTGG - Intergenic
1017073725 6:150599812-150599834 GGGCGCGGGGAGGGGCGGGCCGG + Intergenic
1017158238 6:151341590-151341612 GGCAGCCGGCAGGGGCGCGCTGG + Intronic
1017282127 6:152636842-152636864 GGGCGCCGGGCCGCGGCCGCCGG - Intronic
1017877645 6:158537217-158537239 GGGGGCGGCGAGGCGGGCGCGGG - Intronic
1018013603 6:159693338-159693360 GGGCGCGGGGCGGGGCCCGCGGG - Intronic
1018330984 6:162727507-162727529 GGGAGCCCGGCGGCGCGGGCCGG + Intronic
1018669428 6:166167126-166167148 GGGACCCGCGAGGCGCGCCCTGG - Intronic
1018876533 6:167826886-167826908 GGGCGGCGGGCGGCGGGCGCCGG + Intergenic
1019279399 7:192564-192586 GGGCGCCGAGAGGCTCGGCCAGG + Intergenic
1019472832 7:1230262-1230284 GGGCGCGGGGAAGGGCGCGGGGG + Intergenic
1019562603 7:1665982-1666004 GGGCTCCGGGAGGGGCCGGCAGG + Intergenic
1019563577 7:1669351-1669373 GGGCGCCGGCGGGGACGCGCGGG + Intergenic
1019712359 7:2523547-2523569 GTGCGCCGGGCGGCACGCGCTGG + Intronic
1019795252 7:3043819-3043841 GGGCTGCGGGCGGCGCGGGCAGG + Exonic
1019828195 7:3301148-3301170 GGGCGGCGGGCGGCGGGCGCGGG + Intergenic
1020099810 7:5388575-5388597 GGGAGCCGGGGGGCGCCTGCAGG + Exonic
1020204523 7:6104858-6104880 GGCCGCCGGGGGGCGCGCCAGGG - Intergenic
1020212843 7:6168635-6168657 GGGCGCCGGGTGCCAAGCGCAGG - Intronic
1021006191 7:15397342-15397364 GGGCTGCGCGAGGCGCTCGCGGG - Intronic
1021231022 7:18086646-18086668 GCGGGCCGGGAGGCGCGGGCCGG - Intergenic
1021452747 7:20797974-20797996 GGGTGCCGGGAGGTGCGCAGAGG - Intergenic
1021998372 7:26201717-26201739 GGGAGCCGGGAGCTGCGCGCGGG - Intronic
1022207698 7:28180073-28180095 GGGCGGCGGGAGCTGGGCGCTGG - Intronic
1022410378 7:30135108-30135130 CGGCGGCGGGAGGCGGGCGCGGG + Exonic
1022629411 7:32071066-32071088 GCGCGGAGGGAGGGGCGCGCGGG + Intronic
1023400761 7:39792088-39792110 GGGCGCCGGGAGGCAGGAGCTGG - Intergenic
1023400964 7:39792852-39792874 GGTCGCCGGGAGGCCCAAGCTGG - Intergenic
1023401264 7:39794011-39794033 GGCCGCCGGGAGGCTGGAGCTGG - Intergenic
1023781300 7:43658245-43658267 GGGCACCGGGAGGCGGAGGCAGG + Intronic
1024043825 7:45574471-45574493 GGGCGCCGGGGCGCGGGCGGCGG - Intronic
1024074226 7:45810603-45810625 GGGCACCGGGAGGCAGGAGCTGG - Intergenic
1024074272 7:45810769-45810791 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1024075238 7:45814593-45814615 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1024471796 7:49773951-49773973 GCGCGCCAGGCGGAGCGCGCAGG + Exonic
1024521032 7:50304348-50304370 GGCGGCCGAGAGGTGCGCGCGGG + Intronic
1024648348 7:51386670-51386692 GGCCGCCGGGAGGCCAGAGCTGG + Intergenic
1024648668 7:51387925-51387947 GGTCGCCGGGAGGCCCAAGCTGG + Intergenic
1024649062 7:51389429-51389451 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1024649105 7:51389595-51389617 GGCCGCCGGGAGGCAAGAGCTGG + Intergenic
1025052200 7:55741139-55741161 GGCCGCCGGGAGGCTGGAGCTGG + Intergenic
1025052214 7:55741202-55741224 GGTCGCCGGGAGGCCCAAGCTGG + Intergenic
1025053140 7:55744759-55744781 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025053187 7:55744925-55744947 GGGCGCCGGGAGGCTGGAGCTGG + Intergenic
1025069765 7:55887804-55887826 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
1025069768 7:55887811-55887833 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
1025069771 7:55887818-55887840 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
1025069774 7:55887825-55887847 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
1025129155 7:56366822-56366844 GGCCGCCGGGAGGCTGGAGCTGG + Intergenic
