ID: 1190324024

View in Genome Browser
Species Human (GRCh38)
Location X:49195615-49195637
Sequence GTGGTGTGATGGAGGAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 837
Summary {0: 1, 1: 0, 2: 6, 3: 81, 4: 749}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190324017_1190324024 -2 Left 1190324017 X:49195594-49195616 CCTGGGACTAAGGCCTTTCCTGT 0: 1
1: 0
2: 2
3: 22
4: 187
Right 1190324024 X:49195615-49195637 GTGGTGTGATGGAGGAGAGGTGG 0: 1
1: 0
2: 6
3: 81
4: 749

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190324024 Original CRISPR GTGGTGTGATGGAGGAGAGG TGG Intronic
900143818 1:1149603-1149625 GTGGTGGGAAGGGGCAGAGGAGG + Intergenic
900143851 1:1149685-1149707 GTGGTGGGAAGGGGCAGAGGAGG + Intergenic
900204859 1:1427470-1427492 GCAGGGTGATGGAGGGGAGGGGG - Intronic
900243024 1:1625809-1625831 GTGGGGTCAAGGAGAAGAGGGGG + Intronic
900459290 1:2793899-2793921 GAGGTGGGATGGGGGAGAAGAGG - Intronic
900620026 1:3582451-3582473 TTGGTGTCATGGAGGAGACGAGG - Intronic
900971731 1:5995672-5995694 GTGGTGGGATGAAGGAAAGGAGG + Intronic
900993114 1:6106936-6106958 GTGGAGGGATGGAGGAGAGGAGG + Intronic
901007040 1:6177011-6177033 GTGCAGTGATGGTGGGGAGGGGG - Intronic
901206592 1:7501084-7501106 GTGGTGTCAAGGACGAGGGGTGG - Intronic
901545112 1:9950478-9950500 GTCGTGTGATGGCCGATAGGTGG + Intronic
901846338 1:11985053-11985075 GAGGGGTGGTGGTGGAGAGGCGG + Intronic
901879672 1:12186318-12186340 GTGCTGTGAGGAAGGGGAGGAGG + Intronic
902222951 1:14978401-14978423 GGGATGTGATGGTGGGGAGGAGG + Intronic
902695054 1:18134650-18134672 GTGCTGTGGTGGGGAAGAGGGGG - Intronic
902880368 1:19368255-19368277 GTGGTGGGATGGAGCGCAGGCGG + Intronic
903264037 1:22145860-22145882 GTGCTGTGATAATGGAGAGGAGG + Intergenic
903342536 1:22663451-22663473 GGGGTCTGGTGGAGGACAGGGGG - Intergenic
903502103 1:23806398-23806420 GCAGTGTGACTGAGGAGAGGGGG - Intronic
903535038 1:24061153-24061175 GAGGGGTGATGAAGGAAAGGTGG + Intronic
903733958 1:25518051-25518073 GTGATGGGATGGAAAAGAGGAGG - Intergenic
904211637 1:28889711-28889733 GTGGTGGGAGTGAGGAGGGGAGG + Intronic
904349425 1:29895367-29895389 GTTCAGTGAGGGAGGAGAGGAGG + Intergenic
905227155 1:36486790-36486812 CTTGTCTGATGGAGGAGGGGCGG - Intergenic
905523876 1:38622124-38622146 GTGGTTTCATGGAGTTGAGGAGG - Intergenic
905746827 1:40425260-40425282 GTGGTGTGCTGTGGGAGAGGTGG + Intergenic
905875350 1:41428533-41428555 GAGATTTGATGGAGGAGAAGGGG - Intergenic
906448751 1:45925515-45925537 GTGGTGTCCTTGAAGAGAGGAGG + Intronic
907391602 1:54161743-54161765 GTGGTGGGAAGGATGAGAAGGGG - Intronic
907416510 1:54318110-54318132 GGGGTGGGAGCGAGGAGAGGTGG + Intronic
907503990 1:54903887-54903909 GTGGGGGTATGGAAGAGAGGAGG - Intergenic
907516384 1:54995934-54995956 TGGGTGTGATGGAGGAGGTGAGG + Intergenic
907949659 1:59170055-59170077 CTGGTGGTATGCAGGAGAGGTGG - Intergenic
908110816 1:60895573-60895595 GTGGTGTGGGGGCGGAGGGGGGG - Intronic
908486299 1:64597086-64597108 GGGGGGTGCTGGAGGGGAGGCGG + Intronic
908776682 1:67647468-67647490 TTTGTGTGCTGGAGGAGAGGGGG - Intergenic
908879817 1:68718686-68718708 GTGGGGTGAAGGATGAGGGGAGG - Intergenic
909055183 1:70812534-70812556 GTGGGGTGAAGGTGGAGGGGAGG - Intergenic
909181989 1:72436027-72436049 GTGGTAGGATGGAGGGGAGGTGG - Intergenic
909395796 1:75169474-75169496 GAGGTGTGAATGAGGAGAGTGGG + Intergenic
910842714 1:91576290-91576312 GTGGTTCGATGGAGCAAAGGAGG + Intergenic
911626228 1:100127822-100127844 GTGGTGGGGTGGGGGAGGGGGGG + Intronic
912466410 1:109877752-109877774 CGGGTGTGCTGGAGGACAGGCGG + Intergenic
912878110 1:113383557-113383579 GTGGGGTTATGGAGGAGAGAAGG - Intergenic
912893296 1:113558148-113558170 GTGGTCATTTGGAGGAGAGGGGG - Intronic
913018360 1:114762595-114762617 GTCGTGGGATGGGGGAGGGGGGG + Intergenic
913565201 1:120066802-120066824 TTGGTGTGGTGGAGAGGAGGAGG - Intronic
914285790 1:146226159-146226181 TTGGTGTGGTGGAGAGGAGGAGG - Intronic
914546822 1:148676911-148676933 TTGGTGTGGTGGAGAGGAGGAGG - Intronic
914619742 1:149393757-149393779 TTGGTGTGGTGGAGAGGAGGAGG + Intergenic
914704631 1:150160681-150160703 GAGGTTTGAGGAAGGAGAGGGGG - Intronic
915341257 1:155178054-155178076 GGGCTGTGCTGGAGGAGAAGCGG + Exonic
915604112 1:156940084-156940106 CTGGTGTGCTTGAGGAGAGATGG - Intronic
915780682 1:158546829-158546851 GTGGTAGGAGGGAGGAAAGGAGG - Intergenic
916432867 1:164748866-164748888 GGTGTGTGATGGAGGGGTGGAGG + Intronic
916912251 1:169363614-169363636 GTGGTGGGATGGTGCAGGGGTGG - Intronic
917070173 1:171141904-171141926 GTTGTGAGAAGAAGGAGAGGTGG - Intronic
917278655 1:173357828-173357850 GTGGTGTGATGGAAGAGGCCAGG - Intergenic
917460236 1:175223072-175223094 GTGGAGTGATGGAGCTGAAGTGG - Intergenic
917645124 1:177022234-177022256 GTGGTGGGCTGGGGTAGAGGGGG + Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
917868183 1:179217726-179217748 ATGGTCTAATGAAGGAGAGGTGG - Intronic
917971539 1:180211251-180211273 GTGGTGGGGTGCGGGAGAGGTGG + Intergenic
918034235 1:180851351-180851373 GGGGTGTGGTGGAGGAGTAGAGG + Intronic
918217880 1:182408844-182408866 GTGGTGAGCAGGAGGAGAGTGGG + Intergenic
918338884 1:183550805-183550827 GTTGTGTGTTGGAGGAGAGCTGG - Exonic
919609089 1:199722802-199722824 GTGGTTTGTTGGAGGAGAGGAGG + Intergenic
919805448 1:201378695-201378717 GGGGGGTCATGGAGGAGGGGAGG - Intronic
919901266 1:202045988-202046010 ATGCTGTGAGGGAGGATAGGCGG + Intergenic
919933975 1:202239383-202239405 GTGGTGTGTTGGGGGACTGGTGG + Intronic
920041151 1:203098349-203098371 CCAGTGTGATGGAGGAGACGAGG - Intronic
920838552 1:209534590-209534612 GTAGTGTGACGGGGGAGATGTGG + Intergenic
920953783 1:210598690-210598712 GTTGGAGGATGGAGGAGAGGTGG + Intronic
921004007 1:211075098-211075120 GGGGAGAGATGTAGGAGAGGAGG + Intronic
921180968 1:212630869-212630891 GTGATGTGCTGGAGGAGAGTAGG + Intergenic
921253567 1:213319366-213319388 GATGTGTGTTGGAGGAAAGGAGG + Intergenic
922271992 1:224043400-224043422 GGGGAGTGTTGGAGGGGAGGGGG - Intergenic
922272001 1:224043420-224043442 AGGGTGTGCTGGAGGGGAGGGGG - Intergenic
922272029 1:224043498-224043520 GGGGTGTGCTAGAGGGGAGGGGG - Intergenic
922272052 1:224043556-224043578 GGGGTGTGCTGGAGGGGAGGGGG - Intergenic
922272106 1:224043732-224043754 GGGGTGTTCTGGAGGGGAGGGGG - Intergenic
923092650 1:230751850-230751872 GTGGGGTGGGGGAGGGGAGGGGG + Intronic
924769796 1:247069038-247069060 GTGGCGAGCTGGAGGAGAGGTGG + Intronic
1063018668 10:2104126-2104148 ATGGGGTGATGGAGCAGAGCTGG + Intergenic
1063578026 10:7279282-7279304 CTGGTGTGGAGGAGGAGAGATGG - Intronic
1064627595 10:17277037-17277059 GGTGTGTGATAGAGGAGAGAGGG - Intergenic
1065367518 10:24951008-24951030 GCGGTGTGATGGATGGGAGGGGG - Intronic
1065834177 10:29641972-29641994 CTGGTGGGAGGGAGGATAGGAGG - Intronic
1066514108 10:36136735-36136757 GTGGGGGCTTGGAGGAGAGGTGG - Intergenic
1066698995 10:38106430-38106452 GGAGTGTGTTGGAGGAGAAGAGG - Intronic
1067342762 10:45418485-45418507 GGTGTGTGATGGTGGAGACGCGG - Intronic
1067370978 10:45682073-45682095 GTGATGTGATGGAGGAGTCATGG + Intergenic
1067388803 10:45844071-45844093 GTGATGTGATGGAGGAGTCATGG - Intronic
1067417262 10:46112880-46112902 GTGATGTGATGGAGGAGTCATGG + Intergenic
1067502675 10:46819769-46819791 GTGATGTGATGGAGGAGTCATGG + Intergenic
1067659359 10:48222822-48222844 GTTGTGTGTTGGGGGTGAGGGGG + Intronic
1069913693 10:71774640-71774662 ATTGTGTGATGGAGGAGCAGAGG + Intronic
1070283689 10:75068606-75068628 GTGGTGTCATGGAAGAAACGTGG - Intergenic
1070756469 10:78996635-78996657 GTGGTGATGTGGAGGGGAGGAGG - Intergenic
