ID: 1190325584

View in Genome Browser
Species Human (GRCh38)
Location X:49205081-49205103
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1914
Summary {0: 2, 1: 1, 2: 18, 3: 233, 4: 1660}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190325564_1190325584 26 Left 1190325564 X:49205032-49205054 CCCCCAGTGCAAAGACAACAAAA 0: 1
1: 1
2: 1
3: 37
4: 598
Right 1190325584 X:49205081-49205103 CCTGCTGGGGAGGGGAGGGCAGG 0: 2
1: 1
2: 18
3: 233
4: 1660
1190325566_1190325584 24 Left 1190325566 X:49205034-49205056 CCCAGTGCAAAGACAACAAAATC 0: 1
1: 0
2: 1
3: 43
4: 1088
Right 1190325584 X:49205081-49205103 CCTGCTGGGGAGGGGAGGGCAGG 0: 2
1: 1
2: 18
3: 233
4: 1660
1190325565_1190325584 25 Left 1190325565 X:49205033-49205055 CCCCAGTGCAAAGACAACAAAAT 0: 1
1: 1
2: 1
3: 37
4: 400
Right 1190325584 X:49205081-49205103 CCTGCTGGGGAGGGGAGGGCAGG 0: 2
1: 1
2: 18
3: 233
4: 1660
1190325567_1190325584 23 Left 1190325567 X:49205035-49205057 CCAGTGCAAAGACAACAAAATCC 0: 1
1: 0
2: 2
3: 16
4: 242
Right 1190325584 X:49205081-49205103 CCTGCTGGGGAGGGGAGGGCAGG 0: 2
1: 1
2: 18
3: 233
4: 1660
1190325571_1190325584 2 Left 1190325571 X:49205056-49205078 CCAGGGATGTGGTCCATGCCTGC 0: 1
1: 0
2: 2
3: 51
4: 460
Right 1190325584 X:49205081-49205103 CCTGCTGGGGAGGGGAGGGCAGG 0: 2
1: 1
2: 18
3: 233
4: 1660

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900008527 1:83310-83332 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
900036758 1:417393-417415 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
900058387 1:653140-653162 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
900142495 1:1144577-1144599 CCTGGCAGGGAGGGGAGCGCTGG - Intergenic
900155862 1:1203062-1203084 GCTGCCGGGGAGTGGCGGGCAGG - Intergenic
900181391 1:1312565-1312587 CGGGCTGGGCAGGGCAGGGCAGG - Intronic
900182853 1:1320018-1320040 GCTGCTGGGGAGGACAGGGCAGG + Intronic
900188982 1:1345417-1345439 CTGGCTGGGGTGGGGACGGCAGG - Intronic
900192836 1:1358688-1358710 CCTGCTGGGGAGGGGCAGTGTGG + Intronic
900207005 1:1435905-1435927 CCTGCTCCGGACGGGCGGGCGGG + Intronic
900227461 1:1539960-1539982 CAGGCTGGGGAGGGGAGCGCAGG + Intronic
900227533 1:1540137-1540159 CAGGCCGGGGAGGGGAGCGCAGG + Intronic
900227541 1:1540156-1540178 CAGGCCGGGGAGGGGAGCGCAGG + Intronic
900227549 1:1540175-1540197 CAGGCCGGGGAGGGGAGCGCAGG + Intronic
900237828 1:1600887-1600909 CCGACGGGGGAGGGGAAGGCGGG + Intergenic
900290994 1:1923551-1923573 CCTGCTGGTGAGAGCTGGGCTGG + Intronic
900379606 1:2377371-2377393 CCGGCTGGGCAGGGAAGGGAGGG - Intronic
900409129 1:2504929-2504951 CCGGCTGGGGAGGGGGTGGCAGG + Exonic
900471264 1:2856165-2856187 CCTGCAGGTCAGGGGAGAGCTGG + Intergenic
900482253 1:2905013-2905035 CCGGCCGGGCAGGGCAGGGCGGG - Intergenic
900483981 1:2912800-2912822 CAGGCTGGGGAGGGGAGGGAAGG + Intergenic
900507535 1:3037201-3037223 TGTGCTGGGGAGGGGTGGGTGGG - Intergenic
900513389 1:3070512-3070534 CCTGCAGAGGAGGGGGCGGCGGG - Intronic
900526832 1:3133477-3133499 CACGATGGGGAGAGGAGGGCAGG + Intronic
900527045 1:3134473-3134495 GCTGTGCGGGAGGGGAGGGCAGG - Intronic
900569745 1:3352394-3352416 CCGGCTTCGGAGGGGAGGGAGGG - Intronic
900626318 1:3610316-3610338 CCTGCTGGGGAGTGCTGGACGGG + Intronic
900707946 1:4092141-4092163 CCTGGTGGGGTGTGCAGGGCTGG - Intergenic
900898609 1:5501844-5501866 CCTGCTCAGGAAGGCAGGGCTGG - Intergenic
900990321 1:6095637-6095659 CCTGGTGGGGAGGGACGGGCAGG + Intronic
900995415 1:6120949-6120971 CCCCCTGGTGAGGGGAGGCCAGG - Intronic
901019944 1:6250424-6250446 CCTGCAGGTGAGCGCAGGGCTGG - Exonic
901217260 1:7561746-7561768 CCTGTTGGGCTGGGGAGGGGTGG - Intronic
901230252 1:7637788-7637810 CGGGCTGGGCAGGGTAGGGCAGG - Intronic
901434265 1:9236546-9236568 GCTGCTGGGGAGGCTAAGGCAGG + Intronic
901506728 1:9689815-9689837 CCGCCTGGGGCGGGGTGGGCAGG + Intronic
901632550 1:10655023-10655045 CCAGCTGGGGTGGGGTGGGAGGG - Intronic
901636618 1:10673508-10673530 CCTGCTGGGGAGGGGGGCTGAGG + Intronic
901639671 1:10686902-10686924 CCTGCCGGGCAGTGGAGAGCCGG + Intronic
901693943 1:10992492-10992514 CTTCGTGGGGAGGGGAGGGGAGG + Intergenic
901931122 1:12596506-12596528 CCTGCTTCGGAAGGGAGGGGCGG - Intronic
902066544 1:13692856-13692878 ACTGCTGGGGAGGGGTGAGGTGG + Intergenic
902169314 1:14598155-14598177 CCTCCTGGGGTGGGCAGCGCAGG + Intergenic
902232131 1:15034898-15034920 TCGGGAGGGGAGGGGAGGGCAGG - Intronic
902232418 1:15036359-15036381 CAGGCAGGGCAGGGGAGGGCTGG - Intronic
902394546 1:16125403-16125425 GCGGCTGGGGAGGGGAGTGGAGG + Intronic
902508141 1:16951129-16951151 GCAGCTGGGGAGGGGTGGGCAGG + Intronic
902531899 1:17096003-17096025 CCTGCCAGGCAGGGCAGGGCAGG + Intronic
902616858 1:17628531-17628553 ACTGGAGGGTAGGGGAGGGCTGG + Intronic
902722954 1:18316251-18316273 CATGCTGGGGAGGAGGGGACAGG - Intronic
903166012 1:21520966-21520988 GCTGCAGGGGAGGGGATGGCAGG - Intronic
903233866 1:21937341-21937363 GCTGCGGGGGCGGGGCGGGCGGG - Intergenic
903264689 1:22150796-22150818 TCTGCTGGGCAGGGAGGGGCTGG - Intergenic
903384324 1:22916688-22916710 ACTGCTGGGCAGGCGGGGGCTGG - Intergenic
903470541 1:23583979-23584001 CCTACTTGGGAGGCTAGGGCAGG + Intronic
903552506 1:24167804-24167826 GCTGCTGGGGAGGCTAAGGCAGG - Intronic
903674457 1:25055375-25055397 ACTTCTGGGGAGGGCAGGACAGG - Intergenic
903674618 1:25056044-25056066 TGTGCTGGGGAAGGGAGGGTAGG + Intergenic
903749906 1:25615376-25615398 CCTGCTGGGGATGGGCGGCTGGG - Intergenic
903778206 1:25806465-25806487 GATGCTGGGGAAGGAAGGGCAGG + Intronic
903846061 1:26280501-26280523 CAGGGTGGGGAGGGGAGGGGAGG - Intronic
904296512 1:29522860-29522882 CCTACTGGGGAGGCTTGGGCAGG - Intergenic
904358712 1:29958803-29958825 CCTGAAAGCGAGGGGAGGGCTGG + Intergenic
904361358 1:29974672-29974694 CTTGCTGGGCAAGGGAGGCCAGG - Intergenic
904363530 1:29994994-29995016 CCTGTCGGGGAGTGGGGGGCTGG - Intergenic
904374697 1:30073111-30073133 GCTGCTTTGGAGGGGAGGTCAGG + Intergenic
904470591 1:30733714-30733736 CCTGCCAGGGAGGGGCGGGAGGG + Exonic
904533061 1:31181823-31181845 CCTGCTGGCTTGGGGAGGCCTGG - Intronic
904575708 1:31503917-31503939 CCTGCAGGGCAGGGAAGGGCAGG - Intergenic
904629415 1:31829904-31829926 GCTGCTGGGGAAGGGTGGGGAGG + Intergenic
904816610 1:33207098-33207120 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
904826570 1:33277067-33277089 CCGTCTGGGGTGGGGAGGCCCGG + Intronic
905166227 1:36084676-36084698 CCGCCTGGGGACGGGAGGGAGGG + Intronic
905168721 1:36098188-36098210 CCCCCTGGAGAGGGGAGAGCAGG - Exonic
905220239 1:36441127-36441149 CCTGCTGGGAAGAGGACGGCGGG + Intronic
905335216 1:37240257-37240279 CCCTCTGGGGAGGGGAGAGAGGG + Intergenic
905435029 1:37950123-37950145 CTTGTTGGGGAGGGGAGTGCTGG + Intergenic
905670770 1:39788863-39788885 ACCGCTGGGCAGGGCAGGGCAGG - Intergenic
905765939 1:40601185-40601207 ACTACTGGGGAGGTGGGGGCAGG - Intergenic
905790120 1:40785053-40785075 CCGGCAGGGTAGGGCAGGGCAGG - Intronic
905836807 1:41131701-41131723 CCTGCTGGGGGGTGGGAGGCTGG - Intronic
905849958 1:41266452-41266474 CCTGCTGGGCTGGGCTGGGCTGG + Intergenic
905865690 1:41375306-41375328 GCTACTCGGGAGGGTAGGGCGGG + Intronic
905871676 1:41407919-41407941 CCTGTGGGGGAGGGGAGCCCAGG + Intergenic
905875879 1:41431877-41431899 CCTGCCGGGGTCTGGAGGGCAGG + Intergenic
905884766 1:41485654-41485676 CTTGCCGGGGAGGGGAAAGCAGG + Intergenic
905896461 1:41549022-41549044 CCTGTTGGGGGGTGGGGGGCAGG - Intronic
906032349 1:42731820-42731842 CCTTCTGGGGTGGGGGGGGCGGG + Intergenic
906079116 1:43071924-43071946 CCTTCTGGGGATGGGATGACAGG + Intergenic
906130523 1:43452872-43452894 CCTGTTGGGATGGGGAGGCCTGG - Intronic
906152770 1:43597749-43597771 CCTTCTGGGGAGGGGCGGAGGGG - Exonic
906168952 1:43707755-43707777 CCGGCGGGGGAGGGGCGGGGCGG - Intronic
906213435 1:44024893-44024915 ACTGCTGTGGAGGGGACAGCTGG - Intronic
906315539 1:44784480-44784502 CATGCTGCGGGCGGGAGGGCGGG + Exonic
906545738 1:46618024-46618046 CCTGCTTGGGAGTGGAGGGCGGG + Intergenic
906636823 1:47415856-47415878 CCAGCTGGGGATGGAAGGCCAGG + Intergenic
906662198 1:47590816-47590838 CCTGCTGGGCAGGGCAGGGTGGG + Intergenic
907222870 1:52920378-52920400 ACTGCTGGGGAAGGGGCGGCAGG + Intronic
907248597 1:53123284-53123306 CCTGCTGGTGCAGGGAGGGGAGG - Intronic
907351793 1:53838112-53838134 CGCGCTGGGCGGGGGAGGGCCGG - Intronic
907443140 1:54490576-54490598 CCAGGAGGGGAGGGGAGGGGAGG - Intergenic
907447422 1:54517744-54517766 CATGCAGGGATGGGGAGGGCAGG - Intergenic
907562951 1:55407839-55407861 CCTGGAGTGGAGGGGAGGCCTGG + Intergenic
907734964 1:57103598-57103620 CATGCTGGGGAGGAGAGAGTAGG + Intronic
907852292 1:58267106-58267128 GCTACTGGGGAGGGTAGGACAGG + Intronic
907914089 1:58852929-58852951 CTTGTAGAGGAGGGGAGGGCTGG + Intergenic
908128054 1:61050229-61050251 GCCCCTGGAGAGGGGAGGGCAGG - Intronic
908477599 1:64505377-64505399 TCTGGAGGGGAGGGGAGGGGAGG + Intronic
908920611 1:69186668-69186690 CCTCCTGGAGAGGGAGGGGCTGG + Intergenic
909878628 1:80844693-80844715 CCTGCTGGGGGAGGGTGGGGAGG - Intergenic
910200068 1:84690310-84690332 CCCGCCAGGGAGGGGCGGGCGGG - Intronic
910452555 1:87361749-87361771 CCTGTTGGGGTGGGTGGGGCTGG + Intergenic
910547202 1:88432236-88432258 ACTGCTGGGGGTGGGAGGGGTGG - Intergenic
910881475 1:91925680-91925702 CTTGGAGGGGAGGGGAGGGGAGG + Intergenic
910981768 1:92965286-92965308 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
911263720 1:95718347-95718369 CCAGCTGGGAAGGGGAGTCCAGG + Intergenic
912459571 1:109821876-109821898 TCTGCTAGGGAGGGGAGGCCTGG - Intergenic
912555947 1:110516098-110516120 GCTGCTGGGAAGGGAAGAGCAGG - Intergenic
912574881 1:110659919-110659941 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
913020399 1:114783847-114783869 CCTGTTGGGGGGTGGGGGGCAGG - Intergenic
913027860 1:114863965-114863987 CCTGTTGGGGGGTGGGGGGCAGG + Intronic
913074220 1:115327811-115327833 CCTGCTTGGGAGGTGGGGGCAGG + Intronic
913075575 1:115338332-115338354 GGTGGTGGGGAGGGGAGGGATGG - Intergenic
914412155 1:147440184-147440206 CCTACTGGAGAGTGGAGGGTGGG + Intergenic
915323637 1:155069727-155069749 CCGGCTGGGGAGGTGAGAGAGGG - Intergenic
915333280 1:155126636-155126658 GCTCCTGGGGTGGAGAGGGCGGG - Intergenic
915520517 1:156439752-156439774 GCTCCTGGGGAGGGAGGGGCAGG - Intergenic
915529356 1:156494475-156494497 CTGGATGGGGAGGGGAGGGCTGG + Intronic
915709144 1:157877375-157877397 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
915839628 1:159203833-159203855 ACAGCTGAGGAGGGGAGGGAGGG + Intronic
915893379 1:159792003-159792025 TGTGCTGAGGAGGGGAGGCCTGG + Intergenic
915971455 1:160358127-160358149 ACTGCAGGGGGAGGGAGGGCAGG - Exonic
916048200 1:161016543-161016565 GCTGCTGGGGAGGCTAAGGCAGG + Intronic
916226394 1:162493948-162493970 CCTGTTGGGGATGGGATGGGAGG + Intergenic
916296328 1:163224207-163224229 GAGGCTGGGGAGGGGAGGGGAGG - Intronic
916412540 1:164559853-164559875 CATGCTGGGGTCGGGATGGCCGG + Exonic
916508955 1:165454433-165454455 CCTCCTGTGGAGGGGAGAGGGGG - Intergenic
916548653 1:165828973-165828995 CCGGCTGGGGAGAGCAGAGCAGG + Intronic
916872139 1:168927233-168927255 TCTGTTGGGGTGGGGAGGGGTGG - Intergenic
917050215 1:170914467-170914489 GCTGCTGGGGAGGGTGAGGCAGG - Intergenic
917132895 1:171760759-171760781 GCTGCTGGGGAGGCTAAGGCAGG - Intergenic
917289527 1:173457959-173457981 CCTGCCGGGGGGTGGGGGGCTGG + Intergenic
917356450 1:174131298-174131320 CCTGCTGGGGCCAGGAAGGCTGG - Intergenic
917497088 1:175550330-175550352 CCTCCTGTGGAGGTGAGGGTTGG - Intronic
917610638 1:176685669-176685691 CCTGGTGGGGAGGAGGGGGCCGG - Intronic
917876915 1:179294088-179294110 GGAGTTGGGGAGGGGAGGGCGGG + Intronic
917880086 1:179326667-179326689 GCTGCTGGGGAGGGTTAGGCAGG - Intronic
918338316 1:183544471-183544493 CCTGCTGGGAAGAGGAGGGAAGG - Exonic
919408881 1:197218962-197218984 CTTGATGGGGAGAGGAGGACAGG + Intergenic
919721378 1:200840379-200840401 GCTGCTTGGGAGGCTAGGGCAGG - Intronic
919799824 1:201346947-201346969 CTTTCTGGGGGGGGCAGGGCTGG - Intergenic
920031855 1:203042283-203042305 CCTGATGGGGGAGGGTGGGCTGG + Intronic
920212035 1:204335386-204335408 TCTGCTGGGGAAGGAAGGGAGGG - Intronic
920331378 1:205211071-205211093 CCTTCTGAGGAGGGGAGGAAGGG - Intronic
920382938 1:205546245-205546267 TCTGCTGGGGAGCCAAGGGCTGG + Intergenic
920384618 1:205561689-205561711 CCTACAGGGGAGGGGAGGGGAGG + Intergenic
920394174 1:205631841-205631863 CGTGCGGGGGCGGGGAGGGCGGG - Exonic
920499785 1:206478909-206478931 CGTGGTGGGGAGCAGAGGGCAGG - Intronic
920742898 1:208598234-208598256 CTTGCTGAGGTGGGGAGGGATGG - Intergenic
920951928 1:210580488-210580510 CCTGCTGGGGGGTGGGGGGTGGG - Intronic
921115597 1:212087935-212087957 CCGGCTGGGAAAGGTAGGGCAGG - Intronic
921175272 1:212587938-212587960 CCTGCTGGGGCGGCGGGGGTGGG + Intronic
921260297 1:213380318-213380340 CCTACTGGAGAATGGAGGGCGGG + Intergenic
921290150 1:213649586-213649608 CCTGGTGGGCGGGGGAGGGAGGG - Intergenic
922204838 1:223437183-223437205 CCTCCTGGGAAGGGGTGGGTTGG - Intergenic
922589826 1:226766434-226766456 CCAGGTGGGGAGGGCAGGGAAGG - Intergenic
922601150 1:226854898-226854920 CCTGTTGGGGTTTGGAGGGCTGG + Intergenic
922764360 1:228149677-228149699 GCGGCTGGGCAGGGGAGGGGAGG + Intergenic
922806187 1:228391294-228391316 CGGGCTGGGGAGGGCAGGGTAGG + Intergenic
922812132 1:228422730-228422752 CCTGCTCGGGAGGCTAAGGCAGG + Intergenic
922860562 1:228812217-228812239 CCTGCTGGGGACGGATGGGATGG + Intergenic
922919803 1:229293022-229293044 CCTGATGGGGATGTGAGGGATGG - Intronic
923038270 1:230300747-230300769 GGTGGTGTGGAGGGGAGGGCCGG + Intergenic
923551040 1:234963592-234963614 CCTCCAGGGGAGGGGAAGGCTGG - Intergenic
923558951 1:235023768-235023790 CCTTCGGGGGAGGGGTGGGAGGG + Intergenic
923715161 1:236418970-236418992 CATGACTGGGAGGGGAGGGCAGG - Intronic
923870563 1:237988963-237988985 CGGGGAGGGGAGGGGAGGGCAGG - Intergenic
923951033 1:238954096-238954118 CCAGCTGGGGAGGCTAAGGCAGG + Intergenic
924172759 1:241358188-241358210 CCAGCTGTGGAGGAGAGGGAGGG + Intergenic
924864912 1:247968492-247968514 CCTGTTGGGGGGTGGGGGGCTGG - Intronic
924874674 1:248089412-248089434 ACTTCTGGGGAGGTGGGGGCTGG - Intronic
1063374686 10:5547078-5547100 CCTTCTGGGCAGGTGCGGGCTGG + Intergenic
1063436079 10:6032579-6032601 CCTGCTGGGGAGGCTGAGGCAGG + Intronic
1063455383 10:6178926-6178948 CGTGCTGGGGAGGTGGTGGCTGG - Intronic
1063464929 10:6236912-6236934 GCTGTCGGGGAGAGGAGGGCTGG + Intergenic
1063606982 10:7531301-7531323 CCTGCGAGAGTGGGGAGGGCAGG + Intergenic
1063656691 10:7997446-7997468 GCAGCTGGGGAGGTGAGGACGGG + Intronic
1063811615 10:9715717-9715739 CCTACTGGAGAGTGGAGGGTGGG + Intergenic
1064019253 10:11796110-11796132 CCTACTGGGGAGGCCAAGGCAGG + Intergenic
1064400789 10:15019420-15019442 CCAGCTGGGGAGGCTGGGGCAGG - Intergenic
1064873104 10:19962500-19962522 CCTGCTGGGGAGGCTGAGGCGGG - Intronic
1065024274 10:21526210-21526232 CCTGCGAGGGAGGGGAGGGACGG + Intergenic
1065079256 10:22111415-22111437 CGAGCTGGGGAGGGGAGCACAGG + Intergenic
1065164392 10:22960091-22960113 ACTGCAGGGGAGGGGAAGGTTGG - Intronic
1065313247 10:24436644-24436666 GCTGCTGGGGAGGCTAAGGCAGG + Intronic