1025129171 7:56366885-56366907 GGCCGCCGGGAGGCGCAAGATGG + Intergenic
1025131153 7:56374875-56374897 GGTCGCCGGGAGGCCCAAGCTGG + Intergenic
1025178190 7:56812394-56812416 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025178354 7:56813013-56813035 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025178624 7:56814136-56814158 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025179060 7:56815926-56815948 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025179222 7:56816545-56816567 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025179515 7:56817812-56817834 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025179679 7:56818431-56818453 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025179965 7:56819650-56819672 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025180128 7:56820269-56820291 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025180439 7:56821632-56821654 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025180599 7:56822251-56822273 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025180884 7:56823481-56823503 GGCCGCCGGGAGGCCCAAGCTGG + Exonic
1025181045 7:56824098-56824120 GGTCGCCGGGAGGCATGAGCTGG + Intronic
1025181473 7:56825840-56825862 GGCCGCCGGGAGGCATGAGCTGG + Intronic
1025181756 7:56827059-56827081 GGCCGCCGGGAGGCCCAAGCTGG + Intronic
1025182061 7:56828304-56828326 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025690159 7:63749936-63749958 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025690440 7:63751140-63751162 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025690606 7:63751759-63751781 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025690670 7:63752021-63752043 GGCCGCCGTGAGGCGAGAGCTGG - Intergenic
1025690888 7:63752963-63752985 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025691056 7:63753582-63753604 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025691121 7:63753844-63753866 GGCCGCCGTGAGGCGAGAGCTGG - Intergenic
1025691328 7:63754738-63754760 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025691491 7:63755358-63755380 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025691553 7:63755620-63755642 GGCCGCCGTGAGGCGAGAGCTGG - Intergenic
1025691767 7:63756562-63756584 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025691931 7:63757181-63757203 GGCCGCCGGGAGGCCCAAGCTGG - Exonic
1025691995 7:63757443-63757465 GGCCGCCGTGAGGCGAGAGCTGG - Exonic
1025692214 7:63758385-63758407 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025692379 7:63759004-63759026 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025692444 7:63759266-63759288 GGCCGCCGTGAGGCGAGAGCTGG - Intergenic
1025692660 7:63760208-63760230 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025692823 7:63760827-63760849 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025692888 7:63761089-63761111 GGCCGCCGTGAGGCGAGAGCTGG - Intergenic
1025693076 7:63761887-63761909 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025693240 7:63762506-63762528 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025693304 7:63762768-63762790 GGCCGCCGTGAGGCGAGAGCTGG - Intergenic
1025693522 7:63763710-63763732 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025693683 7:63764329-63764351 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025693747 7:63764591-63764613 GGCCGCCGTGAGGCGAGAGCTGG - Intergenic
1025694162 7:63766316-63766338 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025694179 7:63766379-63766401 GGCCGCCGGGAGGCCGGAGCTGG - Intergenic