1071016101 10:80998657-80998679 GCAGTGGGATGAAGGAGAGGGGG + Intergenic
1071075526 10:81746853-81746875 GTGGAGTGTTTGAGGAGAGTGGG - Intergenic
1071497710 10:86180131-86180153 GTGGAGAGGTGCAGGAGAGGTGG + Intronic
1071573236 10:86709367-86709389 GGTGTGTGTTGGGGGAGAGGGGG + Intronic
1071700709 10:87931481-87931503 GGAGTCTGATGGATGAGAGGAGG + Intronic
1071710083 10:88041472-88041494 GTGGTGAGAGGGAGGAGGGGTGG + Intergenic
1072428059 10:95347088-95347110 GTGGAGGGATGGAGGTGTGGAGG - Intronic
1072633221 10:97161202-97161224 GTGCTGGGAAGGAGGGGAGGAGG - Intronic
1072923952 10:99599901-99599923 GCGGAGGTATGGAGGAGAGGCGG - Intergenic
1073528761 10:104211673-104211695 CTAGTGTTAGGGAGGAGAGGTGG - Intronic
1073730263 10:106279298-106279320 ATGGGGTGATGGAGGGCAGGGGG + Intergenic
1073743915 10:106443868-106443890 GTAGAGTGATGGAGGGGAGGTGG + Intergenic
1073865559 10:107800459-107800481 GTGGTGTCATGGTGGAGAAGAGG - Intergenic
1074001059 10:109373247-109373269 GTGGGGTGAGGGAAGAGGGGAGG + Intergenic
1074158184 10:110816254-110816276 GTGGTGGGAGGGAGAAGAGCAGG - Intronic
1074293393 10:112158868-112158890 GTGGTGGGATGGAAGGGATGAGG - Intronic
1074410662 10:113225728-113225750 GTGGTGTGAGGGTGGAGTGGAGG + Intergenic
1074583431 10:114743740-114743762 GAGCTGTGATGGAGAACAGGAGG - Intergenic
1075670492 10:124260996-124261018 TTGGAGTGAAGGAGGGGAGGAGG - Intergenic
1075741488 10:124698942-124698964 GTGGTGTGAGTGAGGAGGGGAGG - Intronic
1076386267 10:130058206-130058228 GTGGGGTGGTGGAGTAGGGGTGG - Intergenic
1076465722 10:130680348-130680370 GTGGCCTGATGGAGGAGGGAGGG + Intergenic
1076553542 10:131304940-131304962 GTGGGCTGCTGGAGGAGACGTGG - Intronic
1076621715 10:131793149-131793171 GTGGTCTGTTGGATCAGAGGAGG + Intergenic
1076867710 10:133176165-133176187 GTGGATTGATGGAGGATAGATGG + Intronic
1078304414 11:10169319-10169341 GTAGTGTGGCGGGGGAGAGGAGG - Intronic
1078442454 11:11378882-11378904 GAGGTGTGGTAGAGGGGAGGGGG - Intronic
1079248958 11:18773322-18773344 GGGGTGTGAGGAAGGGGAGGGGG + Intronic
1079496667 11:21052189-21052211 GTGGTGAGATGGGGGAAAGTGGG + Intronic
1080061050 11:27957354-27957376 CTGGGGTGATGGAAGAGAGTAGG - Intergenic
1080557404 11:33430086-33430108 GTGGAGGGAGGGAGGAGAGAGGG - Intergenic
1080668064 11:34353350-34353372 GGGAAGTGATGGGGGAGAGGAGG + Intronic
1080750914 11:35149307-35149329 GTGGTGTAATGAAGATGAGGAGG + Intronic
1081540365 11:44030387-44030409 GGGGAGGGATGGAGGGGAGGGGG - Intergenic
1081685795 11:45042180-45042202 GTGGTGTGCTAGAGGAGAAAGGG - Intergenic
1082003789 11:47408797-47408819 GCGGAGCGATGGGGGAGAGGAGG - Intronic
1082073850 11:47961425-47961447 GTGGTGGGAGGGAGCACAGGAGG - Intergenic
1082757912 11:57096390-57096412 GTGGGGTGGTGGAGGAGAGATGG + Intergenic
1083792382 11:64994371-64994393 AAGGTGGGATGGAGAAGAGGTGG + Intronic
1083811045 11:65107245-65107267 GTGGTCTGATGGAGCAGTTGAGG + Intronic
1084335200 11:68453409-68453431 GGGGTGAGGTGGAGGAGAGATGG + Intergenic
1084438627 11:69158063-69158085 GTGGTGGGAGGGAGGGGAGCAGG + Intergenic
1084519200 11:69653138-69653160 GACGTGTGAGGGAGGACAGGCGG + Exonic
1084540331 11:69782404-69782426 GTGGTGTCAGGGAGGAAAGTGGG - Intergenic
1084616809 11:70241899-70241921 GTGGATGGATGGAGGACAGGTGG - Intergenic
1084832471 11:71780414-71780436 GTGGTCTCATGGTGGGGAGGAGG + Intergenic
1085054100 11:73394135-73394157 GTGGTGGTATGGAGGGTAGGTGG + Intronic
1085277153 11:75307561-75307583 CTGGTGTGATGGAGGAGGCATGG - Intronic
1085461798 11:76698513-76698535 GTGGTGAGGTGGAGGACAGTCGG - Intergenic
1086721958 11:90131750-90131772 CTGCTATGATGGAGAAGAGGAGG + Intronic
1086932202 11:92705442-92705464 GTGGTGTGATGGTGGTGTGATGG + Intronic
1086932243 11:92705647-92705669 GTGGTGTGATGGTGGTGTGATGG + Intronic
1087161832 11:94956436-94956458 CGCGTGTGATGGAGGAGGGGTGG + Intergenic
1087521787 11:99247606-99247628 GTTGTGGGATGGGGGAAAGGGGG - Intronic
1087702454 11:101450801-101450823 GTGGTGAGATGGTGAAGAGTGGG + Intergenic
1087805596 11:102552139-102552161 GAGGTGAGATGGAGTTGAGGAGG + Intergenic
1087997588 11:104829424-104829446 CTGGTGGGAAGGAAGAGAGGAGG + Intergenic
1088815956 11:113421090-113421112 CTGGAGGTATGGAGGAGAGGTGG - Intronic
1088819247 11:113442990-113443012 TTTGCGTGATGGGGGAGAGGAGG + Intronic
1088953469 11:114594033-114594055 GTGGGGGCATGGAGGAGAAGTGG + Intronic
1089001910 11:115059196-115059218 CTGGTGTCTTAGAGGAGAGGAGG + Intergenic
1089155377 11:116398052-116398074 GTGGGGAGATGCAGGAGAAGTGG + Intergenic
1089338677 11:117743237-117743259 GTGGTGAGAGAGAGGAGTGGAGG + Intronic
1089792142 11:120953035-120953057 GGGGTGGGGAGGAGGAGAGGGGG + Intronic
1090213931 11:124943570-124943592 GTGGTGGGATGTGGAAGAGGAGG + Intergenic
1090418770 11:126559032-126559054 GTGGGGTGAGGAAGGAGAGCTGG + Intronic
1090702981 11:129312921-129312943 GTGGTGTGGCGGAGGGGTGGTGG + Intergenic
1091107850 11:132939562-132939584 GCGGTGAGATGGAGGCAAGGTGG - Intronic
1091426015 12:389871-389893 TTGTTTTGATGGAGAAGAGGCGG - Intronic
1091436107 12:474332-474354 GTGTTGTGAGGGAGGGGACGGGG - Intronic
1091596369 12:1881630-1881652 GTGGGGAGAAGGAGGACAGGAGG - Intronic
1091667485 12:2429864-2429886 GTGGTGAGGAGTAGGAGAGGAGG + Intronic
1091679344 12:2515643-2515665 GTGGTGTGAGGCTGGGGAGGTGG + Intronic
1091750951 12:3020920-3020942 GTGACGTGAAGGAGGAAAGGAGG - Intronic
1091854126 12:3725148-3725170 TTGGTGAGATGGAAGAGATGTGG - Intronic
1092124432 12:6065588-6065610 GAGCTGTGAGGGAGGAGGGGAGG - Intronic
1092387188 12:8044826-8044848 TTGGTGTTATAGAGGGGAGGGGG - Exonic
1092793458 12:12088844-12088866 GTGAAGAGCTGGAGGAGAGGAGG + Intronic
1092954005 12:13532614-13532636 GTGGAGTGATGTGGGAGAGAGGG + Intergenic
1093027910 12:14261240-14261262 GTGCAGTGATGGAGGAGAGAGGG + Intergenic
1093946038 12:25110551-25110573 TTGGTGTGCTGGAGGATTGGAGG - Intronic
1095246810 12:39932882-39932904 GTGGGATGATGGAGAAGATGGGG + Intronic
1096098793 12:48956685-48956707 GTGGGGAGAGGGTGGAGAGGAGG - Intronic
1096792878 12:54055751-54055773 GGGGGGTGTGGGAGGAGAGGGGG + Exonic
1096829081 12:54300716-54300738 GGGGGGTGAAGGAGGTGAGGGGG - Intronic
1099256811 12:80324614-80324636 ATGGGCTGTTGGAGGAGAGGAGG + Intronic
1099438161 12:82668317-82668339 GTGGGGGGAAGGAGGGGAGGAGG - Intergenic
1099478707 12:83140393-83140415 GGGGTGTGGTGGAGCAGGGGCGG - Intergenic
1100059640 12:90558615-90558637 GAGGAGTGATGGAGGAAGGGGGG - Intergenic
1100889352 12:99107007-99107029 GTGGTGTAATGGAGTAGGGAGGG - Intronic
1101741563 12:107503819-107503841 GTGGGGTGGCGGTGGAGAGGAGG + Intronic
1101821010 12:108184299-108184321 GGGGGGTGGTGGTGGAGAGGTGG - Intronic
1102241161 12:111325652-111325674 GTGTTGTGGTGGGGGAGGGGTGG + Intronic
1102241171 12:111325687-111325709 GTGTTGTGGTGGGGGAGGGGTGG + Intronic
1102241180 12:111325721-111325743 GTGTTGTGTTGGGGGAGGGGTGG + Intronic
1102241190 12:111325756-111325778 GTGTTGTGGTGGGGGAGGGGTGG + Intronic
1102241209 12:111325823-111325845 GTGTTGTGTTGGGGGAGGGGTGG + Intronic
1102241218 12:111325858-111325880 GTGTTGTGTTGGGGGAGGGGTGG + Intronic
1102241246 12:111325957-111325979 GTGTTGTGGTGGGGGAGGGGTGG + Intronic
1102241268 12:111326027-111326049 GTGTTGTGGTGGGGGAGGGGTGG + Intronic
1102241309 12:111326165-111326187 GTGTTGTGGTGGGGGAGGGGTGG + Intronic
1102241319 12:111326199-111326221 GTGTTGTGGTGGGGGAGGGGTGG + Intronic
1102241329 12:111326234-111326256 GTGTTGTGGTGGGGGAGGGGTGG + Intronic
1102241347 12:111326304-111326326 GTGTTGTGGTGGGGGAGGGGTGG + Intronic
1102241357 12:111326339-111326361 GTGTTGTGGTGGGGGAGGGGTGG + Intronic