1065636738 10:27742565-27742587 ACTGCCGGTGAGTGGAGGGCAGG - Intronic
1065649120 10:27868674-27868696 CCTGCTGGGGCACGGAGGGAGGG + Intronic
1065725730 10:28666222-28666244 CCTGCTAGGTTAGGGAGGGCTGG + Intergenic
1065789969 10:29251560-29251582 CCTGCTGGGGAGGGAAAAGCTGG + Intergenic
1066434491 10:35384614-35384636 CCTGCAGTGGAGGGGCGGGGTGG + Intronic
1066525702 10:36276742-36276764 CCTGTTGGGGGGTGGAGGGTAGG + Intergenic
1066661573 10:37741826-37741848 CCAGTGGGGGCGGGGAGGGCAGG + Intergenic
1066965005 10:42255265-42255287 CTTGTTGGGGGGTGGAGGGCTGG - Intergenic
1067066470 10:43106737-43106759 CCTGCTGGTGGCTGGAGGGCAGG - Intronic
1067077706 10:43197567-43197589 CCTGGTGAGGATGGGAGGGTGGG - Intronic
1067082101 10:43217714-43217736 CCTGCTGTTGAGGGCAGGCCTGG - Intronic
1067087899 10:43252489-43252511 CCTGCCTGGGAAGGAAGGGCAGG + Intronic
1067106711 10:43371512-43371534 GCTGTTGGGGAGGGGCGGGCTGG - Intergenic
1067208469 10:44239348-44239370 TCCCCTGGGGTGGGGAGGGCAGG - Intergenic
1067346298 10:45441325-45441347 GCAGCTGGGGAGGGGAGAGGAGG - Exonic
1067570340 10:47366914-47366936 CCTCCTGTGGAGGGGATGGATGG + Exonic
1067683537 10:48454551-48454573 ACGGGTGGGGACGGGAGGGCTGG + Intronic
1067832864 10:49620473-49620495 CCTGCCGGGGAGGGCAGGGAAGG - Exonic
1068071992 10:52207147-52207169 CCAGCAGGGGAGGGGAGGCGAGG + Intronic
1068207252 10:53871863-53871885 GCTGCTGGGGAGGCTAAGGCAGG - Intronic
1068546508 10:58352500-58352522 CCACTTGGGGAGGGTAGGGCGGG + Intronic
1069678512 10:70266770-70266792 CCTGAAGGAGATGGGAGGGCAGG + Intronic
1069680805 10:70283934-70283956 CCTGGTCGGGAGGCGAGGGGCGG - Intergenic
1069790185 10:71014490-71014512 CCTGGTGGAGAAGGAAGGGCTGG - Intergenic
1069808516 10:71141393-71141415 ACTGCTGGAGTGAGGAGGGCAGG + Intergenic
1069844045 10:71358447-71358469 CCTGAAGGGGCGGGGAGGACTGG - Intronic
1069898265 10:71692282-71692304 CCGACTGGGGAGGCAAGGGCGGG - Intronic
1069992172 10:72322624-72322646 TGTGATGGGGAGGGGAGGGTTGG - Intergenic
1070007722 10:72441398-72441420 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
1070305023 10:75234744-75234766 CTTGCGGGGGGAGGGAGGGCAGG + Intronic
1070453095 10:76581485-76581507 CCAGCTGGGGAGGGTCGGGGAGG + Intergenic
1070570895 10:77638553-77638575 CGGGCTGGGCAGGGGTGGGCAGG + Intronic
1071035268 10:81237479-81237501 CTTGCAGGGCAGGGCAGGGCAGG + Intergenic
1071336883 10:84607595-84607617 CCAGCTGGGGAAGGAAGGGTCGG + Intergenic
1071504977 10:86226782-86226804 GCTGCGGGTGAGGGGAGGCCTGG - Intronic
1072183475 10:93011366-93011388 CCTACTGGGGAGGCTAGGGCAGG - Intronic
1072196248 10:93119281-93119303 CCTGCTGGGGTGGAGAAGGGCGG + Intergenic
1072206076 10:93206462-93206484 CCTGCTAGGGAGGGCTGGGTTGG - Intergenic
1072209224 10:93231388-93231410 CAGGCTGGGGAGGAGAAGGCAGG + Intergenic
1072409034 10:95183745-95183767 CCTGCTGGGGCGGCGGGGCCCGG - Intergenic
1072714706 10:97743029-97743051 CCAGCTGGGGAGGGGAGACCAGG - Intronic
1072737554 10:97889273-97889295 CCAGCTGGGAAGTGGAGGGTGGG + Intronic
1072764110 10:98082159-98082181 CCTGCTAGAGAGGAGAGGGCAGG - Intergenic
1073084987 10:100882603-100882625 TCTGCTGGGGAGAGCAGGGAGGG + Intergenic
1073103749 10:101020675-101020697 TCTCCTGGGGAGGGGATGGTGGG + Exonic
1073206286 10:101770990-101771012 CCTATGGGGGAGGGGAGGCCTGG + Intronic
1073376356 10:103038722-103038744 CCTGCTAGGGAGGTCTGGGCCGG + Intronic
1073454778 10:103629869-103629891 CCCCCTGGGGAGAGGAGGGGAGG + Intronic
1073543274 10:104328978-104329000 CCAGCTGGGCTGGGGAGAGCGGG + Intronic
1073583482 10:104687720-104687742 GGTGGTGGGGAGCGGAGGGCTGG + Intronic
1074148834 10:110740469-110740491 CCTGCTGCAGAGGGAGGGGCAGG + Intronic
1074377535 10:112951726-112951748 CGAGCGGGGGAGGGGAGGGAGGG - Intronic
1074508404 10:114091729-114091751 CAAGGTGGGGTGGGGAGGGCAGG - Intergenic
1074703999 10:116115491-116115513 CCTGGAGGGCAGGGCAGGGCTGG - Intronic
1074711741 10:116183622-116183644 CTTTCTGGAGAGGAGAGGGCTGG - Intronic
1074769037 10:116721658-116721680 AGTGCCGGGGAGGGGAGGGATGG - Intronic
1074907694 10:117879475-117879497 CCAGCTGGGGAGGGGAGAAAGGG - Intergenic
1075519442 10:123135275-123135297 CCTGCGGGAGGGGGGAGGGGCGG - Intergenic
1075558318 10:123449307-123449329 CCAGGTGAGGAGGGCAGGGCAGG - Intergenic
1075659784 10:124185244-124185266 CCTGCTGGGATGGGGAGGGGAGG - Intergenic
1075683921 10:124350889-124350911 CCTGCCGGGGAGGGTAGGGATGG - Intergenic
1075785725 10:125048758-125048780 GGTGCTGGGGAGGGGCCGGCTGG + Intronic
1076169856 10:128309944-128309966 CCACCTGGGGACAGGAGGGCAGG + Intergenic
1076187187 10:128459100-128459122 CGTGCAGGGGTAGGGAGGGCTGG + Intergenic
1076188156 10:128464624-128464646 CCTAATGAGGAGGGGAAGGCAGG - Intergenic
1076323688 10:129603936-129603958 CCTCCTGAGCAGTGGAGGGCTGG + Intronic
1076358259 10:129868598-129868620 CCTGCTGGGGCGGGAGGGGTTGG + Intronic
1076526326 10:131114692-131114714 CCTGCCCGGGAAGGGAAGGCCGG + Intronic
1076600115 10:131651896-131651918 CCTGCTGGCAAGGGGAGGGCAGG + Intergenic
1076670822 10:132120308-132120330 CCTGCGGGGGAGGGATTGGCTGG + Intronic
1076805882 10:132858515-132858537 GCTGCTGTGGTGGGGACGGCTGG + Intronic
1077015386 11:396959-396981 CCTGGTGGGCATGGGAGGGGTGG - Exonic
1077062537 11:624178-624200 CCGGGTGGGGCGGGGAGAGCGGG + Intronic
1077073755 11:690322-690344 AGGGCAGGGGAGGGGAGGGCAGG + Intronic
1077073763 11:690337-690359 AGGGCAGGGGAGGGGAGGGCAGG + Intronic
1077073771 11:690352-690374 AGGGCAGGGGAGGGGAGGGCAGG + Intronic
1077143791 11:1036025-1036047 CGAGCTGGGTAGGGGAGCGCGGG + Intronic
1077172639 11:1174771-1174793 CCGGCCGAGGAGGGGAGGGGAGG + Intronic
1077264598 11:1642481-1642503 CCAGCTGCGGAGCGGAGGCCAGG - Intergenic
1077268183 11:1662379-1662401 ACTGCTGAGGAGGGGAAGGATGG - Intergenic
1077269677 11:1669791-1669813 CCTGCTGGAGAGAGGAAGGAGGG + Intergenic
1077272699 11:1689239-1689261 ACTGCTGAGGAGGGGAAGGATGG + Intergenic
1077299742 11:1841437-1841459 GCTCCTGTGGAGGAGAGGGCAGG - Exonic
1077307766 11:1875668-1875690 CCTGCTGGGCATGGCAGGGGAGG - Intronic
1077366780 11:2164444-2164466 CCTCCAGGAGAGGGGAGGCCAGG + Intronic
1077408812 11:2394180-2394202 CCTGCTGGGGACGGTAAGGCAGG + Exonic
1077474153 11:2778538-2778560 CCTGGTGGGGAGTGGGGGCCTGG - Intronic
1077485944 11:2838496-2838518 CCTGCTGGGCTGGGGAAGGGAGG + Intronic
1077500283 11:2906925-2906947 GGCGCTGGGGAGGGGAGGGATGG + Intronic
1077526337 11:3067903-3067925 CCTTCTGGGGAGGGGTAGGATGG + Intergenic
1078090668 11:8262796-8262818 CCGGCAGGCGAGGGGAAGGCGGG - Intronic
1078235518 11:9481274-9481296 GCTGTTTGGGAGGCGAGGGCAGG + Intronic
1078352685 11:10607600-10607622 TGTGCTGGGGCGGGGAGGCCTGG + Intronic
1078479383 11:11662749-11662771 CCTGCTGTGATGTGGAGGGCTGG + Intergenic
1078615832 11:12864816-12864838 CCTGCAGGGTAGGGGAAGGGAGG - Exonic
1078682071 11:13486504-13486526 TCTGCTGAAGAGGTGAGGGCAGG - Intergenic
1078690550 11:13575750-13575772 CCTGTTGGGGGGTGGGGGGCAGG + Intergenic
1078855760 11:15205585-15205607 TCTGGTGGGGAAGGGAGGGCTGG + Intronic
1079489515 11:20972018-20972040 CCTGCTGGGGAGCGGGGTGGGGG + Intronic
1079608990 11:22406794-22406816 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1079638384 11:22773802-22773824 CCTGCTGTGGAAGCGAGGTCAGG - Intronic
1079967242 11:26994375-26994397 CCTGCTGGGGACTGGGGGCCAGG + Exonic
1080204447 11:29712878-29712900 CCTGCAGGGCAGGGCAGGGCTGG + Intergenic
1080906403 11:36550107-36550129 CCTGCTGGGGACTGGGGAGCTGG + Intronic
1081050817 11:38338365-38338387 CCTGTTGGGGAGGGCAGGGTGGG + Intergenic
1081188072 11:40069850-40069872 ACTACTAGAGAGGGGAGGGCAGG + Intergenic
1082802467 11:57425085-57425107 GCTGTTGGGGCGGGGAGGGGGGG + Intronic
1082848358 11:57744116-57744138 CATAGTGGAGAGGGGAGGGCAGG - Exonic
1082856935 11:57816620-57816642 CCTTTTGTGGAGGGGAGGGATGG + Exonic
1082988330 11:59186460-59186482 CCTGCTGGGGAGCTGGGAGCAGG + Intronic
1082997207 11:59263706-59263728 CCTGCAGAGGAGGAGAAGGCAGG + Intergenic
1083048368 11:59755785-59755807 CCCGCAGGGGAGGGGAGGGGAGG - Intronic
1083418838 11:62542425-62542447 GGTGATGGGGAGGGGAGGGCTGG - Intronic
1083613991 11:64017630-64017652 CCAGCTGCAGAGGCGAGGGCTGG + Intronic
1083680996 11:64351858-64351880 CGCCCTGTGGAGGGGAGGGCTGG - Intronic
1083731869 11:64656673-64656695 CCTGGAGGGGAGGAGAGGACAGG - Intronic
1083859324 11:65411576-65411598 CATCCGGGGGAAGGGAGGGCAGG - Exonic
1083869607 11:65478832-65478854 CCTGCTGCTGCGGGGAGGGAAGG - Intergenic
1083872496 11:65497724-65497746 CAGGCTGCGGAGGGGAGAGCGGG - Intergenic
1083923671 11:65793519-65793541 CCTGCTGGGGTGGGGGTGGGAGG + Intronic
1083955869 11:65982474-65982496 CCAGCTGGGGAAGGCAGGGCAGG - Intergenic
1083970462 11:66070897-66070919 GGCGCTGGGGCGGGGAGGGCTGG - Intronic
1083990375 11:66242842-66242864 TCGGCTGGGGAGGAGAGGGGTGG + Intronic
1083990517 11:66243438-66243460 GCTGGAGGGGAGGGGAGGGAAGG - Exonic
1084014822 11:66371963-66371985 CCTGCGGCGGAGGGGAAGGCGGG + Intronic
1084153692 11:67302810-67302832 CCTGCTGGGGAGGAAAAGCCTGG + Intergenic
1084214785 11:67641438-67641460 CCAGCCGGGGAGGGGTGTGCAGG - Intergenic
1084265613 11:68003870-68003892 CCGGCGGGGGCGGGGCGGGCCGG - Intronic
1084274181 11:68043311-68043333 CCTGGTGGGGGAGGCAGGGCAGG + Intronic
1084284505 11:68122242-68122264 CCTGCGGGGGATGGGGAGGCAGG - Intergenic
1084312921 11:68327078-68327100 CCTGCTGGGGCGGGCAGGGACGG - Intronic
1084422273 11:69066341-69066363 CCTGCTGGGGAGAGCTAGGCGGG - Intronic
1084483246 11:69434063-69434085 CCTGCAGGGGAGGGGAGCATGGG + Intergenic
1084559709 11:69896257-69896279 ACTGGTGGGGTGGGGAGGGGTGG - Intergenic
1084642377 11:70433487-70433509 TGTGCTGGGGACGGGTGGGCAGG + Intronic
1084642760 11:70435619-70435641 ACTGCTGGGGAGGAGAGGACTGG + Exonic
1084643206 11:70438068-70438090 CCTGCTGGAGGAGGGAGGGCAGG + Intergenic
1084649069 11:70477807-70477829 GCTGCTGAGGAGGGCAGGGCGGG - Intronic
1084677023 11:70641507-70641529 CCTGCAGGGGAGGCTGGGGCAGG - Intronic
1084691922 11:70732565-70732587 GCTTCTAGGGAGGGGAGGGTCGG - Intronic
1084691969 11:70732776-70732798 AGTGCTGGAGAGGGGAGGGCAGG - Intronic
1084747268 11:71181104-71181126 ACTGCTGACGAGGGGAGGTCTGG + Intronic
1085127471 11:74011388-74011410 GGTGCTGGGGAGGGGTGGGCTGG + Intergenic
1085322635 11:75583998-75584020 CTTTCTGGGTAGTGGAGGGCTGG + Intergenic
1085402028 11:76241212-76241234 CCAGCTGGGATGGGGAGGACAGG - Intergenic
1085423180 11:76380953-76380975 CGCGCGGGGGAGGGGCGGGCGGG + Intronic
1085458807 11:76680909-76680931 CCTGCTGGGCAGCGGAGCCCCGG + Intergenic
1085614608 11:77986830-77986852 CCTGTTGGGGAGTGGGGGGCTGG + Intronic
1085693651 11:78686027-78686049 CCTGCCTTGGAGAGGAGGGCAGG - Intronic
1085777980 11:79383171-79383193 CTAGCAGGAGAGGGGAGGGCAGG + Intronic
1086376538 11:86206604-86206626 TCTGCTGGGGAGGGGAGAGGGGG + Intergenic
1086455679 11:86956356-86956378 CCTGGTGGGGAGGGGGTGCCCGG - Intergenic
1088370611 11:109084539-109084561 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
1088410163 11:109525365-109525387 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1089249127 11:117144750-117144772 CCGGCAGGGCAGGGCAGGGCAGG - Intronic
1089253068 11:117179056-117179078 CCCGCAGGGGAGGGGGCGGCCGG - Exonic
1089393376 11:118117261-118117283 ACTGCTGGGGAGGGCAGGTGAGG - Intronic
1089395756 11:118135670-118135692 GACCCTGGGGAGGGGAGGGCTGG + Exonic
1089400316 11:118160641-118160663 CAAGCTGGGGAGGGAAGGGGAGG + Intergenic
1089630492 11:119781289-119781311 GCAGGTGGGGAGGGGAGGGCTGG - Intergenic
1089905267 11:122031717-122031739 CCTGCTTGAGTGGGGAGGGTGGG + Intergenic
1090235950 11:125147207-125147229 CCTGCCTGGCAGGGGAGGGAGGG - Intergenic
1090408562 11:126492264-126492286 ACAGCTGGGGAAGGGAGGTCAGG + Intronic
1090425606 11:126605152-126605174 CCTGCTGCAGATGGGAGAGCAGG - Intronic
1090554818 11:127862924-127862946 CCTGCTGGGGGGTTGGGGGCTGG - Intergenic
1090602015 11:128382473-128382495 CCTACTTGGGAGGGTAAGGCAGG - Intergenic
1091054535 11:132405880-132405902 CAGGCTGGGTAGGGGAGGGAGGG + Intergenic
1091184911 11:133638387-133638409 GCTGGTGGGGAGGGAAGGGAAGG - Intergenic
1091225737 11:133955892-133955914 GCGGCGGGGGAGGGGAGGGGCGG - Intronic
1091450629 12:570194-570216 CCTGCAGCCGAGGGGACGGCGGG + Intronic
1091460907 12:642967-642989 CCAGCTGGGGAGGGAGGGCCGGG - Intronic
1091680943 12:2526066-2526088 GCAGCTGGGGAGAGAAGGGCTGG + Intronic
1091776255 12:3186824-3186846 ACTCCTGGGGAGGAGGGGGCAGG + Intronic
1091788347 12:3256558-3256580 CCGGCTAGGGCTGGGAGGGCCGG + Intronic
1091801286 12:3326311-3326333 CCAACTGGGAAGAGGAGGGCAGG - Intergenic
1091807044 12:3364337-3364359 CCAGCTGAGGAGGGGAGGGGAGG - Intergenic
1092135391 12:6143528-6143550 CCAGCTGGGGGGGGGGGGGGGGG - Intergenic
1092344731 12:7705967-7705989 CCCGCTGGGGTGGGGCGGGAGGG - Intergenic
1092659586 12:10723365-10723387 CCGGCCCGGGAGGGAAGGGCGGG + Intergenic
1093256420 12:16873557-16873579 CCTGTTGGGGAGTGGGGGCCTGG - Intergenic
1093329236 12:17814689-17814711 CCTGTCAGGGAGTGGAGGGCCGG - Intergenic
1093597138 12:20975739-20975761 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
1094310081 12:29070550-29070572 CATGGTGGGGAGGGCAGGGTTGG + Intergenic
1094480173 12:30875170-30875192 CCAGGCAGGGAGGGGAGGGCTGG + Intergenic
1094536253 12:31324790-31324812 CCTGCTCCCGAGGGGAGGGTCGG - Intronic
1094762179 12:33546688-33546710 ACTACTGGGGTGGGGAGGGAAGG + Intergenic
1095283132 12:40380353-40380375 CCTGTTGGGGGGCGGAGGGAGGG + Intergenic
1095614302 12:44170287-44170309 CCTGCTGGGGGGTGGGGGGAGGG + Intronic
1096127663 12:49131428-49131450 GCGGCTGCGGAGGGGCGGGCGGG + Intergenic
1096214797 12:49792983-49793005 CAGGCTGGGGAGGGGAGGGGAGG + Exonic
1096251064 12:50032959-50032981 GCCCCTGGGGAGGTGAGGGCCGG - Intronic
1096269860 12:50156290-50156312 GCTGCTGGGGAGGCCAAGGCAGG + Intronic
1096485096 12:51974885-51974907 CCTGCTGGGGGAGATAGGGCTGG + Intronic
1096517265 12:52163895-52163917 CCTGCTGGGGAAGGGAGGCCAGG + Intergenic
1096529150 12:52232605-52232627 CCTACTGGAGTGGGGAGGGGAGG + Intronic
1096674212 12:53217738-53217760 CCTGCTGGGGAGGATGGGGGTGG + Intronic
1096677752 12:53234643-53234665 CAAGCTGGGGAGTGGAGGGTGGG - Intergenic
1096678845 12:53241745-53241767 CCGGCCTGGAAGGGGAGGGCTGG + Intergenic
1096776318 12:53966495-53966517 GCAGCAGGGGTGGGGAGGGCTGG + Intergenic
1096782819 12:54000755-54000777 CCGGCGCGGGAGGGGAGGGGAGG + Intronic
1096981003 12:55728352-55728374 CCTGGGGCAGAGGGGAGGGCGGG + Exonic
1097017660 12:55998712-55998734 GCTGCTGGGGAGGCTAAGGCAGG + Intronic
1097047193 12:56196009-56196031 CCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1097135100 12:56846315-56846337 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1097157994 12:57026658-57026680 AGGGCTGGGGAGGGGAGGACTGG + Intronic
1098275814 12:68810196-68810218 CCTGCTGAGGAGGCTGGGGCAGG + Intronic
1098394817 12:70006295-70006317 CCTGCTCGGGAGGGCAGGATTGG - Intergenic
1099409725 12:82310638-82310660 CCTGTTGGGGGGCGGGGGGCTGG - Intronic
1099637019 12:85226678-85226700 CCTGCTGGGGGGTGGGGGGAGGG - Intronic
1099896457 12:88654047-88654069 CATGCTGAGGAGGGGAGTCCTGG - Intergenic