1025976758 7:66376642-66376664 GGCCGCCGGGAGGCGGGAGCTGG + Intronic
1026010051 7:66629234-66629256 GGGCGTGGGGAGGGGCGCGGGGG + Intronic
1026045737 7:66904307-66904329 GGCCGCCGCGAGGCACGAGCTGG - Intergenic
1026045833 7:66904609-66904631 GGATGCCGGGAGGCGAGAGCCGG - Intergenic
1027061860 7:75092665-75092687 GGCGGCCGGGAGCCCCGCGCGGG - Exonic
1029169167 7:98618400-98618422 GGTCGCAGGGAGGCGAGCGCAGG + Intronic
1029496334 7:100897057-100897079 GGGCGCTGCGGGGCGCGCGGCGG - Intergenic
1029640455 7:101816512-101816534 GGGCGGCGGGGGGCGGGCGGCGG + Intronic
1029746399 7:102517752-102517774 GGGTGGCGGGCGGCGGGCGCTGG + Exonic
1029764338 7:102616731-102616753 GGGTGGCGGGCGGCGGGCGCTGG + Exonic
1030216034 7:107044736-107044758 GCGCGCCGGGAGCCGCGGGCCGG + Exonic
1031134880 7:117873515-117873537 GGGCGCCTGGAGCCGGGAGCCGG + Intronic
1032013802 7:128363293-128363315 GGGCGGCGGGGGGCGGGTGCTGG + Intergenic
1032051304 7:128652588-128652610 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1032241438 7:130162347-130162369 GGGGGCCGGGAGGGGCTGGCTGG - Intergenic
1032344360 7:131105946-131105968 GGGCGGCGGCGGGCGCGCGCGGG + Intergenic
1032947568 7:136870371-136870393 GGGCGCCGGGCAGCGCGCACAGG - Intronic
1033339230 7:140479112-140479134 GGGCGCGGGGAGGGGGCCGCGGG - Intronic
1033390719 7:140924819-140924841 GGGCGCGGGGAGGAGCGGCCCGG + Intergenic
1034197875 7:149262076-149262098 GGGCGCGGGGCGGCGGCCGCGGG + Intergenic
1034418772 7:150978346-150978368 GGGGGCCGGGAGGCGGGGGCCGG - Intergenic
1035264724 7:157684703-157684725 AGGGGCGGGGAGGGGCGCGCAGG - Intronic
1035264910 7:157685214-157685236 GGGCGGATGGAGGCGCGCGGGGG - Intronic
1035277606 7:157757458-157757480 GGACCCCGGCAGGCGCGGGCAGG + Intronic
1035431979 7:158829378-158829400 GAGGGCCCGGAGGCGGGCGCCGG - Exonic
1035580702 8:737841-737863 GGCTGCCGGGAGCCGGGCGCGGG + Intronic
1036163006 8:6406604-6406626 GCGAGCCTGGCGGCGCGCGCGGG - Exonic
1036578821 8:10054386-10054408 GGGCGCGGGCGGGCGGGCGCGGG - Exonic
1036708070 8:11059722-11059744 GGGGTCCGGGGGGCGCGGGCCGG - Intronic
1036786756 8:11692889-11692911 AGGCGGCTGGAGGCGAGCGCGGG - Intronic
1037116698 8:15236893-15236915 GGGGGCGGGGAGGCGGGAGCCGG - Intronic
1037575274 8:20197184-20197206 GCGTGCTGGGAGGCGCGCGCGGG - Intergenic
1038204959 8:25457903-25457925 GGGCGCGGGGACGGGGGCGCGGG - Intronic
1038319443 8:26513986-26514008 GGGAGGAGGGAGGCGCGGGCGGG - Exonic
1038447574 8:27614674-27614696 CGTCGCCAGGAGGAGCGCGCGGG - Exonic
1038450030 8:27633934-27633956 CGGCGGCGGGATGCGCGCTCTGG + Intronic
1038554025 8:28494224-28494246 TGTCGCTGGGAGGCGCGCGCCGG + Exonic
1038760986 8:30384349-30384371 GGCGGCCGGATGGCGCGCGCCGG - Intergenic
1039554803 8:38468117-38468139 CGCCGCCGGGAGTCGAGCGCCGG - Intronic
1039921429 8:41896707-41896729 GGGCGCCGGCAAGCGAGCTCCGG - Exonic
1040807435 8:51409284-51409306 GGGCGGCGGGAGGGGCTGGCGGG + Exonic
1041690257 8:60679989-60680011 GAGCGCCGGGAGGCGCGGCGAGG + Intronic
1042253088 8:66775464-66775486 GAGCGCGGGGCGGGGCGCGCGGG + Intronic
1043463904 8:80486728-80486750 GGGAGCCGCGGGGAGCGCGCGGG + Exonic
1044320086 8:90791742-90791764 GCGCGGAGGGAGGCGCGCGCGGG + Exonic
1048833446 8:138497327-138497349 GGCCGCCGGGCGGCCCGCCCCGG - Intergenic
1049145930 8:141001093-141001115 GGGCGCCGGGCGCGGGGCGCGGG - Intronic
1049212273 8:141392225-141392247 GGGTCCCGGGACGCGCGGGCAGG - Intronic
1049405428 8:142450026-142450048 CGGCGACGCGAGGCGCTCGCGGG + Exonic