1102241375 12:111326406-111326428 GTGTTGTGTTGGGGGAGGGGTGG + Intronic
1102658120 12:114501007-114501029 TTGGAATGCTGGAGGAGAGGGGG - Intergenic
1102964206 12:117113565-117113587 GTTGTGTGCTGCAGGAGATGGGG + Intergenic
1103858504 12:123992223-123992245 GTGGTCTGAGGGTGGAGACGAGG + Intronic
1103879174 12:124152848-124152870 ATGCTGTAATGGAGGAGTGGGGG - Intronic
1104878735 12:132054693-132054715 GTGGAGGGACGGAGGAGTGGAGG + Intronic
1105235752 13:18551677-18551699 GTGGAGTGAAGGAGGAGTAGAGG - Intergenic
1105435906 13:20378208-20378230 GTGGTGGGAGGGAGTAGAGCTGG - Intergenic
1106032870 13:26018313-26018335 CTCGTGGGATGGAGAAGAGGAGG - Intronic
1106140117 13:27005070-27005092 GTGGGGTGATGGGGAGGAGGCGG - Intergenic
1106231651 13:27825610-27825632 GGGGAGTGAGTGAGGAGAGGTGG - Intergenic
1107646114 13:42495973-42495995 GTGGAGAGCTGGAGGAGAGGGGG - Intergenic
1107687926 13:42922795-42922817 GTAGTGTGAGAGAGGAGAGCTGG + Intronic
1107887245 13:44883886-44883908 ATGGAATGAAGGAGGAGAGGAGG + Intergenic
1108013536 13:46048668-46048690 GTAGGGTGAGGGAGGTGAGGAGG - Intronic
1108134209 13:47338178-47338200 GCTGTGTGATGCAGCAGAGGTGG + Intergenic
1108215542 13:48180436-48180458 GTGGGGAGTTGGAGGAGAAGAGG + Intergenic
1108624166 13:52211166-52211188 GTGGTGTGGGGGAGAAGATGGGG - Intergenic
1108664404 13:52615536-52615558 GTGGGGAGTTGGAGGGGAGGTGG + Intergenic
1109587277 13:64423041-64423063 GTTGTGTGGTGGGGGGGAGGGGG - Intergenic
1110052758 13:70924334-70924356 ATGCCGTGAAGGAGGAGAGGAGG + Intergenic
1110682706 13:78335159-78335181 GAGGTGGGAAGTAGGAGAGGAGG - Intergenic
1110868070 13:80420184-80420206 GTGGGGAGATGGGGGAGAAGTGG - Intergenic
1111759068 13:92438787-92438809 TAGGTGTGAAGGAGGAAAGGAGG + Intronic
1112432411 13:99361729-99361751 GTTATGTGAAGGAGGGGAGGGGG - Intronic
1113101292 13:106722149-106722171 GTGGTGGGCTGGTGGAAAGGGGG + Intergenic
1113203476 13:107891708-107891730 GTGGTGGGGTGGGGGGGAGGGGG + Intergenic
1113632423 13:111897429-111897451 GTGGCGTGATGGAGTTGGGGAGG + Intergenic
1113677118 13:112214916-112214938 GGGGAGGGCTGGAGGAGAGGTGG + Intergenic
1113881567 13:113629662-113629684 GTGATGTGTGGTAGGAGAGGTGG + Intronic
1114186355 14:20405423-20405445 GAGGTGTGAAGGAGGGGATGGGG - Intronic
1114514454 14:23288879-23288901 GTGAAATGAGGGAGGAGAGGAGG - Intronic
1115504668 14:34081737-34081759 GAGGTCTGAGGGAGGAAAGGTGG - Intronic
1115739066 14:36368185-36368207 GTGGTGTGATGGTCAAGAGAGGG + Intergenic
1115755862 14:36525455-36525477 GTGGTGGGAGGTTGGAGAGGAGG - Intergenic
1116379011 14:44240979-44241001 GTAATGTGAGGGAGGACAGGAGG - Intergenic
1117374803 14:55110557-55110579 GTGGTCTGATGGAGGTGAACTGG - Intergenic
1117439970 14:55750153-55750175 GTGGTGTCATGGTGAAGAGTGGG + Intergenic
1117973388 14:61274282-61274304 GTGGGGTGTTGGAGGAAAAGTGG + Intronic
1118413501 14:65507440-65507462 GTGGTGGGATGAGGGAGAGGTGG - Intronic
1118974630 14:70666091-70666113 GTGGTTAAATGGAGGCGAGGTGG + Intronic
1119231477 14:72983343-72983365 GTGGTGGGGTGGGGGGGAGGGGG - Intronic
1119319162 14:73719223-73719245 GGGGTGGGGTGGAGGGGAGGGGG - Exonic
1119407129 14:74405954-74405976 CTGCTGTGATGCAGGAGTGGAGG + Exonic
1119745495 14:77040815-77040837 GGGGTGTGAAAGAGGAGAGCGGG - Intergenic
1120191174 14:81441093-81441115 GTGGGGTGTTGGAGGGAAGGAGG - Intergenic
1120217606 14:81696895-81696917 TGTGTGTGGTGGAGGAGAGGGGG + Intergenic
1120829106 14:88982421-88982443 TTGCTGTGGTGGAGGTGAGGGGG + Intergenic
1121103846 14:91267929-91267951 CTGGGGTTTTGGAGGAGAGGTGG + Intergenic
1121278786 14:92685651-92685673 GTGGGGTGATGGAGTTGGGGAGG - Intronic
1121423202 14:93830121-93830143 GTGGAGTGAGGGAGGAAAGGAGG + Intergenic
1121806857 14:96834849-96834871 ATCTTGTGATGGAGGAGAGATGG + Intronic
1121876682 14:97459171-97459193 GCGTTGTGAAGGGGGAGAGGTGG + Intergenic
1122369761 14:101222990-101223012 GTGTTGTCAGGGAGGAGAGTTGG - Intergenic
1122426221 14:101607653-101607675 GAGGAGAGGTGGAGGAGAGGAGG - Intergenic
1122426259 14:101607801-101607823 GAGGAGAGGTGGAGGAGAGGAGG - Intergenic
1122426313 14:101608002-101608024 GAGGAGAGGTGGAGGAGAGGAGG - Intergenic
1122426326 14:101608055-101608077 GAGGAGAGGTGGAGGAGAGGAGG - Intergenic
1122501972 14:102206810-102206832 GAGCTGTGATGGGGGAGTGGAGG + Intronic
1122611334 14:102985288-102985310 GGGGTGGTATGGAGGTGAGGAGG + Intronic
1122721314 14:103724087-103724109 GTGGGGTGATGGAGGATCCGTGG + Intronic
1122758070 14:103998061-103998083 AAGGTGTGGTGGAGGGGAGGAGG + Intronic
1122784459 14:104157422-104157444 GGAGTTTGATGGGGGAGAGGCGG + Intronic
1122866310 14:104605729-104605751 GTAGTGTGATGGGGTAGGGGAGG - Intergenic
1122939373 14:104974397-104974419 GTGGGGTGAGGATGGAGAGGTGG - Intronic
1123438440 15:20272677-20272699 GTGGTCAGCTGGGGGAGAGGAGG - Intergenic
1123772353 15:23541104-23541126 GTGGAGAGTTGGGGGAGAGGAGG - Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124055116 15:26235126-26235148 GTGGTGGGAGGGAGGCGGGGTGG - Intergenic
1124964478 15:34423131-34423153 GAAGTGTGATGGAGGGGAGAGGG - Intronic
1124981097 15:34569357-34569379 GAAGTGTGATGGAGGGGAGAGGG - Intronic
1125339751 15:38663120-38663142 GTGTTTTAATGGTGGAGAGGTGG + Intergenic
1126240522 15:46437668-46437690 GTGGGGTGAGGGAAGAGGGGAGG - Intergenic
1126422285 15:48487473-48487495 TTGGTCTGGTGGAGGAGATGAGG - Intronic
1127373855 15:58363990-58364012 GTGATGCGTTGGAGGAGAAGAGG - Intronic
1127390032 15:58497898-58497920 ATTGTGTGTTGGGGGAGAGGAGG - Intronic
1127598143 15:60507798-60507820 GTGGAGTGAAGGATGAGAAGAGG + Intronic
1128255464 15:66192926-66192948 GTGGTGTGATGGAGAGGAATAGG + Intronic
1128278013 15:66370467-66370489 GTGGGGGGCTGGAGGGGAGGAGG + Intronic
1128317636 15:66671170-66671192 GGGGTGGGATAGAGGAGGGGCGG - Intronic
1128530448 15:68441555-68441577 GTGGTGGTGTGGAGGAGGGGTGG + Intergenic
1128530449 15:68441558-68441580 GTGGTGTGGAGGAGGGGTGGAGG + Intergenic
1128756122 15:70185212-70185234 GTGGTGGGAAGGAGAGGAGGAGG + Intergenic
1128877629 15:71215147-71215169 GCGGCGTGATGGAGCAGACGCGG + Exonic
1129901095 15:79149909-79149931 GTGGGGTGGTGGGGGAGGGGAGG + Intergenic
1129998003 15:80023398-80023420 GTGCTGGGAGGGAGGAGTGGAGG - Intergenic
1130067344 15:80615771-80615793 GGGCTGTGTTGGAGGATAGGGGG - Intergenic
1130145957 15:81273791-81273813 GTGGGTTGATGGAAGAAAGGTGG - Intronic
1130532846 15:84760708-84760730 GTGGTTGGGTGGAAGAGAGGAGG + Intronic
1130702959 15:86204267-86204289 ATGGTGTGAGGAAGGACAGGGGG - Intronic
1131229147 15:90647414-90647436 GGGGTGTGGTGGAGGAGAAGGGG - Intergenic
1131672891 15:94639284-94639306 GTGGTGGGATGGGGGTAAGGAGG + Intergenic
1132425308 15:101710884-101710906 GTGGCGTGGTGGTGAAGAGGAGG + Intronic
1133392818 16:5422980-5423002 GTGGGGAGAGGGAGGAGGGGAGG + Intergenic
1133580430 16:7139451-7139473 TTTGAGTGATGGAAGAGAGGAGG + Intronic
1133945296 16:10342939-10342961 GTGATGGGAGGGAGGATAGGAGG - Intronic
1134241575 16:12510717-12510739 GGGGGGTGGGGGAGGAGAGGAGG - Intronic
1134663042 16:15998472-15998494 GGGCTGTGATGGAGGTGATGTGG + Intronic
1134812846 16:17181947-17181969 ATGGTGAGAAGGTGGAGAGGAGG + Intronic
1135610177 16:23859528-23859550 GTGCTGTAATGGTGGAGAGGGGG + Intronic
1135835561 16:25822352-25822374 GAGGCGTTTTGGAGGAGAGGAGG - Intronic
1135940424 16:26817384-26817406 GTGGTGTGATGGCTGAGAGGGGG - Intergenic
1136091704 16:27925386-27925408 GTGGTGGGAGGGAGGAGGGGTGG + Intronic
1136282550 16:29222313-29222335 GTGGTGCTCTGGGGGAGAGGAGG - Intergenic
1137230391 16:46560197-46560219 GTGGTGAGGTGGAGGAGAAGGGG - Intergenic