1100262892 12:92949546-92949568 AGGGCAGGGGAGGGGAGGGCAGG + Intergenic
1100381905 12:94070244-94070266 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1100399105 12:94212473-94212495 CCTGCCGGGGGGTGGGGGGCTGG - Intronic
1100542829 12:95574077-95574099 GCTGCCGGGGAGGGGAGGGCTGG + Intergenic
1101730873 12:107426030-107426052 CTTGCTGGGGGTGGGAGGGAGGG - Intronic
1101970632 12:109309784-109309806 CCTGCTGGGGCCGCGAGGGGGGG + Intergenic
1102101441 12:110281529-110281551 CCTTCTGGCGAGGGGAGGGAGGG + Intronic
1102111550 12:110369109-110369131 GCTACTTGGGAGGGTAGGGCAGG - Intergenic
1102184576 12:110937595-110937617 CCTGCTGGGGGCCGGTGGGCAGG + Intergenic
1102236691 12:111298318-111298340 CCTGGGGGAGAGGGGAGGCCAGG + Intronic
1102254929 12:111409892-111409914 CCGGCTGGGGCGGGGAGTGGGGG - Intronic
1102370807 12:112381602-112381624 CCCGTGGGGGAGGGGAGGGAGGG + Intronic
1102458672 12:113087022-113087044 CAGGTAGGGGAGGGGAGGGCAGG - Intronic
1102465768 12:113130141-113130163 CCTGATGGGGGTGGGTGGGCTGG - Intronic
1102505964 12:113384829-113384851 CCTGCCGGGCAGGGGAAGGGAGG - Exonic
1102537550 12:113592475-113592497 GCTGCTGGGGAGGGCAGGTGAGG + Intergenic
1102609511 12:114099179-114099201 CCTCATGGGAGGGGGAGGGCAGG + Intergenic
1103018659 12:117515812-117515834 GCTGCTGGGGAGGCTAAGGCAGG + Intronic
1103512357 12:121484121-121484143 CCTGCAGGAGAGGGGAAGGTGGG - Intronic
1103667612 12:122582457-122582479 CTTGCTGAGGTGGGGAGGGGAGG + Intronic
1103876156 12:124129009-124129031 GCTGCTGGGGAGGCTAAGGCAGG - Intronic
1103896136 12:124274479-124274501 CTTCTGGGGGAGGGGAGGGCGGG + Intronic
1104338010 12:127918783-127918805 AATTCTGGGGAGGGGAGGGCAGG - Intergenic
1104406462 12:128521452-128521474 CCTGTTGGGGGGTGGGGGGCTGG - Intronic
1104450503 12:128864771-128864793 GCTGTTGGGGAGGGGTGAGCTGG + Intronic
1104745125 12:131205652-131205674 GCTCCTGGGGATGGAAGGGCCGG + Intergenic
1104749485 12:131229404-131229426 ACTGCTGGGGTGGGGTGGGGAGG + Intergenic
1104768697 12:131346616-131346638 GCTGCAGGGGAGGGGCTGGCGGG - Intergenic
1104807532 12:131599058-131599080 CCAGGAGGGGAGTGGAGGGCTGG - Intergenic
1104897943 12:132173417-132173439 TCTGTTGGGGAGGGGAGGGGAGG + Intergenic
1105215306 13:18280681-18280703 GCTGCGGGGGTGGGGAGGGGGGG + Intergenic
1105403988 13:20118864-20118886 CCCGCGGGGGAGGCGAGGGAAGG - Intergenic
1105472258 13:20704323-20704345 GCAGGTGGGGAGGGCAGGGCTGG + Intronic
1105673501 13:22644904-22644926 AGTGCTGGGAAGGGAAGGGCGGG - Intergenic
1105925864 13:25007405-25007427 CCTGTTGGGAGGTGGAGGGCAGG - Intergenic
1106181259 13:27371663-27371685 CCTTCTTGGGTGGGGAGGACTGG - Intergenic
1106400830 13:29428603-29428625 GCTGCTGCGGGAGGGAGGGCGGG - Intronic
1107086579 13:36432437-36432459 CCGGCTGGGCGGGGCAGGGCGGG - Exonic
1108316752 13:49244132-49244154 CTTGAAGGGGAGGGGAGGGGAGG - Intergenic
1108396545 13:49996684-49996706 CCGCCTGGGACGGGGAGGGCCGG - Intronic
1109004355 13:56852439-56852461 CTTTCTGGGGAGGGCAGAGCAGG + Intergenic
1109172970 13:59118409-59118431 AGTGCTGGGAAGGGAAGGGCTGG - Intergenic
1109271044 13:60255284-60255306 ACTGGAGGGGAGGGGAGGGGAGG - Intergenic
1109416403 13:62046569-62046591 CCTGCAGAGCAGGGGAGGGTGGG + Intergenic
1109899916 13:68753917-68753939 CCTGCTGGGGGGTGCGGGGCTGG + Intergenic
1110318241 13:74134474-74134496 CCGGGCGGGGAGGCGAGGGCCGG - Intergenic
1111122824 13:83877676-83877698 GTTGCTGGGGCGGGGAGGGTGGG + Exonic
1111396139 13:87672083-87672105 CCGAGGGGGGAGGGGAGGGCCGG + Intergenic
1111927308 13:94477481-94477503 ACTGCTAGAGAGGGGAGGGAGGG + Intronic
1112268508 13:97947714-97947736 GCTACTGGGGAGGCTAGGGCAGG - Intergenic
1112507074 13:99981710-99981732 CGGGCAGGGCAGGGGAGGGCGGG - Intergenic
1112621910 13:101061909-101061931 CCTGCGGGGCAGGGCGGGGCGGG + Intronic
1112692776 13:101916195-101916217 CCTGCAGGGACGCGGAGGGCAGG + Intronic
1112703663 13:102040996-102041018 CCTGCTGGGTATGGTAGGGTGGG - Intronic
1112748877 13:102559973-102559995 CCTGTTGGGGAGTGGGGTGCTGG + Intergenic
1112811797 13:103226597-103226619 CCTGCTGGGCTGGGGAGGGATGG + Intergenic
1112908623 13:104454797-104454819 CCTGTTGGAGGGTGGAGGGCAGG + Intergenic
1113008489 13:105735779-105735801 CCAGCTGGAGAGGGGAGGAAAGG - Intergenic
1113494191 13:110714564-110714586 GCTGCGGGGGAGGGGGCGGCGGG + Intronic
1113505073 13:110811100-110811122 CCTGCTGGGAAGCGCTGGGCTGG + Intergenic
1113814030 13:113159347-113159369 AGTGCTGGGCAGGGCAGGGCGGG - Intronic
1113886717 13:113664902-113664924 ACTGCTGTGAAGGGCAGGGCTGG + Intergenic
1113962300 13:114132694-114132716 CCTGCAGGGGCGGGGTTGGCAGG + Intergenic
1113982633 13:114289032-114289054 CCTGCCGGGGTGGGGAGAGGGGG + Intronic
1114665391 14:24374474-24374496 CCTGCTGGGGAGGGGAGGGCAGG + Intronic
1114901196 14:27061170-27061192 CCTGTTGAGGGGTGGAGGGCTGG - Intergenic
1114924967 14:27384455-27384477 AGTGCTGGGAAGGGAAGGGCGGG - Intergenic
1115000769 14:28417747-28417769 CCTGTTGGAGAGTGGGGGGCAGG - Intergenic
1115035436 14:28851206-28851228 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1115180679 14:30622294-30622316 CCGGCTGGGGAGCGGAGCGGGGG - Exonic
1115486106 14:33912930-33912952 GCTGGTGGGGAGGGGAGAGGAGG - Intergenic
1115818998 14:37193799-37193821 CCTGTTGGGTGGGGGGGGGCTGG + Intergenic
1115958685 14:38810346-38810368 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
1117066977 14:52021001-52021023 TCTGCTGGGGATGGGAGGGGTGG - Intronic
1117452484 14:55865168-55865190 CCTGGTGGAGAGGGCAGGGTAGG + Intergenic
1117484334 14:56178739-56178761 TCTCCTGGGGAGGGCTGGGCAGG + Intronic
1117547340 14:56804422-56804444 ACTGCTGCGGGGTGGAGGGCAGG - Intronic
1117892103 14:60435707-60435729 CCTTCTGGGGAGAGCGGGGCAGG + Intronic
1118321371 14:64755136-64755158 AGTGCTGGGGAGGAGAGGGAAGG + Intronic
1118609515 14:67529205-67529227 GCGGATGGGGAGGGGAGGGAAGG - Intronic
1118610119 14:67533269-67533291 GCTGCCGGGGAGGGGAGAACCGG + Intronic
1118921860 14:70156744-70156766 CCAGCAGGGGAGGGGTGGGGAGG + Intronic
1119182252 14:72613257-72613279 CATGGTGGGGACGGGAGGGCAGG - Intergenic
1119261341 14:73239866-73239888 CCTGCAGGGGAGTCGGGGGCGGG + Intronic
1119519665 14:75276994-75277016 CCGGCAGGAGCGGGGAGGGCAGG - Intergenic
1119527458 14:75333843-75333865 CCTGGGGAGGAGGGGAGGGGGGG + Intergenic
1119720662 14:76888102-76888124 CCTGATGGGAAGGTGAGGGCAGG + Intergenic
1119726148 14:76922887-76922909 CCGGATGGAGAGGGGAGGACAGG - Intergenic
1120404461 14:84077769-84077791 TGGGCTGGGGAGTGGAGGGCTGG - Intergenic
1120993389 14:90397636-90397658 CGGGGTGGGGAGGGGCGGGCCGG - Intronic
1121315756 14:92960174-92960196 CCGGCTGGGGAGTAGAGGGAGGG + Intronic
1121565543 14:94906826-94906848 ACTGCTTGGCAGGGGTGGGCGGG + Intergenic
1121692662 14:95889137-95889159 ACAGCAGGGGAGGGGAGGGGAGG - Intergenic
1121744602 14:96278410-96278432 CCAGCAGGAGATGGGAGGGCAGG + Intergenic
1122156928 14:99755539-99755561 CCAGCTGTGGAGGGGAGAGCTGG + Intronic
1122236434 14:100333080-100333102 CCAGGTGAGCAGGGGAGGGCAGG + Intergenic
1122413865 14:101539308-101539330 CAAGGTGGGCAGGGGAGGGCAGG + Intergenic
1122779714 14:104138535-104138557 CGCGCTCGGGAGGCGAGGGCGGG - Intergenic
1122795307 14:104203125-104203147 CCTGCAGGAGTCGGGAGGGCTGG - Intergenic
1122861196 14:104583062-104583084 CCAGTTAGGGAGGGGATGGCAGG + Intronic
1123034483 14:105466365-105466387 CCAGCAGGGGAGGGGCAGGCAGG - Intronic
1123140848 14:106076538-106076560 ACTGCTGGAGAGTGGAGGGAGGG + Intergenic
1123158638 14:106255421-106255443 ACTGCTGGAGAGTGGAGGGAGGG + Intergenic
1123162924 14:106297239-106297261 CCTGTCGGGGAGTGGGGGGCTGG - Intergenic
1123864832 15:24508514-24508536 CCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1124354384 15:28984226-28984248 CATGCTGGGGGAGTGAGGGCAGG + Intronic
1124505338 15:30267671-30267693 CCTGGTGGGGGCAGGAGGGCTGG + Intergenic
1124659847 15:31538251-31538273 CCCGCTGGGGAGAGAAGAGCAGG + Intronic
1124693822 15:31847001-31847023 CCTGCTAGGCAGGGCAGGGAAGG + Intronic
1124738214 15:32270960-32270982 CCTGGTGGGGGCAGGAGGGCTGG - Intergenic
1124798342 15:32804658-32804680 CCTGTTGGGGGGTGGGGGGCTGG - Intronic
1125200339 15:37096806-37096828 CCTTCTTGGGAGGTCAGGGCTGG - Intronic
1125483060 15:40093576-40093598 GCAGCTGGGGAGGGGAGGAGAGG - Intronic
1125539340 15:40460734-40460756 GCTGCTGGGGAGGTGAGGGCTGG + Intronic
1125541205 15:40471092-40471114 GTAGTTGGGGAGGGGAGGGCAGG - Exonic
1125594094 15:40873498-40873520 CCTCCTGGGGTGGGAAGGCCAGG + Exonic
1125602523 15:40923412-40923434 CCAGGTGGGGAGGCAAGGGCAGG + Intergenic
1125713717 15:41806810-41806832 TCAGCTGGGGAGAGGAGTGCGGG - Intronic
1126025165 15:44439391-44439413 CCGGCTGGGGATGGGGGGGCAGG - Intronic
1126143021 15:45452923-45452945 CCCGTGGGGGAGGGGGGGGCGGG + Intergenic
1126237253 15:46400475-46400497 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1126475750 15:49063512-49063534 AGTGCTGGGAAGGGAAGGGCAGG - Intergenic
1126647421 15:50888901-50888923 CCAGCTGGGGAGGCTGGGGCAGG + Intergenic
1126697908 15:51341452-51341474 CCTGCGGAGGAGGGGCTGGCAGG - Intergenic
1126839704 15:52705348-52705370 CCTGTTGGGGAGTGGGGGGCTGG + Intronic
1127309435 15:57739322-57739344 CCTGTTGGGGGGAGGGGGGCAGG + Intronic
1127315312 15:57789264-57789286 CTTGCTGGGGAGGTGGGGGAAGG - Intergenic
1127361861 15:58251463-58251485 CCTGCTTCAGAGGAGAGGGCAGG - Intronic
1127381941 15:58438159-58438181 GCTGATGTGGAGAGGAGGGCAGG - Intronic
1127625525 15:60776422-60776444 CCTGCTGGGGAGCAAAGGCCTGG + Intronic
1127732512 15:61813779-61813801 ACTGCTGGGGAGGGTAAAGCAGG + Intergenic
1127770154 15:62224352-62224374 CAGGCAGGGCAGGGGAGGGCAGG - Intergenic
1127861585 15:62998236-62998258 CATGCTGGGCAGGTGGGGGCAGG + Intergenic
1127873286 15:63090972-63090994 CTGGCTGGGGAGGGCCGGGCAGG - Intergenic
1127893876 15:63277767-63277789 CCAGCGGGGGAGGGGAGCCCCGG - Intronic
1127994192 15:64143105-64143127 CCTAGGGGGAAGGGGAGGGCGGG + Intronic
1128398716 15:67254966-67254988 GCGGCTGGGCAGGGCAGGGCCGG - Intronic
1128523921 15:68395718-68395740 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
1128645575 15:69376509-69376531 CAAGTTGGGGAGGGCAGGGCAGG + Intronic
1128731970 15:70027286-70027308 CCGGCTGGGCAGGGAAGGGAAGG - Intergenic
1128789569 15:70423189-70423211 CCTCCTGGGGATGGGAAAGCAGG - Intergenic
1129036647 15:72654464-72654486 ACTCCGGGAGAGGGGAGGGCTGG - Intergenic
1129093248 15:73174363-73174385 CCTGCTGGGGTGCTGTGGGCTGG + Intronic
1129189743 15:73930365-73930387 TTTGCTGGGGAGGGGATTGCAGG + Intronic
1129213240 15:74082761-74082783 ACTCCGGGAGAGGGGAGGGCTGG + Intergenic
1129292781 15:74581164-74581186 ACTGATGGGGGCGGGAGGGCAGG - Intronic
1129379125 15:75154477-75154499 TCTGCCGGGGAGGGGAGGGGTGG - Intergenic
1129400771 15:75282602-75282624 ACTCCGGGAGAGGGGAGGGCTGG - Intronic
1129424517 15:75454343-75454365 CCTGCAGGGGAGCTGAGGGGCGG - Intronic
1129607405 15:77031555-77031577 TCTGCCGGGGATGGGAGGGGAGG + Intronic
1129699043 15:77757119-77757141 ACTGGTGGGGAGGGGAAGGCAGG - Intronic
1129709185 15:77811550-77811572 CTTGCTGGGCAGGGGTGGGTGGG + Intronic
1129709868 15:77815292-77815314 CTTGCTGGGCAGGGGTGGGTGGG - Intronic
1129788190 15:78322955-78322977 CCTCCTGGGGATGGATGGGCAGG - Intergenic
1129881242 15:79007661-79007683 GCTACTGGGGAGGGTAAGGCAGG - Intronic
1130086734 15:80783994-80784016 CCTGCAGGGGTGGGGAGGCAAGG - Intronic
1130335303 15:82952758-82952780 GCGGCTGGGGAGGGCGGGGCGGG - Intronic
1130396777 15:83509220-83509242 CCTGCCGTGGAGGGGAGGAATGG + Intronic
1130847304 15:87759241-87759263 CCTGAATGGGAGGGGATGGCAGG + Intergenic
1131035942 15:89222026-89222048 CCTGCTGGCTGGGGGAGGGGTGG - Intergenic
1131065034 15:89429279-89429301 CCTCCTGGGGAGAGGAGTGGAGG - Intergenic
1131451238 15:92541878-92541900 CTTGCTGGGTTGGGGAAGGCTGG - Intergenic
1132199835 15:99943778-99943800 CCAGTTGGGGAGGGGGAGGCAGG + Intergenic
1132226967 15:100150391-100150413 CCAGCTGGAAAGGGGTGGGCTGG - Intronic
1132279908 15:100603322-100603344 ACAACGGGGGAGGGGAGGGCTGG - Intronic
1132289017 15:100686334-100686356 CCAGCTGGAGAGTGGAGGGAAGG + Intergenic
1132293984 15:100721573-100721595 GCTGCTGGGGAAAGGAGGGCGGG + Intergenic
1132426830 15:101724598-101724620 CCTGCAGGGGCGGGGCGGGGCGG + Exonic
1132426850 15:101724643-101724665 CCTGCAGGGGCGGGGCGGGGCGG + Intergenic
1132445027 15:101908808-101908830 CCTGGTGGGGAGTGAGGGGCAGG - Intergenic
1132570579 16:642281-642303 CCGGCGGGGGAGGGGAAGCCGGG - Intronic
1132688752 16:1172979-1173001 CCTGGGAGGGAGGGGAGGGGTGG + Intronic
1132702564 16:1228394-1228416 CTGCCTGGGCAGGGGAGGGCCGG + Exonic
1132705760 16:1242474-1242496 CTATCTGGGCAGGGGAGGGCTGG - Exonic
1132708860 16:1257835-1257857 CCATCTGGGGAAGGGAGGGGAGG - Intronic
1132709194 16:1258925-1258947 CTGCCTGGGCAGGGGAGGGCCGG - Exonic
1132732036 16:1367429-1367451 GATGCTGGGGAGGGGAGGGGAGG - Intronic
1132741406 16:1414911-1414933 GCTGCAGGGCAGGGCAGGGCAGG - Intergenic
1132755274 16:1481485-1481507 CATGCTGGGGAGGGGAAGCCAGG + Intergenic
1132977158 16:2716572-2716594 GCTGCAGGGTTGGGGAGGGCAGG - Intronic
1132991720 16:2798905-2798927 CCGGGTGGGGTGGGGTGGGCAGG - Intergenic
1133102181 16:3486289-3486311 CCTGCATCGGAGGGCAGGGCAGG - Exonic
1133104361 16:3496980-3497002 CCTGCTGGGGAGGCCGAGGCAGG - Intergenic
1133154309 16:3861981-3862003 TCTCCTGGGGAGGAGAGGGTGGG - Intronic
1133261976 16:4556789-4556811 GCAGCTGGGCAGTGGAGGGCAGG - Exonic
1133786297 16:8976055-8976077 CCTGCTGGGGGGTGGGGGGAGGG - Intergenic
1133907007 16:10031631-10031653 GCTGCAGGGGAGAGGAGTGCAGG - Intronic
1133968119 16:10546526-10546548 TCTGCTGGGGAGGACATGGCCGG + Intronic
1134028941 16:10976698-10976720 CATGCTGGGGATGGGGGGCCAGG - Intronic
1134070423 16:11256607-11256629 GCTGCAGGGGAGGAGAGGACAGG - Intronic
1134537189 16:15035427-15035449 CCTGCGGGAGAGGAGAGGGCTGG - Exonic
1135114135 16:19711440-19711462 CCTGCAGGAGAGGGCAGAGCTGG + Exonic
1135137378 16:19895116-19895138 AATGGTGGGGAGAGGAGGGCAGG + Intergenic
1135295244 16:21273985-21274007 CCTGCTGGGGAGGGAAGAATGGG - Intronic
1135609656 16:23855144-23855166 CCGGCGGGGGAGGGGGTGGCAGG + Intronic
1135872147 16:26161053-26161075 CCAGGTGGGAAGGAGAGGGCAGG - Intergenic
1136045281 16:27610258-27610280 CCAGCCTGGGAGGGGAGAGCAGG + Intronic
1136170859 16:28488505-28488527 CCAGCTGGGTAGTGAAGGGCTGG + Intronic
1136250974 16:29004861-29004883 CAGGCTGGGGAAGGGAAGGCAGG - Intergenic
1136413719 16:30091403-30091425 CCTCCCGGGGTGGGGAGGGAGGG - Intronic
1136716862 16:32288669-32288691 CTTGGTGGGGAGGGCAGGGCCGG - Intergenic
1136730692 16:32409265-32409287 CCTGTTGGGGGGTGGAGGGCTGG - Intergenic
1136736685 16:32473611-32473633 CATGCAGGGGAAGGGAGGGCAGG - Intergenic
1136772384 16:32852517-32852539 ACTGTTGGGGAGTGGGGGGCTGG + Intergenic
1136777376 16:32879138-32879160 ATAGCAGGGGAGGGGAGGGCAGG + Intergenic
1136777723 16:32880637-32880659 GCTGCTGGGCAGGGCAGGGCGGG + Intergenic
1136835238 16:33494914-33494936 CTTGGTGGGGAGGGCAGGGCCGG - Intergenic
1136892900 16:33980877-33980899 GCTGCTGGGCAGGGCAGGGCGGG - Intergenic
1136893249 16:33982375-33982397 ATAGCAGGGGAGGGGAGGGCAGG - Intergenic