1049541712 8:143211728-143211750 GGGCGCAGGGAGGCGGGTGGGGG + Intergenic
1051171574 9:14322714-14322736 GGGACCCGGGAGGCGGGAGCGGG + Intronic
1051629316 9:19127600-19127622 GGGCGCCGGGACGTGCCCGAGGG - Intronic
1051855439 9:21559696-21559718 GGGCGCCGCCAGGGGCTCGCAGG - Intergenic
1051855461 9:21559773-21559795 GGTCCCCGAGAGGGGCGCGCGGG + Intergenic
1053786346 9:41655246-41655268 CGGGGCCGGGAGGCGGGGGCGGG + Intergenic
1055814132 9:80185390-80185412 GGGCGGGGGGAGGCTCACGCAGG + Intergenic
1056746780 9:89310515-89310537 GGGCGCCAGGAGCCCCGCGACGG + Intergenic
1057207901 9:93184456-93184478 GGGGCGCGGGAGGGGCGCGCGGG - Intergenic
1057259626 9:93576538-93576560 CCGCGCCGGGAGCCGCCCGCCGG - Exonic
1057773082 9:97984194-97984216 GGGCGCCTGGAGGCCTGGGCGGG + Intronic
1057781914 9:98056972-98056994 GGGCGCCGGGAGGGGCGGGGCGG + Intronic
1057883079 9:98807866-98807888 GCGCCCCGGGCGGCGCGAGCCGG + Exonic
1059115755 9:111599201-111599223 GGGCGGCGGGAGGCGAGGGTGGG - Intronic
1059375131 9:113875892-113875914 GGGAGCCGGGGAGCGGGCGCGGG + Intergenic
1060825102 9:126683280-126683302 CGGCGGCGGGAGCCGCGGGCGGG - Intronic
1061000474 9:127899551-127899573 TGGCGCCGGGAGCCGAGCGCCGG + Exonic
1061015876 9:127980645-127980667 GGGTGCCGGGCGGCCAGCGCAGG + Intergenic
1061261245 9:129482230-129482252 GGGGTCCGGGAGGAGCGCGGGGG - Intergenic
1061293657 9:129666024-129666046 GGGCGGCTGGCGGCGCGCCCCGG + Exonic
1061472240 9:130835604-130835626 GGGCGCAGGCGGGAGCGCGCGGG - Intronic
1061486251 9:130921988-130922010 GGACGCGGGGAGGCCCGCACAGG - Intronic
1061573981 9:131494818-131494840 AGGAGCCGGGGTGCGCGCGCTGG + Intronic
1061620270 9:131807314-131807336 GGGAGCCTGGAGGAGAGCGCCGG + Intergenic
1061725613 9:132580536-132580558 GAGCGCCGGGAGCCGGGCGCGGG + Intergenic
1061828327 9:133275264-133275286 GGGCGGCGGGCGGCGCGGGCCGG - Intergenic
1062022306 9:134325467-134325489 GGGCGGCGGGCGGCGCGCGGCGG + Intronic
1062269547 9:135702295-135702317 GTCTGCCGGGAGGCGCGCGGCGG + Exonic
1062314740 9:135961182-135961204 GGGGCCCGGGTGGCGGGCGCAGG - Exonic
1062491643 9:136807885-136807907 GGGCGCCGCGAGGGCCGCGGGGG - Intergenic
1062547610 9:137070694-137070716 TGGCCCTGGGAGGCGCGCGGAGG + Intergenic
1062596690 9:137302766-137302788 GTGAGCCCGGAGGCGCGGGCTGG - Intergenic
1062754493 9:138279904-138279926 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1203578397 Un_KI270745v1:24064-24086 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1185747471 X:2584225-2584247 GCGCGCCCGGAGCCCCGCGCCGG + Intergenic
1186466153 X:9786116-9786138 GCGGGCCGGGAGGGGCGCTCAGG - Intronic
1186821336 X:13291164-13291186 GGGCGCGGGGGGGCGCGGGGGGG - Intergenic
1187507183 X:19887376-19887398 GGGCGCCGGGATCGGGGCGCTGG + Exonic
1190007993 X:46758640-46758662 CGGCGCCAGGAGGAGCGCGGCGG + Intronic
1190323422 X:49191661-49191683 GGGCGCCGGGAGGCGCGCGCAGG + Exonic
1191085569 X:56563901-56563923 GGGCCGCGGGAGGGGCGCGGGGG - Exonic
1197694891 X:129540291-129540313 GGGCGCCGGGAGCCGGGAGCGGG - Exonic
1197694895 X:129540298-129540320 GGGCGCCGGGCGCCGGGAGCCGG - Exonic
1197774488 X:130110588-130110610 GGGCGCGGGGTGGCGGGGGCAGG - Intronic
1197774543 X:130110752-130110774 GGGGGCGGGGTGGAGCGCGCGGG + Intergenic
1198302424 X:135344942-135344964 GTGCCCCGGGCGGCGGGCGCCGG + Intronic
1198388036 X:136147384-136147406 GGGCGGGGCGGGGCGCGCGCGGG - Exonic
1199967245 X:152830780-152830802 GGGAGCGGGGCTGCGCGCGCGGG - Intergenic
1200098149 X:153673741-153673763 GGGCGCGGGGACGCGCGGGGCGG - Intronic
1200129020 X:153830961-153830983 GCGCGCCGGGAGGGGCGGGGAGG + Intergenic