1138295195 16:55879518-55879540 GTGATGAGATGCAGGAGTGGAGG - Intronic
1138497707 16:57418292-57418314 GTGGGGTGGGGGAGGAGGGGAGG - Intergenic
1138516093 16:57536250-57536272 GCGGGGTGATGGGGGAGGGGAGG - Intronic
1138855611 16:60687549-60687571 GTCGTGGGATGGGGGAAAGGGGG + Intergenic
1139264210 16:65623954-65623976 GTGGGGAGAGGGAGGAAAGGAGG - Intergenic
1139500164 16:67356705-67356727 ATAGAGGGATGGAGGAGAGGCGG + Intronic
1139660831 16:68419672-68419694 GTGCTATGTTGGAGGTGAGGAGG - Intronic
1140165367 16:72544589-72544611 GTGATCTTTTGGAGGAGAGGAGG - Intergenic
1140726348 16:77816412-77816434 GTGTGATGATTGAGGAGAGGTGG + Intronic
1140905017 16:79402516-79402538 TGGGTGTGACGGGGGAGAGGTGG + Intergenic
1142002633 16:87672129-87672151 GTGGGGTGAGGGAGAAGAGTGGG + Intronic
1142086927 16:88188237-88188259 GTGGTGCTCTGGGGGAGAGGAGG - Intergenic
1203141683 16_KI270728v1_random:1771358-1771380 GGGCTGGGATGGAGGAGAAGAGG - Intergenic
1203141700 16_KI270728v1_random:1771405-1771427 GGGCTGGGATGGAGGAGAAGAGG - Intergenic
1142694115 17:1623888-1623910 GAGGGGTGATTCAGGAGAGGAGG - Intronic
1142706395 17:1697688-1697710 CTGGGGAGATGGAGGAGATGGGG - Intergenic
1143022849 17:3925638-3925660 GTGGAGTGAAGGAGGCGTGGGGG - Intronic
1143388339 17:6545450-6545472 GCGATGGGAGGGAGGAGAGGGGG - Intronic
1143435661 17:6922765-6922787 GGGGTGTGCTGGGGGAGAGACGG - Intronic
1144035932 17:11366083-11366105 GTGGTGTGAGGGAGGGAAGCTGG + Intronic
1144063235 17:11601729-11601751 GTGCTGAGAGAGAGGAGAGGGGG - Intronic
1144081015 17:11763930-11763952 GTGGTGTGTTTGTGGAGAGAGGG + Intronic
1144269438 17:13602053-13602075 GGGGTGGGATGGAGAAAAGGTGG + Intergenic
1144318402 17:14087629-14087651 GTGGCCTGATGGAGGGAAGGAGG + Intronic
1144366236 17:14547535-14547557 GTGGTGACATGGAGGAAAGTTGG + Intergenic
1144375267 17:14633703-14633725 GTGGTTGGAGGGAGGAGAGCAGG - Intergenic
1144621748 17:16822667-16822689 ATGATGAGGTGGAGGAGAGGAGG - Intergenic
1144765034 17:17727935-17727957 TTGGTGTGCTGCAGGGGAGGGGG - Intronic
1145717530 17:27036284-27036306 GTTCTGTGATGGCTGAGAGGAGG - Intergenic
1145925853 17:28645872-28645894 GGGCCCTGATGGAGGAGAGGAGG + Intergenic
1146297755 17:31662987-31663009 GTGGTGAGAGGCATGAGAGGAGG - Intergenic
1146659429 17:34654495-34654517 GTGGTGGAATGTAGGAGAGCTGG - Intergenic
1147314436 17:39612790-39612812 GTGGTGCCATGGGGGAGGGGAGG + Intergenic
1147326525 17:39672354-39672376 GTGGTGTCCTGGAGGAGGGTGGG + Exonic
1147345892 17:39794844-39794866 CTGGAGTGATGGAGGAAGGGAGG - Intronic
1147422130 17:40327107-40327129 GTGGTGGGCTGGGGGTGAGGTGG + Intronic
1147444053 17:40464055-40464077 GGGGTGGGAGGTAGGAGAGGGGG + Intergenic
1148000377 17:44384209-44384231 GTGGTTTGGTGGAGGCGGGGCGG + Intronic
1148334500 17:46832403-46832425 GGGGGGTGGTGGAGGAGAGAAGG + Intronic
1148439024 17:47702313-47702335 GGGGTGTGATTGGGGTGAGGAGG + Intronic
1148753036 17:49956847-49956869 GGTGGGTGAAGGAGGAGAGGAGG - Intergenic
1148863393 17:50616195-50616217 GCGGTATGATGGAGGGGCGGGGG + Intronic
1148871501 17:50661082-50661104 GTGGATTGATGAAGGAGAGCAGG - Exonic
1149040015 17:52176813-52176835 GTGGTGGGGTGGTGGAGAGCAGG + Intergenic
1149174051 17:53848059-53848081 ATTGTGTGAAGGAGGAAAGGAGG - Intergenic
1149382250 17:56105890-56105912 GTGGTGTTACTGGGGAGAGGAGG + Intergenic
1149468387 17:56897381-56897403 GTGGTGTGATGGGGGTCTGGGGG - Intronic
1149981988 17:61318115-61318137 CTGGTGTGATGGTGGCGGGGAGG - Intronic
1150165832 17:62941629-62941651 ATGGTGAAATGGAGAAGAGGTGG + Intergenic
1150288426 17:63967073-63967095 GTGGTGTGATGAAGGAGGACAGG + Intronic
1150580898 17:66473065-66473087 GGGGAGTGGAGGAGGAGAGGTGG - Intronic
1150582957 17:66491967-66491989 GGGGTGTTGGGGAGGAGAGGGGG + Intronic
1151449731 17:74191095-74191117 CTGGTGGGATGGAAGTGAGGTGG + Intergenic
1152063671 17:78097980-78098002 GTGGCGTGATGAAGGATGGGTGG + Intronic
1152075756 17:78158725-78158747 GTAGTGTGAGGGGGAAGAGGAGG - Intronic
1152233689 17:79127392-79127414 GAGCGGTGAGGGAGGAGAGGAGG + Intronic
1152462743 17:80449949-80449971 GTGGAGAGAAGGAGGACAGGGGG - Intergenic
1153161560 18:2210396-2210418 GTTGTGTGGTGGGGGGGAGGGGG + Intergenic
1153387137 18:4510791-4510813 GTGGTGTGGTGGTGGTGTGGTGG + Intergenic
1153387156 18:4510867-4510889 GTGGTGTGGTGGTGGTGTGGTGG + Intergenic
1153387159 18:4510878-4510900 GTGGTGTGGTGGTGGTGTGGTGG + Intergenic
1154513788 18:15138321-15138343 GTGGAGTGAAGGAGGAGTAGAGG + Intergenic
1155317390 18:24586201-24586223 CTTGTGAGAGGGAGGAGAGGAGG - Intergenic
1155623383 18:27807188-27807210 CTGGTGTGATGGAGTTGAGGTGG - Intergenic
1156083911 18:33376261-33376283 CTGGTGTGTTGGGGGAGGGGCGG + Intronic
1156189517 18:34702124-34702146 CTGGTGTGATGGAGGAATGCAGG - Intronic
1157479390 18:48043900-48043922 GAGCTGTAAGGGAGGAGAGGAGG + Intronic
1158045658 18:53152620-53152642 CTGTTGTCATGGAGAAGAGGAGG - Intronic
1158424344 18:57325561-57325583 TAGGGGTTATGGAGGAGAGGTGG - Intergenic
1158497523 18:57969984-57970006 GTGGAGTGATGAAGGAGAAGAGG - Intergenic
1158551701 18:58441551-58441573 GTGGAGAGAGGGAGGCGAGGTGG + Intergenic
1159267448 18:66101055-66101077 GTGCTTTCATGGAAGAGAGGGGG + Intergenic
1159793643 18:72816089-72816111 GGGGAGGGGTGGAGGAGAGGGGG - Intronic
1160161279 18:76472959-76472981 GTGGGGAGAGGGAGGAGATGGGG + Intronic
1160545305 18:79649020-79649042 GTGGTGGGATGGAGGACTGAGGG - Intergenic
1160745957 19:710660-710682 GCTGTGTGATGGAGGGGGGGTGG - Intronic
1161030720 19:2056676-2056698 GGGGTGGAAGGGAGGAGAGGAGG - Intergenic
1161091992 19:2365404-2365426 TTGGGGCGATGGAGGAGGGGAGG + Intergenic
1161329371 19:3678914-3678936 ATGGAGGGATGGAGGAGTGGAGG + Intronic
1161364099 19:3868558-3868580 GTGGTCTGACCGAGGAGGGGAGG - Intronic
1161488300 19:4547793-4547815 GGGGAGTGAGGGAGGAGGGGAGG - Intronic
1161497984 19:4597914-4597936 GAGGGGTGAGGGAGGAGAAGGGG + Intergenic
1161498002 19:4597962-4597984 GAGGGGTGAGGGAGGAGAGGGGG + Intergenic
1161750546 19:6092968-6092990 GTGGTGTCGGGGAGGCGAGGAGG + Intronic
1161943219 19:7418786-7418808 GGGGAGAGAGGGAGGAGAGGAGG + Intronic
1161999124 19:7731985-7732007 GGGGTTTGATGGGGGAGGGGAGG - Intronic
1162007043 19:7787641-7787663 GGGGTTTGATGGGGGAGGGGAGG + Intergenic
1162610643 19:11747997-11748019 GTGGGGTGGTGATGGAGAGGTGG - Intergenic
1163272997 19:16265476-16265498 CTGGTGTGCAGGAGGAGATGGGG + Intergenic
1163406438 19:17126013-17126035 TGGGTGTCATGGAGGTGAGGAGG - Intronic
1163447169 19:17353497-17353519 GTGGAGTGATGGAGGGGAACGGG - Intronic
1163554700 19:17985244-17985266 GGGGTGTGATGGAGGCAAAGGGG + Intronic
1163607455 19:18282707-18282729 GGGGTGTGAGGGAGGAGAGATGG + Intergenic
1163914711 19:20230853-20230875 GGTGTGTGATGGAGCAGAGAGGG + Intergenic
1164364635 19:27563068-27563090 GTGGGGTGGGGGAGGGGAGGGGG + Intergenic
1164580505 19:29432288-29432310 GAGGTGTGAGGGGAGAGAGGGGG - Intergenic
1164725370 19:30462245-30462267 CTGCTGTGATGGATGGGAGGAGG + Intronic
1164799262 19:31062477-31062499 GAGGTGGGATGGTGGGGAGGGGG + Intergenic
1164918100 19:32067993-32068015 GTGGTGTGAGGAAGGAGGGATGG - Intergenic
1164937179 19:32223958-32223980 TTGCTGGGATGGAGGAGACGAGG - Intergenic
1165034412 19:33022577-33022599 GTGGTCAGCTGGGGGAGAGGAGG - Intronic
1165089498 19:33375831-33375853 GTGGTGTGAGGGAGGAGAGAGGG + Intronic
1165305166 19:34999235-34999257 GTGGTGTGAAGGAAAAGAGAGGG + Intronic
1165324086 19:35104163-35104185 CTGGTGTGTTGGAGGAGTGGTGG + Intergenic
1165789533 19:38483229-38483251 GTGGTGTGGTGGGACAGAGGGGG + Intronic
1165914882 19:39252279-39252301 GTGGGATGAGGGATGAGAGGAGG - Intergenic