1136898232 16:34009000-34009022 ACTGTTGGGGAGTGGGGGGCTGG - Intergenic
1137476739 16:48815881-48815903 CCTATTGGGGAGTGGAGGGTGGG + Intergenic
1137499577 16:49000112-49000134 CCTGCTGCGGAGGGTGGGGGGGG + Intergenic
1137685178 16:50381817-50381839 CCTCCTGGGATGGGGAGGGTGGG + Intergenic
1138023265 16:53503271-53503293 CCCGCTGCCGAGGGCAGGGCAGG - Intronic
1138083830 16:54115962-54115984 TCTGCTGGGGTGTGGAGGGGAGG - Exonic
1138131506 16:54483933-54483955 CCCCCTGGAGAGGGGAGAGCAGG + Intergenic
1138143717 16:54589669-54589691 GCTGCTGGGGAGGGTGGGGCAGG + Intergenic
1138186626 16:54982387-54982409 CGGGCTGGGGGGTGGAGGGCGGG - Intergenic
1138348774 16:56335501-56335523 CCAGCAGAGAAGGGGAGGGCAGG + Intronic
1138506267 16:57479831-57479853 CGTCCTGGGGTGGGGAGGGAAGG - Intronic
1138594539 16:58022783-58022805 GCTGAGGGGGAGGGGTGGGCAGG + Intergenic
1138655246 16:58487708-58487730 CCTGCTGCGGCGGGGACGCCCGG - Intronic
1138756366 16:59490942-59490964 CCTGCAGGGGAGGGGGAGGAAGG - Intergenic
1139420003 16:66844329-66844351 CCTGCTGGGGGGTGGGGGGCGGG + Intronic
1139471074 16:67178504-67178526 CCTGCGGGGAAGGCGAGGGGAGG + Exonic
1139475239 16:67199615-67199637 CCTGCGGAGGGCGGGAGGGCAGG + Intronic
1139505565 16:67396557-67396579 CCTGCTGGGGTGGGGGTGGGTGG + Intronic
1139515006 16:67447560-67447582 ACAGCTGGGGAGTGGAGGGCCGG + Intronic
1140056083 16:71526856-71526878 TCTGCTGGGGAGTGGAAGACAGG + Intronic
1140334731 16:74094740-74094762 CCTGAGTGGGAGGGCAGGGCAGG - Intergenic
1140396719 16:74633584-74633606 ACTGCTGGGGATGGGAGAGGAGG + Intronic
1140457292 16:75112797-75112819 GCTGCTGGGGAGAGGTGGGGAGG - Intronic
1140475607 16:75238062-75238084 GCACCTGGGGAGGGGAGGGCTGG - Intronic
1140873762 16:79131136-79131158 CCTGCTTGGGAAGGAAGGCCCGG - Intronic
1141438993 16:84017129-84017151 CTTCCTGGGGAGGTGAGGCCTGG - Exonic
1141605636 16:85151907-85151929 CCAGCCGGGGAGAGGAGGGCGGG - Intergenic
1141635100 16:85310467-85310489 ACGGCAGGGGAGGGGAGGGAGGG - Intergenic
1141649614 16:85385951-85385973 CCCATTGGGGAGGGGTGGGCAGG + Intergenic
1141683487 16:85557020-85557042 CCTGGAGGGGAGGGGAGGGGAGG + Intergenic
1141690368 16:85593286-85593308 TCTGCTGTGGAGGGGAGGGGCGG - Intergenic
1141792102 16:86243829-86243851 CCTGCTGGGCTGGGGATGGCAGG + Intergenic
1141895676 16:86957408-86957430 CCTGCCGTGGAGGGGAGCCCGGG - Intergenic
1141984812 16:87572827-87572849 CTTCCTGGGGAGGGGAGTGTGGG - Intergenic
1142151006 16:88512549-88512571 CCTGCTGGGGCCTGGGGGGCAGG - Intronic
1142155963 16:88533052-88533074 CCGGAAGGGGAGGGGTGGGCGGG - Intronic
1142160875 16:88556830-88556852 CCTGCTCGGGAGGGCACAGCTGG + Intergenic
1142169263 16:88612013-88612035 CATGCAGGGGAGGGCCGGGCGGG + Intronic
1142214274 16:88823138-88823160 TCTGCTGGGGAAGGGAGGGGAGG + Intronic
1142352480 16:89586546-89586568 CGTGGTGGGGAGGGGAGGGGAGG - Intronic
1142380712 16:89730414-89730436 GCTGCTGGTGTGAGGAGGGCTGG + Intronic
1202995705 16_KI270728v1_random:108004-108026 CCTGTTGGGGGGTGGAGGGCTGG + Intergenic
1203009565 16_KI270728v1_random:229118-229140 CTTGGTGGGGAGGGCAGGGCCGG + Intergenic
1203016383 16_KI270728v1_random:355966-355988 CATGCAGGGGAAGGGAGGGCAGG + Intergenic
1203022392 16_KI270728v1_random:420346-420368 CCTGTTGGGGGGTGGAGGGCTGG + Intergenic
1203034718 16_KI270728v1_random:629124-629146 CATGCAGGGGAAGGGAGGGCAGG + Intergenic
1203074807 16_KI270728v1_random:1114615-1114637 ACTGTTGGGGAGTGGGGGGCTGG + Intergenic
1203079789 16_KI270728v1_random:1141247-1141269 ATAGCAGGGGAGGGGAGGGCAGG + Intergenic
1203080139 16_KI270728v1_random:1142746-1142768 GCTGCTGGGCAGGGCAGGGCGGG + Intergenic
1203145410 16_KI270728v1_random:1795235-1795257 CTTGGTGGGGAGGGCAGGGCCGG - Intergenic
1142472704 17:172197-172219 CCTGCAGGCCAAGGGAGGGCGGG - Intronic
1142533211 17:596492-596514 GTTGGTGGGGAGGGCAGGGCAGG - Intronic
1142589710 17:997369-997391 CCTGCGTGGGAGGTGAGGCCGGG + Exonic
1142618596 17:1151434-1151456 GCAGTTGGGGAGGGCAGGGCTGG - Intronic
1142669750 17:1482703-1482725 GCAGGAGGGGAGGGGAGGGCAGG - Intronic
1142669777 17:1482778-1482800 CCAGTGTGGGAGGGGAGGGCAGG - Intronic
1142696862 17:1638714-1638736 CCTTGTGGGGTGGGGAGGGCTGG - Intronic
1142697975 17:1643967-1643989 CCTGCGGGGGTGGGGACGGGAGG + Exonic
1142703054 17:1676161-1676183 CCTGCTGGGAAGGTGACAGCAGG - Intronic
1142767670 17:2074840-2074862 CCTGATGGAGAGGGAGGGGCAGG + Intronic
1142854883 17:2724045-2724067 CTTGGTGGGGTGGGGAGGGCTGG - Intergenic
1142958960 17:3540414-3540436 CTTGCTGGGGCGAGGAGGTCTGG - Intronic
1143374298 17:6458256-6458278 TATCCTGGGGAGGGGAGGGAAGG - Intronic
1143431931 17:6894131-6894153 CCCGCTGGGGTGGGCACGGCAGG + Intronic
1143449933 17:7030076-7030098 CTTGCTGGGGGAGGGTGGGCTGG - Intronic
1143462472 17:7112720-7112742 GGTGCTGGGCAGGGCAGGGCAGG - Intronic
1143465615 17:7134310-7134332 AGTGCTGGGGAGAGAAGGGCGGG - Intergenic
1143504469 17:7356153-7356175 AACGCTGGGGAGGGGAGGCCGGG - Exonic
1143579660 17:7818129-7818151 GATGCTAGGGAGGGAAGGGCTGG + Intronic
1144351018 17:14396484-14396506 GCTGCTTGGGATGGGTGGGCTGG + Intergenic
1144379882 17:14684207-14684229 CCTGCTGGAGAATGGAGGGTGGG - Intergenic
1144481033 17:15629077-15629099 CCTGCTGGGGAGGTCCGGGTAGG + Exonic
1144577236 17:16436808-16436830 CCTCCTTGGGAGGGGAAGCCAGG - Exonic
1144581394 17:16461445-16461467 CCTGGCGGGAAGGGGAGGGCCGG - Intronic
1144642252 17:16944009-16944031 CTTGGTGGGGAGAGGAGGGCAGG - Intronic
1144917332 17:18734976-18734998 CCTGCTGGGGAGGTCCGGGTAGG - Exonic
1144956040 17:19019401-19019423 CCTGCAGGCGAGTGGAAGGCAGG - Exonic
1145052839 17:19677107-19677129 CCTGCTGGACAGAGCAGGGCAGG + Exonic
1145260719 17:21352779-21352801 CCTGGCGGGGAGGGGAGAGGCGG + Intergenic
1145855786 17:28155773-28155795 CCTGTCGGGGGGTGGAGGGCTGG + Intronic
1145886917 17:28388273-28388295 CCAGGTGAGGAGGGGCGGGCGGG + Exonic
1145924039 17:28632844-28632866 CCCTCTGGGGAGGGGAGGGGAGG - Intronic
1146053457 17:29569243-29569265 TGTGGTGGGGAGGGGACGGCAGG - Intronic
1146093415 17:29905376-29905398 CCTGCTGGGCAAGTGATGGCAGG - Intronic
1146341124 17:32020844-32020866 CCTGCTGTGGTGGGGTGGGGTGG - Intronic
1146357014 17:32142763-32142785 GCTGCAGGGGCAGGGAGGGCAGG - Intronic
1146652101 17:34613374-34613396 GCAGCGGGGGAGGGGAGTGCGGG - Intronic
1146657877 17:34645670-34645692 CCACCAGGGGAGGGGTGGGCTGG - Intergenic
1146716274 17:35089285-35089307 CCGGCTGGGGATGGGTGGGAGGG - Exonic
1146935383 17:36809717-36809739 CCTGGTAGGTGGGGGAGGGCAGG + Intergenic
1146996014 17:37321634-37321656 GCTGCTGGGGAGGGTGAGGCAGG + Intronic
1147188646 17:38726228-38726250 CGTGATGGGGAGGAGAGGGCAGG + Exonic
1147254339 17:39173245-39173267 CCAGCTGGGGATGGGAGGAATGG + Intergenic
1147466678 17:40616179-40616201 CGTGGTGGGGAGGGGAGGAGAGG + Intergenic
1147517731 17:41138051-41138073 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1147568218 17:41550614-41550636 CCAGCTGGGGAGGACAGGTCAGG + Intergenic
1147726144 17:42567185-42567207 CACGCCGGCGAGGGGAGGGCGGG + Exonic
1148075075 17:44930991-44931013 CGTGCTGGGGAGGGAAGAGCGGG + Intronic
1148106342 17:45120875-45120897 CCTGCCGGGGCTGGGAGGGAGGG - Intronic
1148171620 17:45525838-45525860 CCTGTTTGGGTGGGGAGGGGAGG - Intergenic
1148208172 17:45792512-45792534 TCTGCTGGGTAGGGGTTGGCAGG - Intronic
1148271741 17:46266958-46266980 CCGGTTGGGGTGGGCAGGGCCGG - Intergenic
1148277750 17:46320571-46320593 CCTGTTTGGGTGGGGAGGGGAGG + Intronic
1148299957 17:46538426-46538448 CCTGTTTGGGTGGGGAGGGGAGG + Intronic
1148364402 17:47042711-47042733 CCTGTTTGGGTGGGGAGGGGAGG + Intronic
1148384659 17:47225465-47225487 CTGGCTGAGGAGGAGAGGGCTGG + Intergenic
1148466691 17:47869194-47869216 CCAGCTTGGCAGGGGAGGGGAGG - Intergenic
1148487891 17:48003114-48003136 GCTGCTGTGGGGGTGAGGGCAGG + Intergenic
1148645453 17:49217586-49217608 CCTGGTGGGGGGCGGGGGGCGGG + Intronic
1148682564 17:49483102-49483124 CATGCTGGGGAGGGGGCTGCTGG - Intergenic
1148688411 17:49513313-49513335 CCTGCTGTGGTGGGAGGGGCTGG - Exonic
1148793405 17:50186020-50186042 ACTGCAGGGGAGGGGAGAGAGGG + Exonic
1148818358 17:50346428-50346450 CCTGCTGGGGAAGGGAGTGCCGG - Intronic
1148860958 17:50604136-50604158 CACCCTGGGGAGGGGAGGGAGGG - Exonic
1148866047 17:50629244-50629266 CCTACTGGGAAGAGGAGGCCAGG - Intergenic
1148895268 17:50835827-50835849 CCTGCTGGGGTGGGGAGGGCAGG + Exonic
1148910664 17:50940676-50940698 CCTGCTGGGCAGAGCAGGCCGGG - Intergenic
1149596130 17:57865740-57865762 CCTGCTTGGGTTGGGTGGGCTGG - Intronic
1149647293 17:58249689-58249711 CCCGCTGGTGAGGGCAGGCCGGG + Exonic
1150094657 17:62362981-62363003 CCTGTCGGGGGGTGGAGGGCTGG + Intergenic
1150402546 17:64870873-64870895 CCTGTTTGGGTGGGGAGGGGAGG - Intronic
1150575391 17:66426217-66426239 CCAGCTGGAGTGGGGAGTGCTGG + Intronic
1150625488 17:66838472-66838494 CCTTGTGGGGAGGAGAAGGCTGG + Intronic
1150631267 17:66882031-66882053 CATGCTGGGGAATGGAGGGAGGG + Intronic
1151346581 17:73506349-73506371 CCTCCTGCAGAGGGGAGAGCTGG - Intronic
1151349496 17:73523293-73523315 CCTCTTGATGAGGGGAGGGCTGG + Intronic
1151495900 17:74457877-74457899 TCTGGTGGGGAGGCGAGGGGTGG + Intergenic
1151539780 17:74759015-74759037 CCTGCTAGGGAGGGGTGAGGAGG + Intronic
1151662451 17:75525875-75525897 CCACCTGGGGCGGGGAGGCCAGG + Intronic
1151756472 17:76077962-76077984 CCGGCGGGGGGGGGGGGGGCAGG + Intronic
1151784163 17:76266790-76266812 CCTGCTGGGGGAGGAGGGGCAGG + Intronic
1152023584 17:77794784-77794806 ACTGCGGGGGAGGGGAGGTGGGG - Intergenic
1152029642 17:77834137-77834159 GCTGCTGGGGTGGTGGGGGCAGG - Intergenic
1152287738 17:79422400-79422422 CCGGCCTGGGAGTGGAGGGCCGG - Intronic
1152344587 17:79743255-79743277 TGGGCTGGGGAGGGGAGGGGGGG + Intergenic
1152472807 17:80499801-80499823 CATGCTAGGGTGGGGAGGTCTGG + Intergenic
1152524927 17:80883083-80883105 CAGGCTGGGGAGGTGAGGTCCGG + Intronic
1152540216 17:80970946-80970968 CCTGATGGGCAGGCGGGGGCGGG + Intergenic
1152546728 17:81004079-81004101 CCGGGTGGGGAGCGGAGGCCAGG - Intronic
1152551304 17:81031797-81031819 GCCGCTGGGGAGAGGAGGGCTGG - Intergenic
1152630751 17:81409774-81409796 CCTGCTGGGGAGGTGCTTGCAGG - Intronic
1152640100 17:81445726-81445748 CCTGCCGGGCAGGGGTGGGAGGG - Intronic
1152655769 17:81518630-81518652 CCTGCTGCCGCGGGGAGAGCTGG - Intronic
1152699183 17:81810803-81810825 TCTGCAGGGTAGGGTAGGGCAGG - Exonic
1152740880 17:82017852-82017874 CCTACTGAGGTGGGCAGGGCGGG + Intergenic
1152744778 17:82033618-82033640 CCTGCAGGGGAGGGGTGGGGAGG + Intronic
1152802813 17:82339789-82339811 CCTCATGGGGAGAGGAGGGAGGG + Intergenic
1152808563 17:82370769-82370791 CGTGCTGGGGAGGCGAGGCTGGG - Intergenic
1152891520 17:82884290-82884312 CCTGCTGTGGATGGGTGAGCTGG - Intronic
1152897591 17:82922025-82922047 CCAGGACGGGAGGGGAGGGCAGG - Intronic
1152926372 17:83089592-83089614 CCTCCTCGGAGGGGGAGGGCTGG - Intronic
1153450231 18:5219054-5219076 CCTACTGGAGAGTGGAGGGTGGG - Intergenic
1153678435 18:7477025-7477047 GCTACTCGGGAGGGCAGGGCAGG - Intergenic
1153874729 18:9358968-9358990 TCTGGTGGCAAGGGGAGGGCAGG + Intronic
1153893672 18:9540479-9540501 CCAGCTGGGGAGGGGAAGGAAGG + Intergenic
1153963217 18:10157830-10157852 TCTGCAGAGGATGGGAGGGCTGG - Intergenic
1153982414 18:10321678-10321700 CCTGCTGGGGAGGGCAGGACTGG - Intergenic
1154142220 18:11834272-11834294 CCTGCTAGGGAGGGGCGTGTGGG + Intronic
1154202875 18:12311179-12311201 CCAGCTAGGGATGGGAGGGGTGG - Intronic
1154316132 18:13304541-13304563 GCTGCTGGGGAGGGCTGGGAAGG + Intronic
1154954593 18:21242114-21242136 CCCGCTGCGGAGGCCAGGGCGGG + Intergenic
1155025813 18:21939876-21939898 TCTGCTGGGGAGGAGAAGGCAGG - Intergenic
1155075247 18:22348715-22348737 GCGGCGGGGGAGGGGCGGGCCGG + Intergenic
1155257943 18:24014746-24014768 CCGGGAGGGGAGGGGAGGGGAGG - Exonic
1155389116 18:25315036-25315058 CCTCAGGGGGTGGGGAGGGCTGG - Intronic
1155722899 18:29041304-29041326 CCTGTTGGGGGGTGGGGGGCGGG - Intergenic
1155932662 18:31723957-31723979 CCTGGTGGGGTGGGGTGGGGTGG - Intergenic
1156191469 18:34726090-34726112 CCTGTCGGGGAGTGGGGGGCTGG + Intronic
1156221408 18:35055841-35055863 CCTACTGGGGAGGCTGGGGCAGG + Intronic
1157102629 18:44744282-44744304 CCTGCAGGGAAGGGGGGAGCAGG - Intronic
1157285415 18:46374082-46374104 CCTGGTGGGGAGGGGAGGTGGGG - Intronic
1157574707 18:48735897-48735919 CCTCTTGGGGAGGGCTGGGCTGG + Intronic
1157595174 18:48859837-48859859 TCTGATGGGGAGGGGAGAGGCGG - Exonic
1157916600 18:51669705-51669727 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1158554021 18:58460399-58460421 CCGGCTGGGGGGGGGGGGGGGGG - Intergenic
1158592578 18:58790107-58790129 CCTTCTTGGGAGGGGAGAGCTGG + Intergenic
1158669389 18:59461335-59461357 ACTGCTGGGAAGGTGGGGGCTGG - Intronic
1158887695 18:61844230-61844252 ACGGGAGGGGAGGGGAGGGCAGG + Intronic
1158934100 18:62348816-62348838 CATTCTGGGGAGGGGAAGGTGGG + Intronic
1159178152 18:64865958-64865980 CCTGCTGTGGGGTGGAGGGAGGG - Intergenic
1159779601 18:72645831-72645853 TGAGCTGGAGAGGGGAGGGCAGG - Intergenic
1159946857 18:74450443-74450465 AGTGCTGAGGAGGGGAGGGCGGG + Intronic
1160021439 18:75184951-75184973 TCTGCTGGGGAAGGGAAGGGAGG - Intergenic
1160225023 18:77005769-77005791 GCTGCTGGGGAGGGCAGTGCTGG - Intronic
1160231602 18:77053256-77053278 GCTTCAGGGGAGGGGTGGGCAGG + Intronic
1160290016 18:77583714-77583736 CCTGTTGGGGGTTGGAGGGCTGG + Intergenic
1160334534 18:78027009-78027031 CATGCTGGGGAGAGCATGGCTGG + Intergenic
1160391214 18:78534770-78534792 CCTCCTGGGAAGGGCAGGGTGGG + Intergenic
1160525069 18:79531015-79531037 CCGGGTGGGGAGGGGAATGCTGG - Intergenic
1160535586 18:79589797-79589819 CAGGGTGGGGAGGGCAGGGCAGG - Intergenic
1160551004 18:79693883-79693905 CCTGCAGGGGAGCGGAGGGGCGG - Intronic
1160640285 19:124903-124925 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
1160703144 19:517826-517848 GCTGGTGGGGAGGGGAGGCCCGG + Intronic
1160703283 19:518174-518196 GCTGGTGGGGTGGGGAGGGGAGG + Intronic
1160703351 19:518339-518361 GCTGGTGGGGTGGGGAGGGGAGG + Intronic
1160745424 19:709068-709090 CGCGCGGGGGAGGGGAGGGGAGG - Intergenic
1160768878 19:821655-821677 CCGGCGGGGGAGGGGCGGTCGGG + Intronic
1160823082 19:1067293-1067315 ACAGCTGGGGAGGGGGTGGCCGG + Intronic
1160833272 19:1113076-1113098 GGTGCTGGGAAAGGGAGGGCGGG + Intronic
1160841197 19:1147698-1147720 GCTGATGGAGCGGGGAGGGCGGG - Intronic
1160846601 19:1168791-1168813 CTTGCTGGGGAGGGGCAGCCAGG - Intronic
1160856216 19:1219112-1219134 CCTACGGGGAAGGGGAGGACAGG - Intronic
1160910509 19:1471763-1471785 CATGCTGGGGATGGGACGGGAGG - Exonic
1160946103 19:1644801-1644823 CCTGGTGGGGAGGGTGGGGTGGG - Intronic
1160953961 19:1681145-1681167 ACTGCTGTGGAGGGGCCGGCAGG - Intergenic
1160957339 19:1699690-1699712 GCCGCTGGGGAGGGGAGGGTGGG + Intergenic
1161073284 19:2272903-2272925 CCTGCGGGGGTGGGGGGTGCGGG + Intronic
1161076842 19:2289957-2289979 CCCGCGGGGGAGGGGAGGGGAGG + Exonic
1161079811 19:2305182-2305204 CCTTCTGGGGCGTGGAAGGCAGG + Intronic
1161107845 19:2453460-2453482 CCTGCTGGGGTGGGGGCCGCTGG - Intronic
1161118354 19:2511882-2511904 CTTCCTGGAGAGAGGAGGGCAGG + Exonic