1166351379 19:42199997-42200019 GTGGTGGGCTGGAGAAGAGGAGG - Intronic
1166679069 19:44756527-44756549 GGGGTCTGATGGAGGAGGGCTGG + Intronic
1166878046 19:45909978-45910000 GTAGTGTGCTGGAGAAGAGATGG + Intergenic
1167470060 19:49670534-49670556 GTCATGTGATAGAGGAGGGGCGG + Intronic
1167566690 19:50261437-50261459 GAGGGGTGATGACGGAGAGGGGG - Intronic
1168099537 19:54133917-54133939 GTGGAGAGAGGGAGGGGAGGTGG - Intergenic
1168099605 19:54134102-54134124 GTGGAGAGAGGGAGGGGAGGTGG - Intergenic
1168312032 19:55465216-55465238 GCAGAGTGAGGGAGGAGAGGGGG + Intergenic
925079643 2:1053914-1053936 GGGGCGGGAGGGAGGAGAGGAGG - Intronic
925398237 2:3552543-3552565 GTGGTGGTGTGGAGGGGAGGGGG - Intronic
925398248 2:3552568-3552590 GTGGTGGTGTGGAGGGGAGGGGG - Intronic
925927995 2:8684569-8684591 GTGGGGGGATGAAGGAGAAGGGG - Intergenic
925989101 2:9239449-9239471 GTGTGGTGATGGAGGGGTGGTGG + Intronic
926075760 2:9941755-9941777 GTGGAGGCATGGAGGAGGGGTGG - Intergenic
926123748 2:10258620-10258642 GTGGTCGGAGGGTGGAGAGGTGG - Intergenic
926127297 2:10279438-10279460 ATGATGTGGTGGAGAAGAGGAGG + Intergenic
926680024 2:15655898-15655920 GTGGAGTGATTGGGGTGAGGAGG + Intergenic
926719196 2:15946311-15946333 GCGCTGTCATGGAGGTGAGGTGG - Exonic
926721323 2:15963469-15963491 GTCGTGTGGTGGAGGGGAGCGGG + Intergenic
927216953 2:20672742-20672764 TTGGTGTGGGGGAGCAGAGGTGG + Exonic
927478932 2:23435079-23435101 TGGGTGTGATGGGGGTGAGGAGG + Intronic
927517376 2:23680241-23680263 TTGGTGTGATGAGGGAGGGGAGG + Intronic
927556607 2:24038861-24038883 TTGCTGTGATGGAGCAGACGTGG + Exonic
927862808 2:26570739-26570761 GTGCAGTGATGGGCGAGAGGAGG + Intronic
928253363 2:29701065-29701087 GTGGTGTTATGGAGAATAGCTGG - Intronic
928656296 2:33455041-33455063 ATGTGGTGATGGAGGAGAGTGGG + Intronic
929191000 2:39139595-39139617 GGGTGGTGATGGGGGAGAGGGGG - Intergenic
929446898 2:42009058-42009080 GTGGTGTGATGGTGGTGGGTTGG + Intergenic
929661557 2:43790905-43790927 GTGGTGTGGTTGAGAAGAGATGG + Intronic
931115450 2:59162054-59162076 GTGGTGGGGTGGGGGGGAGGGGG - Intergenic
931197248 2:60064340-60064362 GAGGGGTGGAGGAGGAGAGGAGG + Intergenic
931209999 2:60183760-60183782 GTGGTGTGATGTAGATGTGGAGG - Intergenic
931855286 2:66296538-66296560 GTGATGACATGGAAGAGAGGTGG - Intergenic
931932413 2:67154184-67154206 GTAGGGGGCTGGAGGAGAGGTGG + Intergenic
932206561 2:69888623-69888645 CTGGGGTGGTGAAGGAGAGGTGG + Intergenic
932354559 2:71058375-71058397 GGGGTTTGAAGGTGGAGAGGGGG + Intergenic
932437400 2:71710661-71710683 GGGGTGTGGTGGGGGAGAGCTGG + Intergenic
933658438 2:84907304-84907326 GTGGTGGGAGGGAGGAAGGGTGG + Intergenic
933996194 2:87671755-87671777 CTGGTGTGATGGTTGAGAGAAGG + Intergenic
935168632 2:100591807-100591829 GTGGTGTGGTGGGGGGGGGGCGG + Intergenic
936297660 2:111279157-111279179 CTGGTGTGATGGTTGAGAGAAGG - Intergenic
936419108 2:112346812-112346834 GTGGTGTGATGGTGGTGCGATGG - Intergenic
936694894 2:114934497-114934519 GGGCTGAGAAGGAGGAGAGGAGG + Intronic
937132995 2:119527265-119527287 GGGGGGTGGTGGAGAAGAGGAGG - Intergenic
937477136 2:122225827-122225849 CTGGCAGGATGGAGGAGAGGAGG - Intergenic
938514031 2:131982932-131982954 GTGGAGTGAAGGAGGAGTAGAGG + Intergenic
938593028 2:132758011-132758033 GTGATTTGGTGGAGGAAAGGGGG - Intronic
938683427 2:133714501-133714523 GTGGTGGGAGAGGGGAGAGGAGG - Intergenic
938702053 2:133888288-133888310 GTGGGGGGAAGGAGGTGAGGCGG + Intergenic
938730304 2:134142057-134142079 GTGGAGCGAGTGAGGAGAGGTGG + Intronic
940535962 2:154944561-154944583 GTGGTGTGTTGGGGGAAAGGAGG + Intergenic
941476177 2:165953887-165953909 GTGCTGTAATGGAGCAGGGGCGG + Intergenic
942712170 2:178848770-178848792 GTGGTGGGGTGGAGGTGGGGAGG + Intronic
943687002 2:190829326-190829348 ATGGTGTGATGGAGAAGCAGTGG + Intergenic
944599139 2:201285361-201285383 GTAGTGTGATGGAGTAGGGGGGG - Intronic
944858845 2:203794992-203795014 GAGGTGTGAGGGTGGAGAGTAGG + Intergenic
945412443 2:209527495-209527517 GTGGTGAGAAAGAAGAGAGGCGG - Intronic
945760549 2:213908919-213908941 GTTGTGTGGTGGGGGGGAGGAGG - Intronic
945836325 2:214839651-214839673 GAAGTGAGATGGAGAAGAGGAGG + Intergenic
945931956 2:215864331-215864353 GTGGTGGGGTGGCGGAGGGGTGG - Intergenic
946127018 2:217571756-217571778 GTGTTGTCATGGAGAGGAGGAGG + Intronic
946159348 2:217826635-217826657 GTGGTGCGAGTGAGGAGTGGAGG - Intronic
946969878 2:225079870-225079892 GTGGTGAGATGGGGGGAAGGGGG - Intergenic
946990659 2:225325986-225326008 CATGTGTGATGGGGGAGAGGAGG + Intergenic
948458817 2:238119432-238119454 GAGGGGAGGTGGAGGAGAGGAGG + Intronic
948511286 2:238466822-238466844 GAGGTGTGCTGGAGGGGGGGTGG + Intergenic
948728342 2:239948030-239948052 GTGGTGAGGTGGAGGAGGTGAGG + Intronic
1169404766 20:5314389-5314411 GTGGTGTGAGGGAGGTGCGAGGG + Intergenic
1169483303 20:6005187-6005209 GTGGGGCGATAGTGGAGAGGCGG + Intergenic
1170234329 20:14085033-14085055 GGGGGGTGGTGGGGGAGAGGTGG + Intronic
1171056043 20:21908092-21908114 GATGTGTGGTGTAGGAGAGGAGG + Intergenic
1172011038 20:31845694-31845716 GTGGGGCGAGGGAGGAGGGGAGG - Intergenic
1172125126 20:32621134-32621156 GGGGTGGGATGGTGGGGAGGAGG + Intergenic
1172280089 20:33701856-33701878 GTGGTTTTGTGGAGTAGAGGAGG + Intergenic
1172913887 20:38429652-38429674 GTGGTGGGAGGGAGGAGGTGTGG + Intergenic
1173528257 20:43749378-43749400 ATGGTGGGCTGGGGGAGAGGAGG - Intergenic
1173791130 20:45828423-45828445 ATGGAGGGATGGAGGAGAGGAGG + Intronic
1173964079 20:47098657-47098679 GTGGTGAGGTGGGAGAGAGGTGG - Intronic
1175402984 20:58711117-58711139 GTGGGGAGGAGGAGGAGAGGGGG - Intronic
1175433096 20:58921002-58921024 TTGGTGAGGTAGAGGAGAGGGGG + Intergenic
1175486918 20:59353443-59353465 GGGGTGTCCTGGAGGAGAGGGGG + Intergenic
1175763696 20:61578651-61578673 GAGATGAGATGGAGGAGAGGTGG - Intronic
1175934980 20:62510231-62510253 GTGGTGGGATGGAGGGGTGAAGG - Intergenic
1175935009 20:62510307-62510329 GTGGTGGGATGGAGGGGTGAAGG - Intergenic
1175935162 20:62510722-62510744 GTGGAGGGATGGAGGGGTGGAGG - Intergenic
1176041383 20:63067718-63067740 GAGGTGGGAGGGAGGAGGGGTGG + Intergenic
1176779753 21:13179963-13179985 GTGGAGTGAAGGAGGAGTAGAGG - Intergenic
1176899872 21:14427163-14427185 GTGGGGGGTTGGAGGAGAGGTGG + Intergenic
1176995302 21:15548520-15548542 GTAGTGTGATGGAGGGAGGGTGG + Intergenic
1177977398 21:27868998-27869020 GTGGAGTGAAGGAGGAGTAGAGG - Intergenic
1179958687 21:44756039-44756061 CTGGAGTGATGGAGAAGAAGAGG + Intergenic
1180081650 21:45490111-45490133 GTGGAGGGATGGAGGAGTGGGGG - Intronic
1180112151 21:45664762-45664784 GTGGTGGGGTGGGGGGGAGGGGG - Intronic
1180234708 21:46451022-46451044 GGGGTGTGAAGTAGAAGAGGCGG - Intergenic
1180706416 22:17812984-17813006 GTGGGGTGCGGGAGGAAAGGGGG + Intronic
1181495190 22:23283689-23283711 GTGGGAGGATGGGGGAGAGGGGG - Intronic
1182810381 22:33111190-33111212 GAGGAGAGATGGGGGAGAGGTGG + Intergenic
1183354542 22:37351151-37351173 GAGGGGAGAAGGAGGAGAGGAGG - Intergenic
1183468553 22:37993069-37993091 GTGGAGGGAAGGAAGAGAGGGGG + Intronic
1183483493 22:38077329-38077351 GGGGTGTGATGTATGGGAGGAGG + Intergenic
1183508031 22:38220207-38220229 GAGGTGTGGAGGGGGAGAGGAGG + Exonic
1183717721 22:39543638-39543660 GTGGAGTGGTGGAGGAGGGGAGG + Intergenic
1183729962 22:39612845-39612867 GTGGAGGGATGGAGGGAAGGAGG - Intronic
1184058425 22:42067443-42067465 GGTGTGTGTTGGGGGAGAGGTGG - Intronic
1184987233 22:48144176-48144198 GTGGTGTGAGTGAGGAATGGAGG + Intergenic
1185376570 22:50485359-50485381 AAGGTGTGAAGGAAGAGAGGAGG - Exonic
1185414350 22:50701615-50701637 AGGGTGTGATGGAGGAAAGGAGG + Intergenic
949202315 3:1394067-1394089 GGGGACAGATGGAGGAGAGGGGG + Intronic
950540165 3:13607706-13607728 GAGGAGTGAGGGATGAGAGGTGG + Intronic
950609209 3:14114485-14114507 GTGGTGAGATGTAGGGGAAGGGG - Intronic
951455421 3:22886768-22886790 GTGGTGTGTGTGAGGGGAGGTGG - Intergenic
951729447 3:25794789-25794811 GTGGCGGGATGCAGGAGGGGTGG - Intergenic
951760582 3:26143251-26143273 GTGGGGTGTTGGAGGGGAGGTGG + Intergenic
951904901 3:27695400-27695422 GTGGGGTGATAGTGGGGAGGTGG + Intergenic
952167657 3:30768565-30768587 GTGGGGAGGGGGAGGAGAGGCGG + Intronic
952344235 3:32469060-32469082 GTGGTCTGGTCCAGGAGAGGAGG - Intronic
952708012 3:36399593-36399615 GCTGAGTGATGGAGGACAGGTGG + Intronic
952949462 3:38508515-38508537 GTGGAGTGAAGCAGAAGAGGTGG + Intronic
953669830 3:44952899-44952921 GTCTTGTGATGTAGGAGAGATGG - Intronic
953677873 3:45017382-45017404 GTTGTGGGAAGGAGGAGGGGTGG - Intronic
954216222 3:49125929-49125951 GTGGGTTGATGGGGCAGAGGTGG - Intronic
954436371 3:50498495-50498517 GTGGAGGGGTGGAGGAGAGGAGG - Intronic
954659823 3:52221123-52221145 GTGGGGTGAGGGAGGCGAGCAGG + Exonic
954912720 3:54122481-54122503 GGGGAGGGAGGGAGGAGAGGTGG - Intergenic
954936668 3:54333158-54333180 ATGGTGTGGTGGAATAGAGGTGG + Intronic
955005615 3:54965850-54965872 GGGGTGTGAGTGAGGAGAGAGGG + Intronic
956065194 3:65390276-65390298 GTGTTGTGATGGTGGAGATTCGG - Intronic
956483316 3:69694897-69694919 GTGGGGTGAAGGAGAAGAGAGGG + Intergenic
957948057 3:87089404-87089426 GAGGCCTGATGGAGGACAGGAGG - Intergenic
958769803 3:98412562-98412584 GTTGTGGGATGGAGGGAAGGGGG + Intergenic
959259486 3:104057017-104057039 GGGGTGTGGTGGAGGAATGGAGG + Intergenic
959673213 3:109002843-109002865 GTGGTGTGAAGGAGTAGGGCAGG - Intronic
960030967 3:113054492-113054514 GTGGTGTGGTGGGGGAGTGTGGG - Intergenic
960291574 3:115891786-115891808 GAAGTGTGATGGAAGAGAAGAGG - Intronic
960418288 3:117412298-117412320 TTGGTGTGCTGGGGGAGGGGAGG - Intergenic
960536053 3:118815683-118815705 GTGGTGTGATGGCGGACTTGGGG - Intergenic
960590899 3:119364227-119364249 GTGGGGGGATGGAGGTGGGGGGG + Intronic
960684213 3:120280701-120280723 GTGGTGTGAGTAAGGAGAGAAGG - Intronic
960732760 3:120744315-120744337 GGGAAGTGATGGAGGAGAGAAGG + Intronic
961298944 3:125909514-125909536 GTGGTCTCATGGTGGGGAGGAGG + Intergenic
961324820 3:126103838-126103860 GTGGTGTCTTACAGGAGAGGCGG - Exonic
961560796 3:127728197-127728219 GCGGGGAGATGGAGGAGATGGGG - Intronic
962450088 3:135505995-135506017 GAGCTGTGATGGAGGACAGGGGG - Intergenic
962564665 3:136645452-136645474 GTGATGTGATGGAGGTGAAATGG - Intronic
962941056 3:140125131-140125153 GTGGGTTGAGGGAGGATAGGGGG + Intronic
963068916 3:141286560-141286582 GTTGTGTGTTGGAGGAAAGAAGG + Intronic
963132661 3:141872958-141872980 ATTGGGTGGTGGAGGAGAGGTGG + Intergenic
963540881 3:146586673-146586695 GTGGTGAGTCGGAGGAGTGGTGG + Intronic
963725782 3:148920005-148920027 GGTGTGTTATGGAGGAAAGGAGG - Intergenic
963964383 3:151349284-151349306 ATGGGGTGGTGGTGGAGAGGTGG + Intronic
964144502 3:153442733-153442755 GTGTTGTGCTGGTGGGGAGGGGG - Intergenic
964645819 3:158957438-158957460 GTGGTGGGGTGGGGGGGAGGGGG - Intergenic
966155701 3:176913950-176913972 GTGGTGTGATGAAGAATAAGAGG - Intergenic
966807549 3:183818841-183818863 GTGGTGTGATGGGGGAAGGCGGG + Intronic
966917656 3:184593793-184593815 CTGGGCTGATGGAGGAGTGGTGG + Intronic
967320436 3:188189889-188189911 GAGGGGTGATTGATGAGAGGAGG + Intronic
967409690 3:189154763-189154785 GGTGTGTGTTGGGGGAGAGGGGG + Intronic
967519678 3:190415198-190415220 GTGGTGTTGTGGGGGAGAGTTGG - Intergenic
967669923 3:192220577-192220599 GTCGAGTGATGTATGAGAGGCGG - Intronic
967870340 3:194224209-194224231 GTGGGGTGCTGGAGGGGAGGGGG - Intergenic
968045809 3:195623483-195623505 CTGGTGTGGTGGAGGGGTGGAGG + Intergenic
968308847 3:197666604-197666626 CTGGTGTGGTGGAGGGGTGGAGG - Intergenic
968807468 4:2784736-2784758 GTGGGGAGATGGCGGATAGGAGG - Intergenic
968912695 4:3484105-3484127 GCTGTGTGATGGTGGACAGGTGG + Intronic
968917437 4:3502693-3502715 GTTGTGTGGTGGAGGAGCCGTGG + Intergenic
968949757 4:3684364-3684386 GTGGTGGGATGGAGGGTAGGGGG - Intergenic
969087124 4:4664766-4664788 GTCGTGTGATTGGAGAGAGGGGG - Intergenic
969115638 4:4869170-4869192 GTGGTGGGGGGGAGGAGTGGGGG + Intergenic
969402953 4:6968966-6968988 GTGGTTTGTTGGGGGTGAGGCGG + Intronic
969424356 4:7115591-7115613 GAGGTGAGGTGGAGGTGAGGAGG + Intergenic
969611399 4:8229464-8229486 GGGGTGTGATGGGGGTGAGCAGG + Intronic
969647958 4:8444284-8444306 GTGGAGGGTTGGGGGAGAGGTGG + Intronic
970263119 4:14250655-14250677 GTGATGTGGTTGAGGAGAAGGGG + Intergenic
970289418 4:14555004-14555026 GTGGTGGGGTGGGGGAGGGGGGG + Intergenic
970368957 4:15389009-15389031 CTGGTGGGGTGCAGGAGAGGAGG + Intronic
971085182 4:23266627-23266649 GGGGGGTGATGGGGGAGGGGAGG + Intergenic
971304218 4:25466033-25466055 GTGGTGTAATGGGTGAGAGGTGG + Intergenic
971462094 4:26910819-26910841 GTGGTGTGGTGGGGTACAGGTGG + Intronic
971707386 4:30063684-30063706 GTAGTGAGATGGAGTAGAGATGG - Intergenic
972109490 4:35539872-35539894 GTGGTTTGATGGATGAGGGGAGG + Intergenic
972216563 4:36904526-36904548 TTGGTGTGGAGGAGGGGAGGTGG + Intergenic
972968622 4:44544580-44544602 TTGGAGGGATGGAAGAGAGGAGG + Intergenic
973563981 4:52165351-52165373 GTGGTGTGAGGGGGGAGGGTGGG - Intergenic
973934260 4:55827190-55827212 GAGGTGTGAGGGTGGACAGGTGG - Intergenic
974353117 4:60774699-60774721 GTGATGGGTTGGAGGAGGGGTGG + Intergenic
974371676 4:61023996-61024018 GTCGTGGGATGGGGGAGAGGGGG + Intergenic
974700550 4:65439416-65439438 GTGGTGTGGGGGTGGAGATGTGG - Intronic
975162776 4:71143085-71143107 GTGGGGGGATGGGGGAGAGATGG - Intergenic
976203153 4:82599345-82599367 GAGGTGGGGTGGGGGAGAGGAGG + Intergenic
976363177 4:84203701-84203723 GTGATGTTTTGGAGGAGAAGAGG - Intergenic
976370924 4:84287020-84287042 GTGATTTTTTGGAGGAGAGGAGG - Intergenic
977238496 4:94538471-94538493 GTAGTGTGGTGGAGGAGGGAAGG + Intronic
977745126 4:100537658-100537680 GTGGTGGGATTGCGGGGAGGTGG + Intronic
978692404 4:111529669-111529691 GTGGTGGGAGGGAAGTGAGGGGG + Intergenic
978789345 4:112644297-112644319 GTGTTGCGATGGAGAGGAGGGGG + Intronic
981012936 4:139944324-139944346 GTGGTGGGATGGGGGGAAGGGGG - Intronic
981262543 4:142738458-142738480 GTGGTGTGGGGGAAGAGGGGAGG + Intronic
981583396 4:146273360-146273382 GTGGTGTGATGGAAAGGACGTGG + Intronic
981832089 4:149013675-149013697 GTGTTGTGATGCAGAAGAGTTGG + Intergenic
981853096 4:149255125-149255147 GGGTTGGGTTGGAGGAGAGGTGG - Intergenic
981980719 4:150787780-150787802 GTGGGAGGATGGAGGAGAGGTGG - Intronic
982066423 4:151658441-151658463 CTGGAGTGATGGAGGTGATGGGG + Intronic
982265156 4:153531888-153531910 GTGGGGAGGTGGTGGAGAGGTGG - Intronic
982285699 4:153731805-153731827 GTGGTGGGATGGTGGAGGGAGGG + Intronic
982510327 4:156274729-156274751 GGGGTGGGATGGAGGGGATGGGG + Intergenic
983263473 4:165482810-165482832 GTGGTGTCAGGGAGGGGAAGTGG + Intronic
983515695 4:168654223-168654245 ATGGTGTGGTGGGGAAGAGGTGG - Intronic
984258855 4:177419964-177419986 GTGGAATGATGGAGAATAGGAGG - Intergenic
984740622 4:183158004-183158026 AAGGTGAGATGGAGGAAAGGGGG - Intronic
985049617 4:185975732-185975754 GGGGTGGCATGGAGGAGATGAGG + Intergenic
985747484 5:1655359-1655381 CTGGTGTGGTGGAGGGGTGGAGG - Intergenic
986527784 5:8699114-8699136 GTCATGTGGTGGAGGGGAGGGGG + Intergenic
986535207 5:8779457-8779479 GGGGGCTGATGGAGGAGAGAGGG + Intergenic
986755456 5:10831859-10831881 GTGGGGGGATAGAGGAGAGAGGG + Intergenic