1161133008 19:2602741-2602763 GGTGGTGGTGAGGGGAGGGCCGG - Intronic
1161139431 19:2638736-2638758 TCCCCTGGGGAGGGGAGGGGAGG + Intronic
1161249934 19:3275241-3275263 CCTGCTGGGTGGGGCTGGGCTGG - Intronic
1161302118 19:3547822-3547844 CGTGCTGGGGACGGTGGGGCTGG - Intronic
1161316516 19:3619942-3619964 CCTGCCCAGCAGGGGAGGGCAGG + Intronic
1161417699 19:4156976-4156998 CCTGCTGGGGTGGACAGGGAGGG - Exonic
1161419966 19:4171334-4171356 CTTGCAGGGGAGGGGAGGGAGGG + Intronic
1161514550 19:4689398-4689420 CCTCCTGGGTAGGGCAGGGAAGG - Intronic
1161702924 19:5804951-5804973 CCGGCGGGGGCGGGGAGGGCGGG + Intergenic
1161776333 19:6264243-6264265 CTTCCTGGGGTGGGGAGGGGTGG - Intronic
1161808754 19:6459637-6459659 CCCGGGGGGGAGGGGAGGCCCGG + Exonic
1161950358 19:7464403-7464425 CCTGCTGGAGAGGGGCAGGCTGG - Intronic
1162030139 19:7913672-7913694 CCTGCTGGGGTGGCCAGAGCAGG + Exonic
1162061816 19:8100820-8100842 GCTGTTGAGGAGGGGAGGGGTGG + Intronic
1162126537 19:8502469-8502491 CCACCTGTGGAGGGGCGGGCGGG - Intronic
1162287159 19:9747430-9747452 CCTGCTGGGGGGAGGGGGGAGGG - Intergenic
1162327875 19:10009478-10009500 GCAGCTGGGGTGGGGAGGGGGGG + Intronic
1162760931 19:12887695-12887717 CCTCCGGTGAAGGGGAGGGCTGG + Intergenic
1162791077 19:13063301-13063323 GCTTCTGGGGAAGGGAGGGAAGG - Intronic
1162805436 19:13135858-13135880 CCTGTTGGGGTGGCGGGGGCTGG - Exonic
1162955865 19:14097544-14097566 CCTCAGGGGAAGGGGAGGGCTGG + Intronic
1163146041 19:15379877-15379899 CCAGCTGGGACGGCGAGGGCGGG - Intergenic
1163297911 19:16424320-16424342 CCTGGTGGGGTGGGGTGGGAGGG - Intronic
1163369149 19:16892420-16892442 CCTGCAGGTGAGAGGAGGGAAGG - Exonic
1163549510 19:17957819-17957841 GCTGCTGTGGAGAGCAGGGCAGG + Intronic
1164693698 19:30228164-30228186 TCTGCTGGGGTTGGGAGGGGGGG + Intergenic
1164783157 19:30909673-30909695 TGTGCTGGGGAGGAGAGGGGAGG + Intergenic
1165096635 19:33413297-33413319 CCAGCTGGGGACAGGAGGGAGGG + Intronic
1165105968 19:33469890-33469912 CGAGAAGGGGAGGGGAGGGCTGG - Intronic
1165295925 19:34925783-34925805 AGTGCTGGGGAGGGAAGGGCGGG - Intergenic
1165300910 19:34968192-34968214 CCTCATGGGGAGGGGAGCACAGG - Intergenic
1165323282 19:35099443-35099465 AGTGCAGGGGAGGGAAGGGCAGG - Intergenic
1165349673 19:35269049-35269071 CCCGGGGGGGAGGGGAGGGGAGG - Exonic
1165404119 19:35619591-35619613 CCTGTGGGGAAGGGGAGGGGTGG - Exonic
1165757832 19:38304507-38304529 CCGGCTGCGGAGGGGCGGGAAGG + Intronic
1165770306 19:38376138-38376160 GCTGATGGGGAGGGGAGGGAGGG - Exonic
1165800463 19:38546358-38546380 CCTGCTGGGTAGGTGAGGAGGGG + Intronic
1165945482 19:39439367-39439389 CCTGTTGGGCAGGGGAGTTCAGG + Intronic
1166130914 19:40745008-40745030 CCTGCTGGGAGGAGGAGGGAAGG - Intronic
1166136469 19:40780168-40780190 GCCGGTGGGGAGGGCAGGGCTGG + Intronic
1166215332 19:41331020-41331042 CCTGCCGGGGCGGGGCGGGGCGG + Exonic
1166365112 19:42274271-42274293 ACTGCTGGTGAGGTGCGGGCTGG + Intronic
1166695195 19:44847924-44847946 CCCCCTGGGGAGGGAGGGGCTGG + Intronic
1166746306 19:45143455-45143477 CTTCCTGGGGAGGGGACTGCAGG - Intronic
1166765203 19:45248766-45248788 GCTGTTGGGGAAGGGAGGGCAGG + Intronic
1166788293 19:45382595-45382617 CGTGCTGCGGAGGGACGGGCCGG - Exonic
1166826970 19:45615889-45615911 CCTGCGGGGGAGGGAAGGGATGG + Exonic
1166834132 19:45656845-45656867 CCTGCTGGGGAGGCTGAGGCAGG - Intergenic
1167144515 19:47673662-47673684 GGAGCTGGGGAGGGGAGGGAAGG - Intronic
1167212094 19:48139717-48139739 GGTGCAGGGAAGGGGAGGGCTGG - Intronic
1167248914 19:48390711-48390733 CCTGCTCAGGCGGGGCGGGCTGG - Intronic
1167456987 19:49601588-49601610 CCAGCGGGGGTGGCGAGGGCAGG - Exonic
1167517414 19:49931048-49931070 GGAGCTGGGGAGTGGAGGGCAGG + Intronic
1167602367 19:50461770-50461792 CCCAGTGGGGAGGGGAGGGCAGG - Intronic
1167622919 19:50568790-50568812 GATGAAGGGGAGGGGAGGGCGGG + Intergenic
1167703497 19:51065073-51065095 CGGGATCGGGAGGGGAGGGCAGG + Exonic
1167764096 19:51468785-51468807 GCTGCAGGGCAGGGTAGGGCTGG - Intergenic
1167851531 19:52206057-52206079 CCTGCTGGTGAGTGGAAGGCAGG + Exonic
1168063982 19:53909258-53909280 ACTGCGGAGGAGGGGAGGGGCGG - Intergenic
1168081626 19:54014404-54014426 ACTGCTGGGTAGAGAAGGGCAGG - Intergenic
1168132883 19:54332234-54332256 CAGGATGGGGAGGTGAGGGCTGG + Intergenic
1168354369 19:55692397-55692419 CCAGCTGGACAGGGGAGGGGTGG + Intronic
1168354549 19:55693045-55693067 GCCACTGGGCAGGGGAGGGCAGG - Intronic
1168711710 19:58504571-58504593 CCTGGGGGGGGGGGGGGGGCGGG + Intronic
924959619 2:22250-22272 TCTGCTTGAGGGGGGAGGGCGGG - Intergenic
925010238 2:479455-479477 TCTGCTGAGGTGGGCAGGGCTGG - Intergenic
925203114 2:1984999-1985021 TCTGTCGGGGAGGGGAGAGCAGG - Intronic
925449953 2:3960620-3960642 CCCGCAGGGGAGGTGTGGGCAGG - Intergenic
925788515 2:7456920-7456942 CCTGCCTGGTAGGGAAGGGCAGG + Intergenic
926177318 2:10606124-10606146 CCTGCAGGGGCTGGGATGGCTGG + Intronic
926289237 2:11515589-11515611 CCTGAGGGCGGGGGGAGGGCAGG + Intergenic
926402200 2:12508994-12509016 CCTGTTGGGGAAGGGTGGGTGGG - Intergenic
926527441 2:13998757-13998779 CCTGTCGGGGAGTGGGGGGCTGG + Intergenic
926581122 2:14633633-14633655 CCCGGTGGGGAGGAGAGTGCTGG - Intronic
926622048 2:15055495-15055517 CCAGCTGGGGGGCGGGGGGCTGG + Intergenic
926661282 2:15469830-15469852 CCTGCTGGGGGGTGGGGGGAGGG + Intronic
926794484 2:16607706-16607728 CCTGCTTGGGAGGCTAAGGCAGG - Intronic
926821437 2:16855347-16855369 CCCGGAGGGGTGGGGAGGGCTGG - Intergenic
927144469 2:20153502-20153524 TCTGTTGGGGAGGGGAGAGAAGG + Intergenic
927159228 2:20242396-20242418 CCCGCGGCGCAGGGGAGGGCCGG + Intergenic
927248006 2:20973536-20973558 CCTGCTGGGGTGGACAGGGTGGG + Intergenic
927270163 2:21198891-21198913 CCTGCTGGGCAGGGAAGAGCAGG - Intergenic
927311659 2:21638581-21638603 CCTGCAGGGAGGGGAAGGGCCGG - Intergenic
927320212 2:21735034-21735056 CCTGTTTGGGAGTGGAGTGCGGG + Intergenic
927387176 2:22548190-22548212 CCTGCTGGGGGGTGGGGGGAGGG + Intergenic
927468092 2:23351786-23351808 CCTCCCCGGGAGAGGAGGGCAGG - Intergenic
927490730 2:23519318-23519340 CCTGGGGGGGAGGGGAGGACGGG - Intronic
927557494 2:24046106-24046128 CCTGTTGGGGAGGTGGGGGTGGG + Intronic
927565616 2:24110273-24110295 CCTGCTTGAGAGTGGAGGGTGGG + Intronic
927606557 2:24491471-24491493 CCTGCTCCGGAGGAGGGGGCCGG + Intergenic
927916826 2:26942521-26942543 CCTGGTGGGGAGGCAATGGCGGG - Exonic
928058242 2:28081115-28081137 ATAGCTGGGGAGAGGAGGGCAGG + Intronic
928116022 2:28545691-28545713 CCTCCAGGTGCGGGGAGGGCGGG + Intronic
928245333 2:29621771-29621793 GCTTCTGGAGAGGTGAGGGCTGG + Intronic
928322494 2:30294960-30294982 CCTGCTGGGGAATGGAGTGAGGG - Intronic
928412442 2:31065539-31065561 CATGCTGGGGAGGGGAGTCAGGG + Intronic
928931884 2:36633327-36633349 CCTACTGGAGAGGGGAGGGAGGG - Intronic
929034057 2:37673774-37673796 AGGGGTGGGGAGGGGAGGGCAGG - Intronic
929347156 2:40898228-40898250 CCTGGTGGGGTGGGGAGGTGGGG + Intergenic
929502431 2:42501864-42501886 GCTGCTGGGGAGGCTAAGGCAGG + Intronic
929869356 2:45745255-45745277 CCTGGTGGGGAGAGGAGGCCCGG + Intronic
930002480 2:46870527-46870549 ACTGCTGAGGAGGGGAAGGTGGG - Intergenic
930103113 2:47618120-47618142 CCTTCTGGGGAAGGGAAGGGAGG + Intergenic
930475897 2:51881723-51881745 CCTACTGGAGAGTGGAGGGTGGG - Intergenic
930710324 2:54544924-54544946 CCTACTGGGGAGTGGGGGGCTGG - Intronic
930931739 2:56892993-56893015 CCTGCTGTGGGGTGGAGGGAAGG - Intergenic
931357972 2:61553612-61553634 CCTGCTGGGTAGGCTAAGGCAGG + Intergenic
931358285 2:61555976-61555998 TCAACTGGGGAGGGAAGGGCTGG - Intergenic
931643434 2:64400996-64401018 CCTGCTAGGAAGGGGAGGTCTGG + Intergenic
931668647 2:64627536-64627558 CCTGCCTGAGAGGGGAGGGAGGG + Intergenic
931681287 2:64751466-64751488 GCCGCGCGGGAGGGGAGGGCTGG - Intergenic
932344737 2:70988281-70988303 CCCGCTGGGGCAGGCAGGGCAGG - Exonic
932666907 2:73705371-73705393 GCTGGTTGGGAGTGGAGGGCTGG + Intergenic
932893195 2:75613343-75613365 CCTGCGGGGGGGGGGGGGGGGGG + Intergenic
933684594 2:85133389-85133411 CCCGCCGGGGAGGGGCGAGCGGG - Exonic
933688497 2:85161516-85161538 CCTCCTGGGATGGGGATGGCTGG + Intronic
933724503 2:85418909-85418931 CCTCGTAGGGAGGGCAGGGCGGG - Intronic
933975594 2:87506900-87506922 GCTCCTGAGGAGGGGAGAGCAGG - Intergenic
934067085 2:88350547-88350569 CCACCGGGGGAGGGGAGGGGTGG - Intergenic
934187834 2:89762728-89762750 CATACAGGGGAAGGGAGGGCAGG - Intergenic
934315027 2:91909984-91910006 CCTGTTGGGGGGTGGAGGGCTGG + Intergenic
934614168 2:95761162-95761184 ACAGCTGGGGAGGGGCGGGTGGG - Intergenic
934655851 2:96116559-96116581 CCTGCAGGGGAGTGGGGAGCGGG + Intergenic
934692037 2:96369052-96369074 CCTGCAGAGGAGGTGCGGGCTGG + Exonic
935038657 2:99404315-99404337 TCCACTGGGGAGGGGAGGGGAGG - Intronic
935271244 2:101436071-101436093 TCTGCTGGGGAGGGGAGAAGAGG - Intronic
935293271 2:101627568-101627590 CGTGTTGGGGAGGGATGGGCAGG - Intergenic
935503769 2:103873538-103873560 CTTGATGGGGGGGGGGGGGCGGG - Intergenic
936021095 2:108995577-108995599 CCTGCTGGAGAAGGGAGGCTGGG - Intergenic
936027834 2:109046996-109047018 ACTGCAGGGCAGGGCAGGGCAGG - Intergenic
936042728 2:109161927-109161949 CCTCCTGGGGAGGGGAGGGTTGG + Intronic
936065289 2:109326870-109326892 CCAGCAGGTGAGGGGAGAGCAGG + Intronic
936500486 2:113062427-113062449 CCGGCAGAGGAGGGGAGGTCAGG - Intronic
936520595 2:113210027-113210049 GAGGCGGGGGAGGGGAGGGCGGG - Intergenic
936525369 2:113237609-113237631 GCTCCTGGGAAGGGGAGGCCAGG - Intronic
937044316 2:118843254-118843276 CCTGCAGCGGCGGAGAGGGCCGG + Exonic
937129858 2:119501463-119501485 CCTGCTGGGAAGGGTGGGGGAGG + Intronic
937155149 2:119713875-119713897 CCTGGTGTGGAGGGTAGAGCAGG - Intergenic
937309801 2:120895047-120895069 GCTGATGGGGAGGGGAGGGGAGG + Intronic
937764309 2:125641715-125641737 ACTGCAGGGGAGGGCAAGGCTGG - Intergenic
937910405 2:127073018-127073040 CCTGCTGTGGGGGGGAGGTGGGG - Intronic
937913699 2:127088624-127088646 GCTACTGGGGAGGCTAGGGCAGG + Intronic
938051383 2:128175743-128175765 GCTCCTGGGAAGGGGAGGGCTGG - Intronic
938063550 2:128269504-128269526 CCTGCCGCGCAGGGGAGGGTGGG - Intronic
938263598 2:129911490-129911512 CGTGCTGTCCAGGGGAGGGCTGG - Intergenic
938265128 2:129923075-129923097 GGGGCTGGGGAGGGGAGGGAAGG - Intergenic
938291673 2:130153935-130153957 CCTGCAAGGGAGGCGCGGGCAGG + Exonic
938380174 2:130832066-130832088 CCTGCGGGTGAGGGTGGGGCGGG + Intergenic
938464878 2:131519028-131519050 CCTGCAAGGGAGGCGTGGGCAGG - Intergenic
939423111 2:141999236-141999258 CATGATGGGGAGGGGAGGGTCGG - Intronic
939587213 2:144020171-144020193 AGTGCTGGGTAGGGGAGGGTGGG + Intronic
939850867 2:147302808-147302830 TCTGCTGTGGAGGTTAGGGCAGG - Intergenic
940260940 2:151779081-151779103 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
940581246 2:155583965-155583987 CCCTGTGGGGAGGGGAGGGAGGG - Intergenic
941019188 2:160389844-160389866 TCTGGTGGGGAGGGGAGGAGAGG + Intronic
941126461 2:161590173-161590195 CCTGTTGTGGGGGGGTGGGCAGG - Intronic
941651159 2:168094079-168094101 CATGCTGGGGAGGGCTGGGGAGG - Intronic
941818045 2:169817758-169817780 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
942049286 2:172123849-172123871 CCTGCTGGGGAGGGGGGCCGGGG - Intergenic
942198076 2:173542672-173542694 CCTACTGGAGAGTGGAGGGTGGG + Intergenic
942532174 2:176922915-176922937 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
942795089 2:179808142-179808164 GCTGCTGGGGAGGCTAAGGCAGG - Intronic
942901797 2:181129067-181129089 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
943037912 2:182768973-182768995 CCTGTTGGGGAGTTCAGGGCTGG - Intronic
945382903 2:209162766-209162788 CCTGTTGGAGAGTGGAGGGTGGG - Intergenic
945629627 2:212257052-212257074 ACTGCTGGGTGGAGGAGGGCTGG - Intronic
946172319 2:217902719-217902741 CCGGGCGGGGAGGGGAGGGGAGG + Intronic
946238506 2:218340135-218340157 TGTGCAGGTGAGGGGAGGGCAGG + Exonic
946327715 2:218993342-218993364 TCTGCTGGGGTGGGGAAGGGAGG - Exonic
946351856 2:219160569-219160591 CCTCCGGGGGAGGGGTGGGCGGG - Intronic
946409839 2:219510491-219510513 CCTGCGGGGGAGGGCTGGGATGG - Intergenic
947032192 2:225809194-225809216 GCTGAGGGGGTGGGGAGGGCTGG + Intergenic
947091011 2:226511460-226511482 CCTGCTGGAGAGAGAAGGTCAGG + Intergenic
947103826 2:226648283-226648305 CATGGTGGGGTGGGGAGGGGAGG - Intergenic
947138857 2:227002056-227002078 CCTACTGGGGAGGGTGAGGCAGG + Intergenic
947220274 2:227785044-227785066 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
947623357 2:231604682-231604704 CCTGCTGGGCCGGGCCGGGCTGG - Intergenic
947715851 2:232338504-232338526 CCAGATGGGGTGGGGTGGGCTGG - Intronic
947734875 2:232449250-232449272 CCAGATGGGGTGGGGTGGGCTGG - Intergenic
947845900 2:233243563-233243585 CCTGGTGGGGAGAATAGGGCTGG + Intronic
947940426 2:234049692-234049714 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
948263684 2:236622443-236622465 CGTGCTGGGGGTGGGAGGCCTGG + Intergenic
948280157 2:236740772-236740794 CCAGCAGGTGAGGGGAGGGACGG + Intergenic
948373457 2:237505180-237505202 CCTGATGCAGAGTGGAGGGCAGG + Intronic
948462831 2:238138652-238138674 CCTGCAGGGCGGGGCAGGGCTGG - Intergenic
948580764 2:238986113-238986135 CCCACTGGGAAGGGGCGGGCCGG - Intergenic
948580811 2:238986286-238986308 CGTGCGGGGGAGGGGTCGGCTGG + Intergenic
948601579 2:239110801-239110823 CCTGCAGGGGAGAGGAGGGAAGG - Intronic
948635702 2:239334911-239334933 GCTGCTGGGGAGGCTAAGGCAGG + Intronic
948669242 2:239556590-239556612 CCTGTTGGGGAGGTGGGGGGAGG - Intergenic
948674827 2:239591138-239591160 TGTGCTGGGGAGGAGAGGGCAGG - Intergenic
948723438 2:239918021-239918043 CCAGGTGGGGAGAGGAGGCCTGG + Intronic
948726602 2:239938115-239938137 ACTGCTGGGGAGTGGGGTGCTGG - Intronic
948846497 2:240685228-240685250 CCCGCTGGGGAAGGGCGGGGAGG - Intergenic
948847365 2:240689505-240689527 CCCGCTGGGGAAGGGCGGGGAGG + Intergenic
948857149 2:240735496-240735518 GCTCCTGGGGTGGGGTGGGCAGG - Intronic
948862642 2:240760350-240760372 GGTGCAGTGGAGGGGAGGGCAGG - Intronic
948865147 2:240771407-240771429 GCTGCTGGGGAGGGCAGGCCTGG - Intronic
948874493 2:240819680-240819702 ACGGCGGGGGAGGGGAGGGATGG - Intronic
948887888 2:240893064-240893086 AGTACTGGGGAGGGGAGGGGCGG - Intronic
948940535 2:241193487-241193509 CCTGGTGGGGCTGGGAGGGAGGG - Intronic
948953803 2:241272319-241272341 GGAGCGGGGGAGGGGAGGGCCGG + Intronic
948954200 2:241273885-241273907 GTGGCAGGGGAGGGGAGGGCAGG + Intronic
948991747 2:241559100-241559122 CGGGCCGGGGCGGGGAGGGCCGG + Intronic
1168757668 20:327418-327440 GCTTCTGGGGAGGAGGGGGCTGG + Exonic
1168761808 20:354597-354619 CCGGCTGGGGAGGGAGGGGCTGG - Exonic
1168858702 20:1029271-1029293 AGTGCTTGGGAGGGGAGAGCAGG - Intergenic
1168882871 20:1223148-1223170 CCTGCTGGGGGGTGGGGGGAGGG + Intergenic
1168935876 20:1665012-1665034 CCTGCTGGGGAGGTGAGAAGAGG - Intergenic
1169036123 20:2453822-2453844 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1169132390 20:3173042-3173064 TCTGCTGGGGGTGGGAGGGGGGG + Intronic
1169623803 20:7540136-7540158 GCTGGTGGGTGGGGGAGGGCTGG - Intergenic
1170606390 20:17878039-17878061 CTTACTGGGGATGGGAGGGCAGG + Intergenic
1170652921 20:18258907-18258929 GATCCTGGGGAGGGGAGGGTTGG + Intergenic
1170664023 20:18370179-18370201 CCTGTTGTGGGGGGGGGGGCGGG + Intergenic
1170885428 20:20336816-20336838 CACGCTGGGGAGGTGGGGGCTGG - Intronic
1170917514 20:20642041-20642063 CCTGCTTGGGAGAGGAGGACAGG - Intronic
1171206264 20:23283576-23283598 CTTTCTGGGCAAGGGAGGGCAGG + Intergenic
1171232051 20:23494963-23494985 CCTCCTGGAGAATGGAGGGCGGG - Intronic
1171248482 20:23632066-23632088 CCGGCTGCGGAGGGGAGGCAGGG + Intronic
1172023270 20:31930945-31930967 CCTGCTGTGGAGGAGACAGCGGG - Intronic
1172056073 20:32155204-32155226 CTTGCTGGGGAGGGGCTGGAAGG - Intronic
1172108068 20:32528420-32528442 GCTGCTGGAGTGGGGAGGGCAGG - Intronic
1172408097 20:34704185-34704207 CCGGGAGGGGAGGGGAGGGGAGG + Intronic
1172493873 20:35363948-35363970 CGTGCAGGGGCGGGGTGGGCAGG - Intronic
1172598416 20:36166751-36166773 CCTACTGGGGAGGCCAAGGCAGG + Intronic
1172690544 20:36786506-36786528 CCAGCTGGGGTGGGGAGGAGAGG - Exonic
1172750186 20:37245380-37245402 ACTGATGGGGCGGGGAGGGAAGG - Intergenic
1172923527 20:38509368-38509390 CCTGCTGGGACGGGGAGAGCAGG - Intronic
1173001611 20:39109650-39109672 CCAGCTGGGGAGGGGGCTGCTGG - Intergenic
1173001668 20:39109796-39109818 CCAGCTGGGGAGGGGGCTGCCGG - Intergenic
1173226130 20:41163356-41163378 CCTGATGGGGTAGGGAGGGCAGG - Exonic
1173588483 20:44204646-44204668 ACTACTGGCGTGGGGAGGGCAGG - Intronic
1173686912 20:44930415-44930437 GCTGCTGGGGTGGGGAAGGAAGG - Intronic
1173752348 20:45487387-45487409 CCAGCGGGGGTGGTGAGGGCAGG - Intergenic
1173801086 20:45894922-45894944 CCTCCTGGTGAGGTGGGGGCAGG + Intronic
1173851355 20:46220396-46220418 GGGGGTGGGGAGGGGAGGGCAGG + Intronic
1173919143 20:46730996-46731018 CATTCTGGGGTGGGGAGGACTGG - Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174317365 20:49713392-49713414 CCTGTTGGGGTGCGGAGGGCAGG + Intronic
1174371580 20:50092399-50092421 TCTGCTGGGAAGGGGAAGGGAGG + Intronic
1174426318 20:50433991-50434013 CCTGCAGGGGAGGGGAGGGGAGG - Intergenic
1174601673 20:51729936-51729958 GCTGCGGTGGAGGGGAGGCCAGG - Exonic
1174683836 20:52434474-52434496 CCTGCTGTTGAGGGAAGAGCTGG + Intergenic
1175113835 20:56667776-56667798 CATGGAGGGGAGGGGAGGGGAGG + Intergenic
1175116925 20:56689343-56689365 CCAGCTGGGGAGTCCAGGGCTGG + Intergenic
1175216228 20:57392854-57392876 ACTGCTGGGGCGAGGAGGGGGGG - Intronic
1175284535 20:57829106-57829128 CCTGAGGGGCAGGGCAGGGCAGG + Intergenic
1175291520 20:57879042-57879064 CTTGCTGGGGAGGGTCTGGCTGG + Intergenic
1175327995 20:58142903-58142925 GCTGCTGGGGTGTGGAGGCCTGG - Intergenic
1175429570 20:58891858-58891880 GCTGCTGGGTAAGGGCGGGCGGG + Intronic
1175612805 20:60365439-60365461 CCTGCAGGGCAGGGAGGGGCTGG - Intergenic
1175877814 20:62238680-62238702 CGGGGCGGGGAGGGGAGGGCGGG + Intronic
1175937156 20:62519139-62519161 GCGGCTGTGGAGGGCAGGGCAGG - Intergenic
1175940400 20:62535136-62535158 ACTGCTGGGGACGGGGGGGAGGG + Intergenic
1175953383 20:62595810-62595832 CCTGCTGTGGAGGGGCTGGCGGG + Intergenic
1175984307 20:62756290-62756312 GCTGCAGGCGAGGGGATGGCTGG + Intronic
1175995814 20:62811948-62811970 CCTGGTGGGGAGGAGCTGGCTGG - Intronic
1176038012 20:63049724-63049746 CCTGCTGGAGAGGGGAACCCAGG + Intergenic
1176074016 20:63240330-63240352 CCTGCTGAGGATGGCAGAGCTGG + Exonic
1176100231 20:63361368-63361390 CCGGCTGAGGCGGGCAGGGCCGG - Exonic
1176117937 20:63441186-63441208 CCTGCGGGGGAGGTGAGGGCGGG + Intronic
1176166990 20:63679548-63679570 CCAGGTGGGGAGAGGAGGCCTGG - Intronic
1176223173 20:63979550-63979572 CCGGCTGGGGCGGGGCGGGGCGG - Exonic
1176230628 20:64030995-64031017 GCTGCTGGAGAAGGGATGGCGGG - Intronic
1176253458 20:64138161-64138183 TCTGTGGGGGTGGGGAGGGCCGG + Intergenic
1176285491 21:5016916-5016938 CCTGCTGCTGAGAGGAGGGGAGG - Intergenic
1176389945 21:6158289-6158311 CCTTCTGGGGCTGGGAGGTCAGG - Intergenic
1176423404 21:6533401-6533423 CCTCCTGGGGTGGCGAGGGGGGG - Intergenic
1176549257 21:8214431-8214453 GCGGCGGGGGAAGGGAGGGCGGG - Intergenic
1176557150 21:8258654-8258676 GCGGCGGGGGAAGGGAGGGCGGG - Intergenic
1176568189 21:8397469-8397491 GCGGCGGGGGAAGGGAGGGCGGG - Intergenic
1176576092 21:8441689-8441711 GCGGCGGGGGAAGGGAGGGCGGG - Intergenic
1177550521 21:22615039-22615061 GCTGCTGGGGAGGCTAAGGCAGG + Intergenic
1177658553 21:24052048-24052070 CCTGTTGTGGGGTGGAGGGCAGG - Intergenic
1177780289 21:25614965-25614987 GATGGTGGGGAGGGGAGGGAAGG - Intergenic
1178354629 21:31900283-31900305 CCAGCTGGGCAGAGGAGGGCAGG - Intronic
1178404053 21:32310332-32310354 CATGATGGGGGGGGGAGGGGAGG + Intronic
1178425777 21:32477734-32477756 CGTACGGGGGAGGGGAGGGGAGG - Intronic
1178425807 21:32477796-32477818 CGTACGGGGGAGGGGAGGGGAGG - Intronic
1178425835 21:32477858-32477880 CGTACGGGGGAGGGGAGGGGAGG - Intronic
1178437804 21:32575225-32575247 CCTGAAGGGGAGGGGACAGCAGG + Intergenic
1178752909 21:35321344-35321366 CCTCGTGGTGAGGGGAGGGGAGG + Intronic
1178937358 21:36875022-36875044 CCAGTCGGGGAGGGGAGTGCTGG - Intronic
1178961348 21:37068989-37069011 TCTGCAGGGGAGGGCAGGGCAGG + Intronic
1179411689 21:41167865-41167887 CCGGCGAGGGTGGGGAGGGCAGG + Exonic
1179435673 21:41360570-41360592 GCTGCTGGTGAGGGGCGTGCAGG + Intergenic
1179571858 21:42283205-42283227 CCTTCTGAGGGGGGGATGGCGGG + Intronic
1179618143 21:42594960-42594982 CCTGCTGCTGAGGGGATGCCAGG - Intergenic
1179698898 21:43141717-43141739 CCTCCTGGGGTGGCGAGGGGGGG - Intergenic
1179731160 21:43368026-43368048 AGTGCTGGGGAGAGGAGTGCTGG + Intergenic
1179733521 21:43379951-43379973 CCTTCTGGGGCTGGGAGGTCAGG + Intergenic
1179871690 21:44246559-44246581 CCTGCTGCTGAGAGGAGGGGAGG + Exonic
1179874687 21:44261949-44261971 CCCGCGGGGGCGGGGAGGGGCGG + Exonic
1179875317 21:44264025-44264047 CCTGCAGGGCAGGGGAGGTTGGG - Intergenic
1179924657 21:44527894-44527916 GCTGCTGGGGAGGTGAGTGGAGG - Intronic
1179951722 21:44712124-44712146 TCTGCTGTGGTGGGGAGGGGGGG + Intergenic
1180051761 21:45334931-45334953 CCTGCAGGTGAAGGCAGGGCTGG + Intergenic
1180130899 21:45826555-45826577 CCTGGTGGGGAGGACAGGGAAGG - Intronic
1180185156 21:46135743-46135765 AATGCTGGGGAGGGGAGGCTGGG - Intergenic
1180193193 21:46178773-46178795 GCTACTGGGGAGGGCAAGGCAGG + Intronic
1180535866 22:16392308-16392330 CATGCAGGGGAAGGGAGGGCAGG + Intergenic
1180541782 22:16455868-16455890 CCTGTTGGGGGGTGGTGGGCTGG + Intergenic
1180748789 22:18110694-18110716 AGTGCCGGGGAGGGGCGGGCAGG - Intronic
1180782390 22:18528559-18528581 CCTGCTGCGGAGGCGAAGCCAGG + Exonic
1180972949 22:19825058-19825080 CCTGGTGGGCTGGGGTGGGCAGG - Intronic
1181100126 22:20533291-20533313 CCAGCTGGAGAGGAAAGGGCAGG + Intronic
1181109241 22:20591671-20591693 CTGCCTGGAGAGGGGAGGGCTGG + Intergenic
1181111312 22:20604548-20604570 CCTGCAAGGGAGGCGAGGGCAGG + Intergenic
1181239279 22:21467894-21467916 CCTGCTGCGGAGGCGAAGCCAGG + Intergenic
1181427941 22:22856175-22856197 GGTCCTGGGGAGGGGAGAGCTGG + Intronic
1181475393 22:23164893-23164915 CCTGTGGGGGTGGGGTGGGCTGG - Intergenic
1181522624 22:23458372-23458394 GCTGCTGGGCAGGGGTGGGGAGG - Intergenic
1181548481 22:23620189-23620211 GCTGCTTGGGAGGTGAGGGAGGG - Intronic
1181634672 22:24169061-24169083 AGGGCTGGGGAGGGGGGGGCGGG + Intronic
1181639889 22:24190873-24190895 CCTGCTGGAAAGGGGAGGTGGGG - Intergenic
1181719221 22:24761085-24761107 CATGCTGGGGAGGGCAGGTTGGG + Intronic
1181778830 22:25178503-25178525 CCTGGTGGGGAGGGGCGGCGGGG + Intronic
1181808636 22:25390449-25390471 CCTGCTAGGGCGGGCAGGGATGG + Intronic
1181984251 22:26788410-26788432 CCTGTTGGGGAAGGGCGGGGTGG - Intergenic
1182115549 22:27754391-27754413 CCTGCTGGGGTGGGGAGAAGGGG - Intronic
1182146207 22:27998438-27998460 GGGGTTGGGGAGGGGAGGGCAGG - Intronic
1182438254 22:30345237-30345259 GCTCCAGGGGAGGGGAGGGGAGG + Intronic
1182446454 22:30392569-30392591 CCCAGAGGGGAGGGGAGGGCCGG - Intronic
1182522564 22:30892595-30892617 CCAGCAAGGCAGGGGAGGGCCGG + Intronic
1182697320 22:32205977-32205999 CCTGCGGTGGAGGGGTGGGTTGG + Intergenic
1182808576 22:33096674-33096696 CCTGCTCGGGAGGCGGAGGCAGG - Intergenic
1183025205 22:35060032-35060054 CCTGCTTGAGAGTGGAGGGTAGG + Intergenic
1183056202 22:35307656-35307678 CCTGCTGGGGAAGGTAGAGAAGG + Intronic
1183231997 22:36588322-36588344 CCTGCTGGGAAGGTGAGAACTGG + Intronic
1183279064 22:36922571-36922593 TCTGCTGGGGAAGGAGGGGCAGG - Intronic
1183303352 22:37069341-37069363 CATGCTGGGGTGGGGTGGGGTGG + Exonic
1183358784 22:37372770-37372792 TCTGCTGGGGTGTGCAGGGCCGG - Exonic
1183377882 22:37475667-37475689 CAGGCTGGGGAGGGGAGTACAGG - Intronic
1183377889 22:37475686-37475708 CAGGCTGGGGAGGGGAGTGCAGG - Intronic
1183377896 22:37475705-37475727 CAGGCTGGGGAGGGGAGTGCAGG - Intronic
1183452864 22:37906283-37906305 CCGGCAGGCGAGGGGAGGGGCGG - Exonic
1183545977 22:38455116-38455138 GCAGCCGGGGAGGGGAGCGCGGG - Exonic
1183665081 22:39242432-39242454 GCTGTTGGGGAGGGGGTGGCCGG - Intronic
1183767594 22:39893461-39893483 CCGGCAGTGGAGGGGAAGGCTGG + Intronic
1184028817 22:41878771-41878793 CTTGCAGAGGTGGGGAGGGCAGG - Intronic
1184034671 22:41912833-41912855 CCTGCTGGGGATGGGGCAGCAGG - Intronic
1184111768 22:42399664-42399686 CCTGCTGGGAAGGTGAAGGCTGG + Intronic
1184207508 22:43014688-43014710 CCTGCTGGAGAGGGAAGTGCAGG - Intronic
1184301708 22:43564638-43564660 CTGGCTAGAGAGGGGAGGGCAGG + Intronic
1184597908 22:45525521-45525543 CCTGTGGGTGAGGGGTGGGCTGG - Exonic
1184598331 22:45527583-45527605 CATGTTGGGGTGGGGAGGGGAGG + Intronic
1184598997 22:45531716-45531738 CTGGCTGGGGAGGGGAAGGGTGG + Intronic
1184599016 22:45531767-45531789 CCTGCTGGGGAGGGTGGCCCAGG + Intronic
1184599118 22:45532258-45532280 CTTTCTGGGGAGGGGAGAGCTGG + Intronic
1184648293 22:45907970-45907992 CCCGCAGGGGAGGGGAGCTCTGG - Intergenic
1184650844 22:45918900-45918922 CCTGCAGGGCAGGGGTGGCCAGG + Intergenic
1184770444 22:46594104-46594126 GATGCTGGGGAGGGGCTGGCAGG - Intronic
1184770460 22:46594148-46594170 GCAGCTGGGGAGGGGCTGGCGGG - Intronic
1184777825 22:46632143-46632165 CCTGCTTGGGAGGGGAAGGTTGG + Intronic
1184836994 22:47029644-47029666 GCTTCTGGGGCGGGGATGGCAGG + Intronic
1184857919 22:47156599-47156621 CAGGCTGGGGAGGTGAGGGTGGG + Intronic
1184941212 22:47766853-47766875 GCTGCTGGGGAGGGTGAGGCAGG - Intergenic
1185115440 22:48932319-48932341 CCTGTTGGAGGGGGGAGGGTAGG - Intergenic
1185169308 22:49283167-49283189 CCTGGTGGGCAGAGGAGGCCAGG + Intergenic
1185172003 22:49299632-49299654 GTGTCTGGGGAGGGGAGGGCAGG - Intergenic
1185172280 22:49301111-49301133 GGGGCTGGGGAGGGCAGGGCAGG + Intergenic
1185223138 22:49639252-49639274 GCTCCTGGGGAGGGAGGGGCAGG + Intronic
1185274259 22:49943625-49943647 CCTGCAGGGGCCTGGAGGGCTGG - Intergenic
1185278102 22:49958502-49958524 CCTGGAGTGGAGGGCAGGGCAGG - Intergenic
1185279686 22:49964749-49964771 CCTGGTGGGTAGAGGAGGCCTGG + Intergenic
1185316691 22:50182403-50182425 GCTGCTGGGGCAGGGAGGACAGG - Intergenic
1185335848 22:50270535-50270557 CCCCCCGGGAAGGGGAGGGCTGG - Intronic
1185367145 22:50441888-50441910 CCTGAGGGGGAGGGTAGGACTGG + Intronic
1185367584 22:50443996-50444018 ACTGCTGGGGTGGGTATGGCGGG - Exonic
1185378583 22:50495447-50495469 GCTGCTGGGGAGGGTGAGGCAGG - Intergenic
1203254142 22_KI270733v1_random:130747-130769 GCGGCGGGGGAAGGGAGGGCGGG - Intergenic
1203262198 22_KI270733v1_random:175826-175848 GCGGCGGGGGAAGGGAGGGCGGG - Intergenic
949287477 3:2423926-2423948 CCTGCTGTGGGGTGGAGGGAGGG + Intronic
949321186 3:2812116-2812138 CCTGTTAGAGAGTGGAGGGCGGG + Intronic
949936609 3:9120945-9120967 CCAGGTGGGGAGGGAATGGCTGG + Intronic
949961288 3:9314633-9314655 CAGGGTGGGGAGAGGAGGGCAGG - Intronic
950004303 3:9681862-9681884 CAGGCTGGGGAGGGCTGGGCTGG - Intronic
950005636 3:9689320-9689342 GCAGCTGGGCAGGGTAGGGCAGG + Intronic
950193618 3:10993961-10993983 GCTGGGGGGGCGGGGAGGGCGGG + Intronic
950487065 3:13280163-13280185 CCGGCTGGGAAGTGCAGGGCTGG + Intergenic
950673406 3:14540365-14540387 CTCCCTGGGGAGGGGAGGGAGGG - Exonic
950972038 3:17198695-17198717 CGTTCTGGGAAGGGCAGGGCAGG + Intronic
951479110 3:23140933-23140955 CCTGTTGGGGAGGTGGGGGCTGG + Intergenic
951686602 3:25351210-25351232 CTTGATGGAGAGGGGCGGGCAGG + Intronic
952425842 3:33173897-33173919 CCTGTTGGGGTGGGGAGGCCAGG + Intronic
952436582 3:33277646-33277668 GCTGCTGGGCAGGGCAGGGCTGG + Intronic
952728353 3:36613407-36613429 GCTGCTGGTGGGGCGAGGGCAGG - Intergenic
952816580 3:37452365-37452387 CCGGCTGGGGATGGGCGGCCCGG + Exonic
952881245 3:37987340-37987362 CCTGCTAGGGGGAGGAGGGAGGG + Intergenic
953080741 3:39615146-39615168 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
953446082 3:42968710-42968732 CTTTCTGGGGAGGGCAGGGCAGG + Intronic
954197053 3:49003104-49003126 ACTGCTGGGGAGGGGTGGGCAGG + Intronic
954340005 3:49945768-49945790 GCTGCTGGGGAGGCTGGGGCAGG + Intronic
954411618 3:50373626-50373648 GGTGCTGGGGTGGGGAGAGCGGG + Intronic
954640357 3:52094082-52094104 CCTGTGGGGGAGGGAAGGGATGG + Intronic
954882687 3:53846393-53846415 CCTGCTGGGGCTCGGAGGGATGG - Intergenic
955729753 3:61972478-61972500 ACTGAAGGGGAGGGGAGGGTGGG + Intronic
955950653 3:64239235-64239257 CCTGCTGGGGGGCGGGGGGCTGG + Intronic
956113729 3:65897461-65897483 CCTGCTGTGGGGTGGGGGGCAGG + Intronic
956208275 3:66776589-66776611 CGTGTAGGGGAGGGGTGGGCAGG - Intergenic
956396036 3:68827033-68827055 CCTGTTGGGGGGTGGGGGGCTGG - Intronic
956452069 3:69385244-69385266 CAGGCTGGGGAAGGGAGGGGTGG - Intronic
956933236 3:74070342-74070364 CCTACTTGGGAGTGGAGGGTGGG + Intergenic
957784218 3:84860359-84860381 CCTCCTGAGGAGGGGAGAGCTGG - Intergenic
957899857 3:86475099-86475121 CCTGTTGGGGGGTGGGGGGCAGG + Intergenic
958063769 3:88516971-88516993 CCTGCTTGAGGGTGGAGGGCAGG - Intergenic
958259686 3:91366264-91366286 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
958862283 3:99458384-99458406 CCTGCAGGGGAGAGGAGGAGGGG + Intergenic
958866334 3:99505952-99505974 TCTGCTTTGGAGGGGAGGGTTGG - Intergenic
959041553 3:101427844-101427866 CCTGTTGGGGAGTGGGGGGCTGG - Intronic
959062211 3:101625995-101626017 CCTCCTGGGGAGGTAGGGGCTGG - Intergenic
959215835 3:103448903-103448925 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
959765374 3:110020735-110020757 CCTGTTGGGGAGGGTGGGGGTGG + Intergenic
959787377 3:110316766-110316788 ACTGAGGGGGAGGGGAGGGGAGG + Intergenic
960081897 3:113550912-113550934 CCTGCTGGAGGGTGGAGGGTGGG - Intronic
960146648 3:114210891-114210913 CCTGTTGAGGGGTGGAGGGCTGG + Intergenic
960197404 3:114786290-114786312 CCTGTTGGGGAGTGGGGGTCTGG - Intronic
960719832 3:120615262-120615284 CCTGCTGGTGAGTGGGGGGCTGG - Intergenic
960907974 3:122620718-122620740 GCTGCCTGGGAGGGGAGGGTGGG + Intronic
961044394 3:123698849-123698871 TCTGCTTGTGAGGGGAAGGCAGG + Intronic
961111516 3:124287983-124288005 CCTGCTGGGGAGGCTAAGGCAGG - Intronic
961388373 3:126537283-126537305 CCTGGCGGGGAGTGGAGGACAGG + Intronic
961393158 3:126568652-126568674 GCTGCTGGGGAGGAGGGGTCAGG + Intergenic
961574011 3:127820321-127820343 CCCGCAGGCGAAGGGAGGGCAGG + Intronic
961596447 3:128021918-128021940 CTTGCAGGGCAGGGCAGGGCAGG - Intergenic
962006757 3:131357243-131357265 GCTACTGGGGAGGGCAAGGCAGG + Intergenic