987018347 5:13844108-13844130 GTGCTGTGGTGGAGGAGACAGGG - Intronic
987118422 5:14744727-14744749 AAGGTGTGGTGGGGGAGAGGGGG + Intronic
987201385 5:15581348-15581370 GTGGGGAGATGGAGGATGGGCGG - Intronic
988209473 5:28184673-28184695 GTGGTGGGATGGGGGGAAGGGGG - Intergenic
988640645 5:33037620-33037642 GTGGTAGCATGGAGGAGAGAGGG - Intergenic
990089170 5:52019608-52019630 GTTGTGGGATGGGGGGGAGGGGG + Intronic
991372704 5:65936149-65936171 GAGGTCTGATGGAGGGGGGGTGG + Intronic
992627181 5:78646953-78646975 ATTGTGTGTTGTAGGAGAGGGGG - Intronic
992636068 5:78726999-78727021 GGGGGGTGAGGGAGGAGTGGTGG + Intronic
992883855 5:81138157-81138179 GTGGGGTGATGGTGGGGAGGAGG + Intronic
992948584 5:81833984-81834006 GAGATGACATGGAGGAGAGGCGG - Intergenic
993137261 5:83984841-83984863 GTGTTTTGTTGAAGGAGAGGGGG + Intronic
994006911 5:94848029-94848051 GTGGTGAGCAGGTGGAGAGGAGG + Intronic
996354943 5:122585285-122585307 GTGGAGTGGGGGAGAAGAGGAGG - Intergenic
997612346 5:135224015-135224037 TTGCTGAGATGGAGGAGAAGAGG + Intronic
998106382 5:139471748-139471770 CTGGGGTCCTGGAGGAGAGGGGG - Intergenic
998981201 5:147704519-147704541 TTGGTGTTAGGGAAGAGAGGAGG + Intronic
999152924 5:149438451-149438473 GTGGTGGGATGGAGGCGGAGTGG + Intergenic
999279411 5:150355229-150355251 GTGGTTTGATTGAGGAGAGGAGG - Intergenic
999306513 5:150522929-150522951 TTGGTGTGAGCCAGGAGAGGAGG + Intronic
999341437 5:150777152-150777174 GTGTTGGGATGCAGGAGTGGGGG - Intergenic
1000024191 5:157344711-157344733 TTCATGTGAGGGAGGAGAGGCGG - Intronic
1000112318 5:158120745-158120767 GTAGTGAGAAGGAGGAAAGGGGG - Intergenic
1000692720 5:164343304-164343326 GTGGGCTGGTGGAGGAGAGATGG - Intergenic
1001068459 5:168560338-168560360 GAGGTTTGAAGGAGGTGAGGGGG - Intronic
1001173299 5:169442141-169442163 GTGGTGTGAGGAAGGTGAGAAGG - Intergenic
1001298577 5:170516974-170516996 GTGGTGTGATGGTGGTGATGGGG + Intronic
1001897201 5:175392683-175392705 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897213 5:175392716-175392738 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897225 5:175392749-175392771 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897237 5:175392782-175392804 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897249 5:175392815-175392837 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897261 5:175392848-175392870 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897273 5:175392881-175392903 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897285 5:175392914-175392936 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897297 5:175392947-175392969 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897309 5:175392980-175393002 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897321 5:175393013-175393035 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897333 5:175393046-175393068 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897345 5:175393079-175393101 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897357 5:175393112-175393134 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897369 5:175393145-175393167 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897379 5:175393178-175393200 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897393 5:175393213-175393235 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897404 5:175393247-175393269 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1002092182 5:176812054-176812076 GGGGTGGGATGGAGTAGAGAGGG - Intronic
1002347163 5:178556032-178556054 GTGCTGTGATGGAGGGAAGAAGG - Intronic
1002616691 5:180460700-180460722 TGGGTGTCATGGAGGAAAGGAGG + Intergenic
1002912504 6:1501139-1501161 GTGGAGTGAAAGAGGTGAGGGGG + Intergenic
1003264236 6:4551575-4551597 GGGCTGGGAGGGAGGAGAGGAGG - Intergenic
1003545154 6:7052345-7052367 TTGCTGTGAGGGTGGAGAGGGGG + Intergenic
1003789047 6:9521884-9521906 TCGGTGGGATGGAGAAGAGGAGG - Intergenic
1003874446 6:10423640-10423662 GAGGGGGGATGGAGGAAAGGGGG + Intergenic
1003899804 6:10644018-10644040 GTGGAGTGAGGGAGGAGTTGGGG - Intergenic
1003940012 6:11015441-11015463 GTGGTGTGATGAGGTAGGGGAGG - Intronic
1005223915 6:23619975-23619997 GTGGGGGGAGGGGGGAGAGGGGG + Intergenic
1005341857 6:24850761-24850783 GTGTTCTGGTGGAGAAGAGGGGG - Intronic
1005506883 6:26477126-26477148 GTGGTGTGAAGAAGAAGAAGAGG - Intergenic
1006413504 6:33889878-33889900 GTGGTGGGTTGGAGGAGGGTAGG - Intergenic
1006423531 6:33949950-33949972 GTGGAGAGTTGGTGGAGAGGCGG + Intergenic
1006791569 6:36704497-36704519 TTCCTGTGATGGGGGAGAGGGGG - Intronic
1007184813 6:39960568-39960590 GTGGAGTGTGGGAGGAGAGAGGG - Intergenic
1007239742 6:40416426-40416448 GTGGTGGGTGGGAGGAGTGGTGG + Intronic
1007273110 6:40653322-40653344 ATGGTATGATGGAGAAGACGAGG - Intergenic
1007450175 6:41936317-41936339 GTGGTGTGCTGGAGTGGGGGTGG - Intronic
1007642624 6:43354895-43354917 GTGGTTTGACGGTTGAGAGGTGG + Exonic
1008191844 6:48468283-48468305 GTGTGGGGATGGAGGAGAAGTGG + Intergenic
1012480917 6:99665934-99665956 GCTGTGTGAGGGAGAAGAGGTGG + Intergenic
1012509817 6:99990845-99990867 AGGGTGGGAAGGAGGAGAGGTGG - Intronic
1013171227 6:107638080-107638102 GTGATTTAGTGGAGGAGAGGTGG - Intronic
1013324490 6:109031398-109031420 GTGGTGTGAGGCTGGAGAGGAGG - Intronic
1013350205 6:109298772-109298794 GTGGTGGGAAGGAGGAGAGGTGG - Intergenic
1014022774 6:116610154-116610176 GTGTTTTTATGGAGGAGAGTGGG - Intergenic
1015535562 6:134264046-134264068 GTGTTGTTATGGAGTAAAGGCGG + Intronic
1017082144 6:150680299-150680321 GTGGAGTGATGGAAAAAAGGTGG + Intronic
1018650148 6:165986292-165986314 GGGGTTGGATGGAGGGGAGGGGG + Intronic
1019168942 6:170117764-170117786 GGTGTGTGACTGAGGAGAGGGGG - Intergenic
1019615555 7:1958066-1958088 GTGATGTGATGGCGGAGTGCAGG + Intronic
1019732231 7:2634560-2634582 GCGGGGGGATGGAGGGGAGGTGG + Intronic
1019826031 7:3285128-3285150 GGGGTGTGATAGAGGAGGGAAGG - Intergenic
1021891241 7:25188212-25188234 CTGGTGAGATGGGGGAGATGCGG - Intergenic
1022227938 7:28382744-28382766 GTGGTTTGATGGGGGTGAGGGGG - Intronic
1022509352 7:30925359-30925381 GAGTTGTGATGGAGGGGAGAGGG + Exonic
1023496225 7:40800238-40800260 GTGGTCTGAGGCAGGAGTGGGGG + Intronic
1023514485 7:40987295-40987317 CTGGTGGGGTGGAGGAGAGGAGG + Intergenic
1023924352 7:44654856-44654878 GTGCTGTGAGGGAGGAGAGAGGG - Intronic
1024023146 7:45389218-45389240 CTGGTCTGACGGAGGAGAAGAGG - Intergenic
1024249864 7:47497987-47498009 GGGGTGTCACGGAGGAGAGAAGG - Intronic
1024578487 7:50783015-50783037 GGGCTGTGGGGGAGGAGAGGAGG - Intronic
1024864708 7:53891951-53891973 GTGGTGTTGGGGGGGAGAGGTGG - Intergenic
1025117193 7:56268428-56268450 GAGGTGGGAAGGAGGAAAGGAGG - Intergenic
1027597767 7:80197091-80197113 ATGGGGTGGGGGAGGAGAGGAGG - Intronic
1027685484 7:81274777-81274799 CTGGAGCGATGGAGGAGGGGTGG - Intergenic
1028239764 7:88405241-88405263 GTGGTGTGTTTGGGGAGAGTTGG - Intergenic
1028676199 7:93464744-93464766 GTGGTGAGTTGGAAGAAAGGAGG + Intronic
1028891160 7:95989839-95989861 GTGTTGTGATGCAGGAGGTGAGG - Intronic
1029156410 7:98520843-98520865 GTGGGGTGCTGGATGAGAGTGGG + Intergenic
1029380642 7:100212240-100212262 GTAGGGAGATGGAGGATAGGGGG - Intronic
1029490524 7:100867812-100867834 GTGGGGTGGCGGAGGACAGGAGG - Intronic
1029708972 7:102289318-102289340 GTGGTGTGGTGGAGGGGCAGGGG + Intronic
1030015518 7:105216377-105216399 CTGGTGAGATGAAGGAAAGGAGG + Intronic
1030916630 7:115322570-115322592 CAGGTGTGATGAAGGAGTGGAGG + Intergenic