962211485 3:133482845-133482867 CCTGTTGGGGTGGGGGGCGCTGG + Intergenic
962250136 3:133830970-133830992 CCCTGTGGGGAGGGGAGGGAAGG + Intronic
962250559 3:133833553-133833575 GCTGCTGGGGCAGGGCGGGCAGG - Intronic
962265126 3:133939290-133939312 CCAGCTGGGGAGTGGAGAGAGGG + Intronic
962389938 3:134962834-134962856 GCTGCTGGGGAAGGGGTGGCAGG - Intronic
962713840 3:138110294-138110316 CCTGTTGGGGGATGGAGGGCTGG + Intronic
962865699 3:139446656-139446678 CCTGCTGGGGCGGAGTGGGTGGG - Intergenic
963069925 3:141295688-141295710 CCTGTTGTGGAGTGGGGGGCTGG - Intergenic
963597644 3:147347720-147347742 CCTACTTGGGAGGCTAGGGCAGG + Intergenic
963730062 3:148962659-148962681 CCTCCTGGGTAGAGGAGGGGAGG - Intergenic
963823077 3:149921449-149921471 CCTGTTGGGGGGTGGAGGGCTGG - Intronic
964041687 3:152268839-152268861 CCTGGTGGGGCTGGGCGGGCGGG + Exonic
964044439 3:152306256-152306278 AATGCTGGGGAGGGTAGGGGAGG - Intronic
964111135 3:153088967-153088989 CCTGTTGGGGAGTCGGGGGCTGG - Intergenic
964118848 3:153162172-153162194 CTCGCCGGGGAGGGGCGGGCCGG + Intergenic
964790464 3:160449804-160449826 CCTTCGGGGCAGAGGAGGGCGGG - Exonic
965520200 3:169662945-169662967 CCTGGGGGGAAGGGGAGGGGAGG + Intronic
965592046 3:170370440-170370462 CCTGCTCGGGGGGGGGGGGGGGG - Intronic
966402651 3:179563183-179563205 AACGCCGGGGAGGGGAGGGCTGG - Intronic
966712091 3:182980968-182980990 ACTGATGGGGAGGGGAGGTCTGG - Intronic
966715734 3:183011388-183011410 ACAGCTGGGGAAGGGAGGGTAGG + Intergenic
966744177 3:183260016-183260038 TCTCATCGGGAGGGGAGGGCAGG - Intronic
966809751 3:183833134-183833156 CAGGCAGGGGAGAGGAGGGCAGG + Intronic
966816649 3:183895404-183895426 CCTTCTGGTCAGGAGAGGGCAGG + Intergenic
966834360 3:184037999-184038021 CCTGGTGGGGAGGAGAAGGAGGG - Exonic
966933541 3:184691185-184691207 CCTGCTCGTCAGGAGAGGGCTGG + Intergenic
967269897 3:187724888-187724910 CCTGCGGGGATGTGGAGGGCAGG - Intronic
967314091 3:188134460-188134482 CCTACTGGAGAGTGGAGGGTGGG + Intergenic
967434128 3:189424972-189424994 CCTCCTTGGGACTGGAGGGCTGG + Intergenic
967579483 3:191135783-191135805 GCTGCTGGGGAGGCTAAGGCAGG - Intergenic
967715019 3:192752750-192752772 CCTGCTGGGGGTGGGAGGCAAGG + Intronic
967859978 3:194143078-194143100 GCTGCTGGGGAGGCTAAGGCAGG + Intergenic
968083961 3:195866310-195866332 CCTGCTGGGGAGGCTGAGGCAGG - Intronic
968092974 3:195909601-195909623 CCGGGGCGGGAGGGGAGGGCCGG - Intronic
968133110 3:196203668-196203690 CATTCTGGGCAGGGGAGGGAGGG + Intronic
968161767 3:196432504-196432526 ACCGCTGGGGACGGGAGGGGCGG - Intergenic
968178570 3:196572414-196572436 CCTGGTGGAGAGGTGAGGGAAGG + Intronic
968260003 3:197313643-197313665 CCTACTGGAGAGTGGAGGGTGGG - Intergenic
968456678 4:704033-704055 CCAGATGTGGAGGGGAGGACTGG - Intergenic
968489515 4:882498-882520 CCACATGGGGAGGGAAGGGCGGG + Intronic
968506365 4:973105-973127 CTTTCGGGGGAGTGGAGGGCGGG - Intronic
968602564 4:1517262-1517284 GCTGCTGGTGGGCGGAGGGCTGG - Intergenic
968700939 4:2058272-2058294 CCTGGTGGGGTGGGGAGGGGCGG - Intergenic
968742804 4:2339918-2339940 AGGGCAGGGGAGGGGAGGGCAGG + Intronic
968775758 4:2538667-2538689 GCTGTCGGGTAGGGGAGGGCGGG + Intronic
968817895 4:2831252-2831274 GCTCGTGGGGAGGGGAGGTCCGG - Intronic
968861260 4:3172561-3172583 CCTCCTGGGGAGTGAAGGGAAGG - Intronic
968916615 4:3499582-3499604 GGTGCTGGGGAGGGCAGAGCAGG - Intronic
968939594 4:3631053-3631075 CCTCCTGGGGTGGGGTGGGAGGG + Intergenic
968963620 4:3758268-3758290 CCGGCTGAGGCGGGGAGGGGCGG + Intergenic
969048934 4:4358891-4358913 GCTGCTGGGGGGGTGTGGGCTGG - Intronic
969061398 4:4438131-4438153 CCTGCTGGAGGGGTGAGGCCGGG - Intronic
969098204 4:4750270-4750292 GCCGCAGGGGAGGGGAGGACTGG - Intergenic
969240409 4:5893204-5893226 GCGGCTGGGGCGGGGAGGGACGG + Intergenic
969264461 4:6055819-6055841 CCTGCAGAGATGGGGAGGGCTGG - Intronic
969264504 4:6055983-6056005 CCTGCAGAGATGGGGAGGGCTGG - Intronic
969345026 4:6564694-6564716 CCTTCCTGGGAGGGGAGGGTAGG - Intergenic
969348933 4:6586955-6586977 CCTGCTGGTGCCTGGAGGGCGGG - Intronic
969524664 4:7698078-7698100 CCTCCTGGGGTGGGGAGCCCAGG - Intronic
969525871 4:7703741-7703763 CGTCGTGGGGAAGGGAGGGCAGG + Intronic
969581096 4:8065967-8065989 AATGGAGGGGAGGGGAGGGCAGG + Intronic
969676645 4:8618075-8618097 CCCGCTGGGGCTGGGAAGGCAGG + Intronic
969690509 4:8701614-8701636 CCTGCAGGGGGTGGGAGAGCTGG - Intergenic
970195192 4:13544867-13544889 CCAGCAGGGAAGGGGAGGACGGG - Exonic
970758672 4:19456387-19456409 GCTGCTGGGGAGGTGACGGGAGG + Intergenic
970797537 4:19931452-19931474 CCTGCTTGAGAGTGGAGGGTAGG + Intergenic
971775677 4:30961438-30961460 CCTACTGGGGAGGCTAAGGCAGG + Intronic
972371116 4:38424327-38424349 GCTGCTGGGGACAGGAGGGAGGG + Intergenic
973719391 4:53707788-53707810 CCGGCTGGGGAGGGGTGGGGTGG + Intronic
973848489 4:54937287-54937309 CCTGCTGGGAAGTGGCAGGCTGG + Intergenic
974192391 4:58523040-58523062 AGTGCAGGGGAGGGGAGGGGAGG - Intergenic
974807091 4:66894583-66894605 CCTCTTTGGGAGGGGAGGCCTGG - Intergenic
974854386 4:67441893-67441915 CCTGTTGGGGGGTGGGGGGCAGG + Intergenic
975525264 4:75341843-75341865 CCTGTTGGGGGGTGGAGGGCTGG - Intergenic
975640595 4:76496201-76496223 GCTTCTGGGGTGAGGAGGGCAGG + Intronic
975950201 4:79761410-79761432 CCTGCTGGGGGGTGGGGGGAGGG - Intergenic
976220665 4:82754519-82754541 GCTGCTGGTGAGGGGAGGGTGGG - Intronic
976806067 4:89048454-89048476 CCTGTGGGGGTGGGGAGGGATGG + Intronic
977049846 4:92116108-92116130 CCTGTTGGGGGGTGGAGGGAGGG - Intergenic
977195063 4:94047939-94047961 CCTGTTGGGGGGTGGAGGGCTGG + Intergenic
977947260 4:102928069-102928091 CCTGTCGGGGGGTGGAGGGCTGG + Intronic
978056654 4:104277412-104277434 ACTGGAGGGGAGGGGAGGGAAGG + Intergenic
978147340 4:105391178-105391200 CCTGCTGGTGGGGGGAGGGGAGG + Intronic
978629713 4:110730325-110730347 CCTGTCGGGGTGGGGAGGGGAGG - Intergenic
979786324 4:124719163-124719185 TATGCTGGGGAGGGGAGGGGAGG + Intergenic
980002635 4:127508341-127508363 CCTGCTGTGGTGTGGAGAGCTGG - Intergenic
980100763 4:128539259-128539281 AGTGCTGGGTAGAGGAGGGCGGG - Intergenic
980455006 4:133028029-133028051 ACTACTGGAGAGGGGAGGGTGGG + Intergenic
980970308 4:139561026-139561048 CTTTCTGGGGCGGGGAGGGGAGG + Intronic
981429821 4:144645971-144645993 CCTGCTGCGGCGGGGAGGGGCGG - Intergenic
981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG + Intronic
982024161 4:151235187-151235209 CCTACTGGAGGGTGGAGGGCGGG - Intronic
982421946 4:155208682-155208704 CCTGCAGGGGAGGGGACTGGAGG - Exonic
982841765 4:160196585-160196607 GCTGCTGGGGAGGCTAAGGCAGG - Intergenic
984107173 4:175562701-175562723 CTTGCTGGTGAAGGGAGTGCTGG + Intergenic
984793605 4:183636903-183636925 ACTGTTGGGGAGTGGAGGGGGGG - Intergenic
984947764 4:184983243-184983265 CCTGCGGCAGAGTGGAGGGCAGG - Intergenic
985011574 4:185587967-185587989 CCTGCTGAGGAGGGGGGCGGAGG + Intronic
985379291 4:189375153-189375175 CCTGCTTGAGAGTGGAGGGTGGG - Intergenic
985529266 5:424236-424258 TCTGGTGGGGGGGCGAGGGCCGG + Intronic
985529306 5:424385-424407 CCTGGTGGGGGGGCGAGGGCCGG + Intronic
985580667 5:693755-693777 CCTCCTGGGGTGGGGTGGGTTGG + Intergenic
985595203 5:784816-784838 CCTGGTGGGGCGGCGGGGGCGGG - Intergenic
985595291 5:785087-785109 CCTCCTGGGGTGGGGTGGGTTGG + Intergenic
985709840 5:1422094-1422116 CCTGCTGAGATGGGGAGGGCAGG - Intronic
985776921 5:1849156-1849178 CCTGCTGGGCTGGGGTGTGCTGG + Intergenic
986710143 5:10482656-10482678 CCTGGTGGGAAGGGGAGGGATGG + Intergenic
986783226 5:11085984-11086006 CTTGCTGGGCTGGGGAGGGCTGG + Intronic
987213374 5:15707681-15707703 CCTGCAGAGGATAGGAGGGCAGG + Intronic
987320931 5:16768785-16768807 GCTGCTTGGGAGGAGAGGGTGGG - Intronic
987358254 5:17083684-17083706 CCCGCGGGGAAGGGGAGGGGAGG + Intronic
987427005 5:17785002-17785024 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
987912761 5:24170169-24170191 CCCGCTGCCGAGGGCAGGGCAGG + Intronic
988055449 5:26088420-26088442 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
988724698 5:33914849-33914871 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
989056312 5:37369138-37369160 GCTACTGGGGAGGGCAAGGCGGG + Intronic
989572453 5:42957224-42957246 GCTGCTGGGGAGGCTAAGGCAGG + Intergenic
989774086 5:45181982-45182004 CCTGGTGGGAAGGTGGGGGCTGG - Intergenic
990075580 5:51842927-51842949 CCTGCGGGGGGGGGGGGGGGGGG - Intergenic
992038122 5:72802122-72802144 AGTGCTGGGAAGGGAAGGGCAGG + Intergenic
992491297 5:77247305-77247327 CCTGCTGCGGAACAGAGGGCAGG - Intronic
992680987 5:79152904-79152926 GCTACTGGGGAGGTGAAGGCAGG + Intronic
992744049 5:79801925-79801947 CTCACTGGGGAGTGGAGGGCTGG - Intergenic
992995334 5:82327243-82327265 ACTGCAGGGGAGGGGAGTGAGGG - Intronic
993345038 5:86772466-86772488 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
993985195 5:94589013-94589035 CCTGTTGGCGGGTGGAGGGCTGG + Intronic
994388838 5:99165384-99165406 CCTGCTGGGGGGTGGGGGGATGG - Intergenic
994535969 5:101029793-101029815 CCTACTTGAGAGGGGAGGGTGGG + Intergenic
994591514 5:101779151-101779173 ACTACTGGAGAGGGGAGGGAGGG + Intergenic
994621383 5:102166944-102166966 CCTGCTGTGGGGTGGAGGGAGGG + Intergenic
994748655 5:103710915-103710937 CCTCCTGGGGAGTGTAGGCCTGG + Intergenic
994830971 5:104783611-104783633 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
994956109 5:106535176-106535198 CCTACTTGGGAGTGGAGGGTGGG - Intergenic
996392173 5:122973517-122973539 CAGGCTGGGGAGGAGAAGGCTGG + Intronic
996457251 5:123698965-123698987 CCTGTCAGGGAGGTGAGGGCAGG - Intergenic
996681575 5:126233161-126233183 TCTACTGGAGAGGGGAGGGTAGG + Intergenic
997212662 5:132086582-132086604 TGTGCTGGGGAAGGGAGGCCAGG + Intergenic
997298651 5:132786000-132786022 CCTGCTGGGGTGGGGAGCAGGGG + Intronic
997590298 5:135068108-135068130 GCTGCAGGGCAGGGAAGGGCAGG + Intronic
997811450 5:136974396-136974418 CTGGCTGGGGAGGGGAGGGAAGG + Intergenic
998003043 5:138639685-138639707 CCTGGTAGGGAGGGGGGAGCAGG - Intronic
998018936 5:138753690-138753712 CCTGCGGGGGAAGGGACCGCCGG - Intronic
998093118 5:139382418-139382440 CCTGCTGGCCAGGGAGGGGCTGG + Intronic
998106215 5:139471062-139471084 CCAGCTGGGTAAAGGAGGGCTGG - Intergenic
998211917 5:140206081-140206103 CCTGGTGAGGAAGGGAGGGAAGG - Intronic
998296712 5:140977316-140977338 CCTGATGGCGAGGGGAGAGACGG + Intronic
999271736 5:150300678-150300700 GCTGCAGGGTGGGGGAGGGCAGG + Intronic
999480590 5:151944677-151944699 CCTGTTGGGGAGTGAGGGGCTGG - Intergenic
999825956 5:155274105-155274127 CCCTCTGGGGAGGGGCAGGCGGG - Intergenic
999949558 5:156634256-156634278 CCTGTTGGGGTGGGGTGGGAGGG + Intronic
1000105514 5:158055317-158055339 ACAGCTGGGAAGGGCAGGGCTGG - Intergenic
1000303022 5:159972534-159972556 CGTGGGGGGGAGGGGAGGGCGGG + Exonic
1000336485 5:160245248-160245270 GCTGCTGGGGAGCCGAAGGCAGG + Intergenic
1000532759 5:162444402-162444424 GGTGCTGGGAAGGGAAGGGCAGG + Intergenic
1001037908 5:168311167-168311189 GCTGCCTGGGAGGGGAGGGGAGG - Intronic
1001064446 5:168525106-168525128 GCTGCTGGGGAGGGTGAGGCAGG - Intergenic
1001191551 5:169637203-169637225 CCGGCGAGGGAGGAGAGGGCGGG + Intergenic
1001308480 5:170593708-170593730 CCGGCTGGGCAGGGCGGGGCTGG + Intronic
1001482231 5:172096346-172096368 CCTGCTGGTGTGGGAGGGGCAGG - Intronic
1001565239 5:172695800-172695822 CCTGCTTAGGAGGGCTGGGCCGG + Intergenic
1001597256 5:172906250-172906272 CCTGATGCTGAGGAGAGGGCTGG + Intronic
1001630116 5:173168665-173168687 CCTGGGGGTGAGGGGAGGGGTGG + Intergenic
1001707291 5:173750768-173750790 TCTGCATGGGATGGGAGGGCTGG - Intergenic
1001768188 5:174271521-174271543 CCAGCTGGGGTGGGTGGGGCTGG + Intergenic
1001871443 5:175159617-175159639 CATGATGGGGAGTGGAGGGGTGG + Intergenic
1001954225 5:175837327-175837349 CCAGGTGAAGAGGGGAGGGCGGG - Intronic
1002188617 5:177467668-177467690 CGTGCTGGGGTGGGGATGGCGGG - Intronic
1002273198 5:178086426-178086448 CGTGCTGGGGAAGAGAGGCCCGG - Intergenic
1002299501 5:178249250-178249272 CCTGCTGGGGGGAGAAGGGAGGG - Intronic
1002313374 5:178328110-178328132 CCTGCCTGGGTGCGGAGGGCAGG + Intronic
1002508161 5:179695159-179695181 GCTGCTGGGGAGGCTGGGGCAGG - Intronic
1002575429 5:180171281-180171303 GTTTCTGGGGAAGGGAGGGCAGG + Intronic
1002576338 5:180176249-180176271 CCTGCAGGAGTGGGGAGGCCTGG - Intronic
1002581198 5:180210239-180210261 CTGGCTGGCGAGGGGTGGGCGGG + Intergenic
1002603807 5:180370332-180370354 GCTGCTGGGGAGGGGAGGGAGGG + Intergenic
1002696961 5:181098290-181098312 ACTGGAGGGGAGGGGAGGGGAGG + Intergenic
1002697146 5:181098660-181098682 AGGGGTGGGGAGGGGAGGGCAGG + Intergenic
1002697570 5:181100909-181100931 AGGGGTGGGGAGGGGAGGGCAGG - Intergenic
1002697646 5:181101049-181101071 AGGGGTGGGGAGGGGAGGGCAGG - Intergenic
1002737063 5:181401469-181401491 CCTGGTGGGGAGTGAGGGGCAGG - Intergenic
1002747634 6:73310-73332 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
1002816434 6:685430-685452 CCTGCTGGGCTGGGTTGGGCTGG + Intronic
1003014348 6:2455994-2456016 CCTGCTGGAGAGAGCAGGGCAGG + Intergenic
1003065689 6:2902281-2902303 CGTGCTGGGGAGGGTCGCGCCGG - Intronic
1003086446 6:3064638-3064660 CGTGCTGGGGAGGGTCGCGCCGG + Intronic
1003513638 6:6801670-6801692 GCTGCTGGTGAGGGGTGGTCAGG - Intergenic
1003764557 6:9220447-9220469 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1004228925 6:13814004-13814026 CCTGCAGGAGAGGTGAGGCCCGG - Exonic
1005291137 6:24380033-24380055 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1005995795 6:30930686-30930708 AGTGCTGGGGAGGAGAGGCCAGG - Intergenic
1006028580 6:31162798-31162820 CCTCCTGGGGAGGGAAGGGAAGG - Exonic
1006084773 6:31587865-31587887 CCTGCTGGTGGGGGGAGCCCGGG + Intronic
1006088657 6:31615165-31615187 CCTGATGGGGAAGTGAGGTCTGG + Exonic
1006101537 6:31688968-31688990 CTTCCTGGGAAGGGGTGGGCTGG - Intronic
1006337365 6:33427752-33427774 CCTGCTCAGGAGGGGATGGTGGG + Intronic
1006405923 6:33844774-33844796 CCTACTGGGAAGGGGCAGGCTGG + Intergenic
1006417051 6:33910866-33910888 GCAGGTAGGGAGGGGAGGGCAGG - Intergenic
1006503042 6:34470035-34470057 CCTGGAGGGGAGGGCTGGGCTGG + Intronic
1006638107 6:35474668-35474690 CATGATGGGCAGGTGAGGGCAGG - Exonic
1006641999 6:35494451-35494473 CCAGGAGGGGAGGGGAGGGAAGG + Intronic
1006642376 6:35496077-35496099 CCTGCTAGGGGAGGGAGGGCTGG - Intronic
1006762780 6:36477981-36478003 ACTGCTGGGGAGGCTAAGGCAGG + Intronic
1006830838 6:36967317-36967339 CATGCAGGGGTGGGCAGGGCAGG - Intergenic
1006891533 6:37433337-37433359 GCTGCCGGGGAGCGGAGGGGGGG - Exonic
1006897427 6:37479994-37480016 AATGCTGGGGAGGAGAGGGATGG - Exonic
1006898462 6:37485060-37485082 CCTGATGGGGAAGGGTGGGGTGG + Intronic
1006929690 6:37680267-37680289 CCTGATGGGGAGGGCAAGGTGGG + Intronic
1006936641 6:37723348-37723370 CTCTCTGGGGAGGGGAGGGCTGG + Intergenic
1007100221 6:39240844-39240866 CCAGCTGGAGATGGGAGAGCAGG - Intergenic
1007154143 6:39725501-39725523 GGGGCTAGGGAGGGGAGGGCGGG + Intergenic
1007175516 6:39893911-39893933 CCTGCTGGGGATAGGAGGGCAGG - Intronic
1007282744 6:40724300-40724322 CCAGCGGGGCAGGGAAGGGCAGG - Intergenic
1007334802 6:41148044-41148066 CCTGCTGGGGAGTGGAGAGGTGG - Intergenic