1031387412 7:121168714-121168736 GTGGAGCGCTGGAGGAGAGGTGG - Intronic
1031760840 7:125711252-125711274 GTCGTGTGGTGGGGGGGAGGGGG + Intergenic
1032122601 7:129168062-129168084 GGGCTGGGATGGGGGAGAGGAGG - Exonic
1032231203 7:130076041-130076063 ATGGTGGGGTGGAGGAGTGGGGG + Intronic
1033370894 7:140706674-140706696 GGGGTGGGGTGGTGGAGAGGTGG + Intronic
1034258947 7:149742202-149742224 GTGGTTTGATGGAGGAGCAAAGG - Intergenic
1034497910 7:151433115-151433137 GTGGTGTGCAGAAGGGGAGGAGG - Intronic
1034701186 7:153097865-153097887 GACGTTTGATGGAGGAGAAGCGG + Intergenic
1036561699 8:9904439-9904461 GGGGAGGGAGGGAGGAGAGGCGG + Intergenic
1037363627 8:18099549-18099571 CTAGTGTGATGTAGTAGAGGAGG - Intergenic
1038040798 8:23722542-23722564 GTGGTGGGGTGGAGGGGTGGTGG + Intergenic
1038589557 8:28824282-28824304 GTTGGGGGAAGGAGGAGAGGAGG - Intronic
1040962896 8:53053700-53053722 ATGGTGTCATGGAGGCCAGGTGG - Intergenic
1041023201 8:53658593-53658615 GTGTGGTGATGCAGGTGAGGGGG + Intergenic
1041883835 8:62785422-62785444 GTGGTGAGGAGGAGGAGAGATGG + Intronic
1041988241 8:63953194-63953216 ATGGTTAGATGGAGGAAAGGAGG - Intergenic
1042058845 8:64795374-64795396 AGGGTTTGATGGAGAAGAGGAGG - Intronic
1042212505 8:66394887-66394909 CTGGTGTGATGGAGGGCAGAAGG + Intergenic
1042224351 8:66503992-66504014 TTGGTGGGCTGGAGAAGAGGAGG + Intronic
1042503155 8:69531449-69531471 GAGTTGAGGTGGAGGAGAGGTGG - Intronic
1042533445 8:69836319-69836341 GTGCTCTAATGGAGGAAAGGAGG + Intergenic
1042652709 8:71060640-71060662 GTGGAGACATTGAGGAGAGGAGG + Intergenic
1042825920 8:72979145-72979167 GTGGTTTGACTGAGGGGAGGAGG - Intergenic
1042848707 8:73194043-73194065 GTGGTGGGCAGGGGGAGAGGTGG - Intergenic
1042848709 8:73194051-73194073 GTGGTGTGGTGGTGGGCAGGGGG - Intergenic
1043088209 8:75864385-75864407 GGGGTGTGGTGGGGTAGAGGGGG + Intergenic
1043716494 8:83493815-83493837 GTGGGGTGATGGGAGAGGGGAGG - Intergenic
1044502298 8:92972525-92972547 GTGGTGTGAAGGAGGAGCACAGG - Intronic
1044923029 8:97185815-97185837 GTGCTGTGAGGGAGGACAGTGGG + Intergenic
1045686420 8:104717277-104717299 GTGGTAGGGTGGAGGAAAGGAGG - Intronic
1046302851 8:112320635-112320657 GTCGTGGGGTGGAGGGGAGGGGG - Intronic
1046514809 8:115244732-115244754 GTGTTGAGATGGTGGGGAGGTGG - Intergenic
1046979285 8:120319071-120319093 GTGGTGTGCAGTAGGAGTGGTGG + Intronic
1047031885 8:120890945-120890967 GTGATGTGATGGATGAGAAAAGG - Intergenic
1047287947 8:123504492-123504514 GGGCTGTGATGGGGAAGAGGCGG + Intronic
1047527875 8:125649158-125649180 GTGGTGTGATGAGGAGGAGGTGG + Intergenic
1047733803 8:127748345-127748367 GTGCTGTGATAGAGGAAGGGGGG - Intergenic
1047938105 8:129801230-129801252 CTGGGGTGATGGAGAAGGGGTGG + Intergenic
1048260098 8:132937985-132938007 GTGGAGTGGAGGAGGAGGGGAGG + Intronic
1048413291 8:134198154-134198176 GTGGTCAGATGGGTGAGAGGAGG + Intergenic
1048958442 8:139555991-139556013 GTGGTGGGATAGAGGTGGGGTGG - Intergenic
1049362395 8:142218513-142218535 GTGGTGAGTGGGATGAGAGGGGG - Intronic
1049370361 8:142261365-142261387 GAGGAGGGATGGAGGAGAGAGGG + Intronic
1049411467 8:142475682-142475704 GGCCTGTGAGGGAGGAGAGGGGG + Intronic
1049849224 8:144821814-144821836 CTGGTGTGATGGACAAGAGGAGG - Intergenic
1050099771 9:2106593-2106615 GTGGTGGGATGGGGGACAGAAGG - Intronic
1050221510 9:3396185-3396207 GTTGTGGGGTGGAGGGGAGGGGG - Intronic
1051028890 9:12649680-12649702 TTTGTGTGCTGGAGTAGAGGTGG - Intergenic
1051695271 9:19761628-19761650 GTTGTGGGATGGGGGAAAGGGGG - Intronic
1053332428 9:37226648-37226670 GTTGTGTGATGGAAGAGATATGG - Intronic
1054812030 9:69442466-69442488 GGGGTGGGTGGGAGGAGAGGTGG + Intronic
1054970606 9:71081087-71081109 GAGGTGGGAGCGAGGAGAGGGGG - Intronic
1055363122 9:75516545-75516567 GTGGTGGCAGGGAGGAGATGGGG - Intergenic
1056605644 9:88082613-88082635 TTGATGGGAAGGAGGAGAGGGGG + Intergenic
1057548456 9:96035047-96035069 GGGGTGTGGTAGAGGAGATGGGG - Intergenic
1057852469 9:98576059-98576081 CAGGTGTGATGAAAGAGAGGTGG - Intronic
1058210843 9:102167818-102167840 CTGGGTTGAGGGAGGAGAGGAGG + Intergenic
1060113835 9:120925913-120925935 GTGAGGTGATGGAGGAGCGGAGG - Intronic
1060550960 9:124485285-124485307 GTGATGGGGTGGAGGAGAAGTGG - Intronic
1060893282 9:127201981-127202003 GAGGTGTGAGAGAGGAGAGGGGG + Intronic
1060952502 9:127612809-127612831 GTGGGGTGAGGGAGGGGTGGAGG - Intronic
1060952514 9:127612842-127612864 AGGGTGGGATGGGGGAGAGGCGG - Intronic
1061195178 9:129103474-129103496 GTGGTGTGATGGGAGAGCAGTGG + Intronic
1062525757 9:136977499-136977521 GAGGTGTGCAGGAGGAGCGGAGG - Exonic
1185931883 X:4212743-4212765 GTGGTGGGAAGGAGGAGATAGGG - Intergenic
1187284620 X:17892943-17892965 GTGGAGAGGTGGAAGAGAGGTGG + Intergenic
1187783010 X:22850414-22850436 GTGGTCTGGTGGAGGAGATTTGG + Intergenic
1188533462 X:31168055-31168077 GCAGTGTGATGGAGGATAGGTGG + Intronic
1188977274 X:36690722-36690744 TTGGTGTGATTGAGGAGAGCAGG - Intergenic
1189334921 X:40165199-40165221 GTGGGGTGGGGGATGAGAGGTGG + Intronic
1189444535 X:41068233-41068255 GTGGACAGAGGGAGGAGAGGAGG - Intergenic
1190324024 X:49195615-49195637 GTGGTGTGATGGAGGAGAGGTGG + Intronic
1190438260 X:50449259-50449281 GAGGAGTGAGGGAGGAGATGAGG - Intronic
1190618422 X:52262159-52262181 GTGCTGTGAGGGCTGAGAGGAGG - Intergenic
1190904306 X:54710845-54710867 GTGGTGGGATTGGGCAGAGGAGG - Intergenic
1192410949 X:70931474-70931496 GGGGTGTGATGGGGGGGAGTTGG + Intergenic
1192502990 X:71665466-71665488 GGTGTGTGCTGGAAGAGAGGAGG + Intergenic
1192503821 X:71669117-71669139 GGCGTGTGCTGGAAGAGAGGTGG - Intergenic
1192510196 X:71716853-71716875 GGTGTGTGCTGGAAGAGAGGAGG + Intronic
1192516501 X:71764700-71764722 GGTGTGTGCTGGAAGAGAGGAGG - Intronic
1192522581 X:71815169-71815191 GGTGGGTGCTGGAGGAGAGGTGG - Intergenic
1192529320 X:71871975-71871997 GGCGTGTGCTGGAAGAGAGGAGG + Intergenic
1193033357 X:76923542-76923564 GAGATGTGAAGAAGGAGAGGAGG - Intergenic
1193079477 X:77391294-77391316 GTGATCTTTTGGAGGAGAGGAGG - Intergenic
1193446310 X:81608418-81608440 GTAGGGTGCTGGGGGAGAGGTGG - Intergenic
1193655112 X:84188404-84188426 GTGGTGGGATAGAGGGGAGGGGG + Intergenic
1193843632 X:86440976-86440998 ATGGTGCGAGGGAGGAGAGAGGG - Intronic
1194223998 X:91231968-91231990 GTGGTGTGGTAGCGGTGAGGTGG + Intergenic
1194361933 X:92963205-92963227 GTGGAGGGTGGGAGGAGAGGAGG - Intergenic
1194877672 X:99209064-99209086 GTTGGGGGATGGAGGAGGGGTGG + Intergenic
1195491218 X:105472061-105472083 GGGGTGGGATGGAGGGGTGGTGG + Intronic
1196049243 X:111287945-111287967 GGAGTGTTATGGTGGAGAGGTGG - Intergenic
1196825142 X:119734926-119734948 GTGGGGTGGTGGTGGGGAGGTGG + Intergenic
1197712332 X:129680242-129680264 GTGGTGGCAGGGAGGAGCGGAGG + Intergenic
1197747150 X:129939335-129939357 GTGGGGTGGGGGAGAAGAGGAGG - Intergenic
1197753004 X:129978647-129978669 GTGGTGTGCAGGAGTAGGGGTGG + Intergenic
1198026938 X:132716136-132716158 GGGGTGTGAGAGAGGAGATGAGG - Intronic
1198463574 X:136885049-136885071 CTGATGTAATGCAGGAGAGGGGG + Intergenic
1198724850 X:139666239-139666261 ATGGGGTGTTGGGGGAGAGGTGG - Intronic
1199650883 X:149945281-149945303 GTGGAGAGGAGGAGGAGAGGAGG + Intergenic
1200147054 X:153931827-153931849 GTGTTGTGATGGAGGAGCTCTGG - Intronic
1200560463 Y:4695349-4695371 GTGGTGTGGTAGCGGTGAGGTGG + Intergenic
1200670180 Y:6079421-6079443 GTGGAGGGTGGGAGGAGAGGAGG - Intergenic
1200955364 Y:8938657-8938679 CAGGTGTCATGGAGGAGGGGTGG - Intergenic
1201167955 Y:11228288-11228310 GTGGTCTTCTGGAGGAGAAGAGG + Intergenic
1201712463 Y:17007746-17007768 GTGGTGGGATGGAGGTGGGGGGG - Intergenic