1007393732 6:41565487-41565509 CGTGCTGGGGTGGGGAAGGGAGG - Intronic
1007431726 6:41780654-41780676 CCAGCCGGGGAGGGGCGGGCGGG + Intronic
1007557977 6:42782639-42782661 GGTGGTGGGGAGGGGAGGGGAGG + Intronic
1007702227 6:43771934-43771956 CCGGCCGGGCGGGGGAGGGCGGG - Intronic
1007743734 6:44029490-44029512 GGTTCTAGGGAGGGGAGGGCAGG + Intergenic
1007748786 6:44059265-44059287 CCTGTCTGGGAGGAGAGGGCAGG - Intergenic
1007765876 6:44159392-44159414 GCTGGGGGGAAGGGGAGGGCTGG + Intronic
1007807012 6:44457985-44458007 GCAGGTGGGGAGGGGAGGTCAGG + Intergenic
1007825763 6:44599509-44599531 CCTACTGGGGAGGCTAAGGCAGG + Intergenic
1007927803 6:45663780-45663802 GCTGCTGGGGAGGGACAGGCAGG - Intronic
1008888502 6:56457755-56457777 CCTCTTGAAGAGGGGAGGGCAGG + Intergenic
1008960175 6:57258587-57258609 CCTGCAGTGGAGGGGTGGGTGGG - Intergenic
1008995549 6:57654099-57654121 CCTGTTGGGGAGTGGGGGGCTGG + Intergenic
1009446961 6:63754340-63754362 CCTGTTGTGGAGTGGGGGGCTGG - Intronic
1010001681 6:70955800-70955822 CCCGCTGGGTGGGCGAGGGCGGG - Intronic
1010191058 6:73197123-73197145 CCTGTTGGGGAGGGCTGGGGAGG - Exonic
1010343604 6:74786088-74786110 CCTGTTGGGGAGTGGGGGTCTGG - Intergenic
1010888013 6:81268251-81268273 CCTGTAGGGGAGTGGAGGACTGG - Intergenic
1011105289 6:83773017-83773039 CCTGTTGGGGAGTTGGGGGCAGG - Intergenic
1011271573 6:85585229-85585251 CCTGCTGGGGAGTGGGGGACTGG + Intronic
1011418300 6:87145594-87145616 CCTGTTGTGGGGTGGAGGGCAGG + Intergenic
1011448273 6:87466483-87466505 CCTGCTGGGGAGGTGAGAATAGG - Intronic
1012276595 6:97282553-97282575 CCTGTTGGGGGGGGGGGGGTGGG + Exonic
1012349584 6:98233885-98233907 CCTGTTGGGGTGTAGAGGGCTGG - Intergenic
1012373850 6:98537607-98537629 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1012381603 6:98626356-98626378 CGTGGTGGGGGGGGCAGGGCTGG - Intergenic
1012393745 6:98772021-98772043 CCTGATTGGCAGGTGAGGGCAGG - Intergenic
1012598664 6:101069098-101069120 CCTGTTGGGGTGTGGGGGGCTGG + Intergenic
1012687367 6:102268577-102268599 CCTGTTGGGGACGGGAGGATAGG + Intergenic
1013117748 6:107115381-107115403 GCTGAGGGGGAGGGGCGGGCCGG - Intergenic
1013284437 6:108668702-108668724 CCAGATGGAGAGGGGAGGGGTGG + Intronic
1013359612 6:109382158-109382180 TCGGCTGGGCAGGGGAGGGCGGG + Intronic
1013455190 6:110323734-110323756 CGTGCAGGGTAGGGAAGGGCTGG + Intronic
1013537380 6:111075756-111075778 CCTGCTTGGGAGGAGAGTGTGGG - Intergenic
1013624234 6:111920837-111920859 CATGGTGGGGAGGGGAGGATAGG + Intergenic
1013876473 6:114836686-114836708 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1015521552 6:134136521-134136543 CCTGCTGTGGAGTGGGGGGAGGG - Intergenic
1015706987 6:136098923-136098945 CCTGTTGGGGGGTGGGGGGCTGG - Intronic
1015889088 6:137951463-137951485 ACTGCTGGGGACGTGAGGCCTGG - Intergenic
1015904989 6:138107543-138107565 CCTGCCGGGCCGGGGCGGGCGGG + Intergenic
1016080307 6:139847321-139847343 TCTGCAGGGGAAGGGAGGGCGGG - Intergenic
1016441768 6:144091861-144091883 GCTGCTGGGGAGGCTAAGGCAGG - Intergenic
1016459371 6:144266136-144266158 CCTGCTGGATGGGGGAGGGGTGG - Intergenic
1016523355 6:144971854-144971876 CCTGTTGAGGAGTGGGGGGCTGG - Intergenic
1016670873 6:146706034-146706056 GCTGCTTGGGAGGGTAAGGCAGG - Intronic
1016683553 6:146856903-146856925 CCTGTTGGGGAGTGGGGGACTGG + Intergenic
1016893947 6:149034452-149034474 CCTCTGGGGGAAGGGAGGGCAGG - Intronic
1016893965 6:149034518-149034540 CCTCTGGGGGAAGGGAGGGCAGG - Intronic
1017000915 6:149996422-149996444 CCTGCAGAGGAGGAGGGGGCAGG + Intergenic
1017061782 6:150491311-150491333 CCACCTGGGGAGGGGAAGGGAGG - Intergenic
1017432247 6:154382585-154382607 AGGGCAGGGGAGGGGAGGGCAGG + Intronic
1017558383 6:155599628-155599650 GTTGCTGGGGAGGGGAAGGAGGG - Intergenic
1017636367 6:156447497-156447519 CCTGCATGGGAGAGGTGGGCAGG - Intergenic
1017744768 6:157436572-157436594 ACTGCTGGGGGAGGGGGGGCGGG + Intronic
1017768570 6:157626885-157626907 CCAGCTGGGGGGGGGGCGGCGGG + Intronic
1018169855 6:161136221-161136243 GCTGCAGGGGAGGGCAGGGCTGG - Exonic
1018398204 6:163397472-163397494 TGTTGTGGGGAGGGGAGGGCTGG - Intergenic
1018441381 6:163816615-163816637 TCTTCTGGGGCGGGGAGGGGGGG + Intergenic
1018509146 6:164506299-164506321 AGTGGAGGGGAGGGGAGGGCAGG - Intergenic
1018798859 6:167207545-167207567 CATGCTGGGGAGGGCCGGGGAGG + Intergenic
1018865996 6:167747624-167747646 CATGCTGTGGAAGGGAGGGGGGG + Intergenic
1018924657 6:168197815-168197837 CCTGTGGGGGTGGGGAGGGTGGG + Intergenic
1018953874 6:168395243-168395265 GCAGGCGGGGAGGGGAGGGCTGG - Intergenic
1019154674 6:170031102-170031124 GCTGCAGGGGGAGGGAGGGCTGG - Intergenic
1019187487 6:170229302-170229324 CCAGCAGGGCAGGGGAGGCCTGG - Intergenic
1019189977 6:170246210-170246232 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019189990 6:170246244-170246266 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190003 6:170246278-170246300 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190016 6:170246312-170246334 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190028 6:170246346-170246368 GCTGCAGGGGCGGTGAGGGCTGG - Intergenic
1019190041 6:170246380-170246402 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190054 6:170246414-170246436 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190068 6:170246449-170246471 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190081 6:170246483-170246505 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190094 6:170246517-170246539 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190108 6:170246552-170246574 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190120 6:170246586-170246608 GCTGCAGGGGCGGTGAGGGCTGG - Intergenic
1019190133 6:170246621-170246643 GCTGCAGGGGCGGTGAGGGCTGG - Intergenic
1019190146 6:170246655-170246677 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190159 6:170246689-170246711 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190173 6:170246724-170246746 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190185 6:170246758-170246780 GCTGCAGGGGCGGTGAGGGCTGG - Intergenic
1019190199 6:170246793-170246815 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190224 6:170246862-170246884 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190238 6:170246897-170246919 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190251 6:170246931-170246953 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190264 6:170246965-170246987 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190277 6:170246999-170247021 GCTGCAGGGGCGGTGAGGGCCGG - Intergenic
1019190314 6:170247102-170247124 GCTGCAGGGGCGGTGAGGGCTGG - Intergenic
1019242159 6:170677039-170677061 CCTGGTGGGGAGTGAGGGGCAGG - Intergenic
1019314267 7:377280-377302 TCTGCTGGGGAGGGCATGGCAGG + Intergenic
1019323316 7:425283-425305 GTTGCTGGGGAGGGCAGGGCCGG + Intergenic
1019341362 7:510485-510507 TCGGGTGGGGAGGGGAGGGGAGG + Intronic
1019341398 7:510583-510605 TCGGGTGGGGAGGGGAGGGGAGG + Intronic
1019351730 7:557158-557180 CCTGGTGGAGATGGGAGGGCAGG - Intronic
1019366686 7:636723-636745 CCTGCTGGGGAGGGGGCCGGCGG + Intronic
1019426103 7:977589-977611 CCTCATGGGGAGGGGACGCCTGG - Intergenic
1019427089 7:982991-983013 GGGGCCGGGGAGGGGAGGGCAGG - Intergenic
1019501489 7:1367029-1367051 GCAGCTGAGGAGGGCAGGGCTGG - Intergenic
1019565472 7:1676683-1676705 GATGCTGGGGAAGGGAGAGCAGG + Intergenic
1019614399 7:1952599-1952621 CACGCATGGGAGGGGAGGGCTGG + Intronic
1019616435 7:1964997-1965019 CCCACTGGGGAGGGGCTGGCGGG - Intronic
1019701012 7:2475077-2475099 CCTGCTGGGGTGGGCAGTGTGGG + Intronic
1019925246 7:4187188-4187210 CCTGAGGGAGTGGGGAGGGCTGG + Intronic
1019972232 7:4550294-4550316 CCTGGTGAGCTGGGGAGGGCTGG - Intergenic
1020096911 7:5374481-5374503 CCTGCTGGGAAGGGGCCGGCAGG + Exonic
1020119356 7:5494325-5494347 GCTACTGGGGAGGCGAAGGCAGG + Intronic
1020262186 7:6536668-6536690 CCTGGTGGGGAGGGGCGGGACGG + Intronic
1020660288 7:10973783-10973805 CCTGCTCGGGAAGGGTGCGCGGG + Intergenic
1021072385 7:16256756-16256778 CTTGTTGGGGAGTGGGGGGCTGG + Intronic
1021202525 7:17742105-17742127 TATGATGGGGAGGGGTGGGCTGG - Intergenic
1021338873 7:19438907-19438929 GCTGCTGGGGAGGCTAAGGCAGG - Intergenic
1021374862 7:19894035-19894057 CCTGCTGAGGAGTGGGGGGCTGG + Intergenic
1022105403 7:27192991-27193013 TCTCCTGGGGAGGGCGGGGCGGG + Intergenic
1022221972 7:28322594-28322616 CCTGTCGGGGAGTGGGGGGCTGG - Intronic
1022467027 7:30658885-30658907 GCTGCTGGGGAGTGTAGGGATGG + Intronic
1022503656 7:30897493-30897515 TGTGCTGGGGAGGGGAGGGGAGG - Intergenic
1022692535 7:32670888-32670910 GCTGCTGGGGAGAGGAGGAAGGG + Intergenic
1022920209 7:35005433-35005455 GCTGCTGGGGAGAGGAGGAAGGG + Intronic
1023290812 7:38667205-38667227 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1023465243 7:40447527-40447549 CTTGGTGGGGAAGTGAGGGCAGG + Intronic
1023685029 7:42724870-42724892 CCTGCTTGGGAGGGCAAGGTAGG - Intergenic
1023722943 7:43113656-43113678 GCTGCCGGGGCGGGGAGGGGGGG + Intronic
1023834091 7:44058410-44058432 CCTGCTGGGAAGGGCCGGGTGGG - Exonic
1023888395 7:44376327-44376349 CCTGTTGGGGAGGGGAAGATGGG + Intergenic
1023910031 7:44547259-44547281 CAGGATGGGGAGGGGAGGGGAGG + Intergenic
1023990209 7:45124246-45124268 TCTGCAGGCGAGGTGAGGGCTGG - Intergenic
1024312407 7:47981022-47981044 CCTGTTGGGGGGTGGAGGCCTGG + Intergenic
1024566934 7:50688991-50689013 CCTGCTGGAGGGTGGAGGCCAGG + Intronic
1024581925 7:50807496-50807518 CCTGCTGGGGTGTGCAGGCCGGG + Intergenic
1024978215 7:55133310-55133332 CCTGCTGGGGTGGTGGAGGCTGG + Intronic
1025004347 7:55343194-55343216 CCAGCTGAGGCTGGGAGGGCAGG - Intergenic
1025018761 7:55464300-55464322 CCAGCTGTGGTGGGCAGGGCAGG + Intronic
1026052491 7:66959071-66959093 CCTGCTGGGGAGGGAAGGGAAGG - Intergenic
1026281794 7:68928641-68928663 GCTGCTCGGGAGGGCAAGGCAGG + Intergenic
1026458056 7:70589957-70589979 CCTCCTGGGGAGGGGAAGAAAGG - Intronic
1026773747 7:73218350-73218372 CCTACTGGGGAGGCCAAGGCAGG + Intergenic
1026774558 7:73223361-73223383 CCAGCTTGGGTGGGGAGGGGAGG - Intergenic
1026828218 7:73596786-73596808 CCTGCTGGGGTGGAGAAGGGCGG + Exonic
1026894011 7:73999752-73999774 GCTGCTGGGGAGGGTGGGCCTGG - Intergenic
1026956006 7:74376839-74376861 CCTGCTGGGGCGGGAGGGTCGGG + Intronic
1027014606 7:74771744-74771766 CCTACTGGGGAGGCCAAGGCAGG + Intergenic
1027015416 7:74776750-74776772 CCAGCTTGGGTGGGGAGGGGAGG - Intronic
1027072615 7:75169205-75169227 CCAGCTTGGGTGGGGAGGGGAGG + Intergenic
1027073427 7:75174213-75174235 CCTACTGGGGAGGCCAAGGCAGG - Intergenic
1027222123 7:76220766-76220788 CTGGCTGGGGGTGGGAGGGCTGG - Intronic
1027520515 7:79200780-79200802 CCTGTTGGAGTGGGAAGGGCTGG - Intronic
1027876355 7:83774256-83774278 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1028414765 7:90567788-90567810 TCTGCAGGGGATGGGAGGACTGG + Intronic
1028780971 7:94736110-94736132 CCTGCTGGAGGGTGGAGGGTGGG + Intergenic
1029042029 7:97586301-97586323 CCTGTTGGGTAGGGGAAGGGAGG + Intergenic
1029105077 7:98168164-98168186 AGGGCTGGGGAGGGGAGGGCTGG + Intronic
1029272700 7:99386370-99386392 CCAGCTGGGGAGGGGCTGGCAGG + Intronic
1029420545 7:100469669-100469691 CCAGCTGGGGGCTGGAGGGCAGG - Intronic
1029626372 7:101722564-101722586 CCTCTTGGGGAGGGGACCGCAGG + Intergenic
1029712430 7:102307105-102307127 CCAGTGGGGGAAGGGAGGGCAGG - Intronic
1029924303 7:104299532-104299554 CCTGTGGGGGTGGGGAGGACAGG - Intergenic
1030106838 7:105994690-105994712 TCTTCTGGGGAAGGGTGGGCAGG + Intronic
1030121249 7:106112417-106112439 GCGGCTGGGGAGGCGAGGGGCGG + Intronic
1030262550 7:107580447-107580469 CCTTCTGGGAGCGGGAGGGCCGG + Intronic
1030396074 7:108988491-108988513 CCTGGTGGGGCAGGGAGGGGTGG + Intergenic
1030481774 7:110113619-110113641 CCTGGTGGGGGGGGGGGGGGTGG - Intergenic
1030521827 7:110607156-110607178 CCTGCTTGGCAGGGCAGAGCTGG - Intergenic
1030522888 7:110620347-110620369 CCTGCTTGGCAGGGCAGAGCTGG - Intergenic
1030788784 7:113697089-113697111 CTTTCTGGGGAGAGCAGGGCAGG + Intergenic
1031196476 7:118620899-118620921 CCTGTTGGGGAGTGGAGGGCTGG - Intergenic
1031356421 7:120792343-120792365 CCTCCTGGGGAGGGAGGGACCGG - Intronic
1031529317 7:122856994-122857016 CCTTATGGGGAGAGGAGGGCTGG - Intronic
1031599784 7:123692630-123692652 GGTGCTGAGGAGGGAAGGGCTGG + Exonic
1032006308 7:128304754-128304776 CCTGCTGCAGAGCTGAGGGCTGG + Exonic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1032270230 7:130398367-130398389 CCTGCTGGGGTGGGGTCTGCAGG + Exonic
1032401966 7:131629970-131629992 GCTGCGGGGATGGGGAGGGCAGG + Intergenic
1032514544 7:132496873-132496895 CCTCCTTGGGAGGGGAGAGTTGG - Intronic
1032650119 7:133868966-133868988 CCTGCTGGGAGAGGCAGGGCAGG - Intronic
1032783723 7:135184596-135184618 CCAGCCAGGGAGGAGAGGGCAGG + Exonic
1032898340 7:136277624-136277646 CTTGGGGGTGAGGGGAGGGCTGG + Intergenic
1033049241 7:137989201-137989223 TCTGCTGGGAAGGAGAGGCCTGG - Intronic
1033138583 7:138804822-138804844 CTTGCAGAGGAGGAGAGGGCAGG + Exonic
1033150091 7:138906876-138906898 CATGCTGGGGAGGTGATGGCGGG - Intronic
1033550718 7:142445230-142445252 AACCCTGGGGAGGGGAGGGCAGG + Intergenic
1033705573 7:143882648-143882670 GGTGCTGCGGGGGGGAGGGCAGG - Intronic
1033707396 7:143902581-143902603 CCTGGAGGGGAGGGGAGGGGAGG - Intergenic
1033780662 7:144665076-144665098 CCTGTTGTTGAGGGGAGGGGAGG + Intronic
1033825697 7:145186963-145186985 AGTGGAGGGGAGGGGAGGGCAGG - Intergenic
1034149006 7:148898626-148898648 TCTGCTGGGGTGGGTAGGGGAGG - Intergenic
1034164419 7:149014554-149014576 CTTCATGGGGAGGGGAGGGGAGG - Intronic
1034401776 7:150866471-150866493 CCTGTTGGAGAGTGGAGGGTGGG + Intergenic
1034422464 7:150996744-150996766 GCTCCTGGGGAGGAGAGGGGTGG - Exonic
1034474786 7:151276044-151276066 AGTGCTGGGGATGGGAGAGCTGG + Intronic
1034535415 7:151723014-151723036 CCTGCGGTGGAGGGGAGGAGTGG - Intronic
1034904214 7:154929700-154929722 ACTGCTGGAGAAGGGAGGGCTGG - Intronic
1034935244 7:155194996-155195018 CCAGCTGGGGAGGGGTGTGGAGG + Intergenic
1035018819 7:155788579-155788601 CCTGCGAGGGCAGGGAGGGCAGG + Intergenic
1035121164 7:156568738-156568760 CCTGTTCTGGAGTGGAGGGCAGG + Intergenic
1035184063 7:157112079-157112101 CGTTCTGGGCAGAGGAGGGCAGG - Intergenic
1035247290 7:157571775-157571797 CCTGCAGGGGTGGGACGGGCAGG - Intronic
1035339723 7:158152509-158152531 AGTGCTGGGAAGGGGAGAGCTGG + Intronic
1035375133 7:158402668-158402690 CCTGCAGGGAAGGGAAGGTCTGG + Intronic
1035375252 7:158403241-158403263 CCTGCTGGTGAGGGGTCTGCTGG - Intronic
1035403408 7:158583469-158583491 CCTGCCAGGGAGGGGAGGTGGGG - Intronic
1035464411 7:159065277-159065299 ACTGCAGGGGAGGGGAGGGAGGG - Intronic
1035486986 7:159233686-159233708 CATGCTGGGAATGGGATGGCTGG + Intergenic
1035505959 8:131112-131134 CCTGGTGGGGAGTGAGGGGCAGG + Intergenic
1035519527 8:266044-266066 CCCCCTGGGGAGGGGGGGTCAGG + Intergenic
1035519680 8:266437-266459 CCACCTGGGGAGGGGGCGGCCGG + Intergenic
1035688390 8:1542815-1542837 GCTGCTGGGGAAGGGAGAACAGG - Intronic
1035728800 8:1840862-1840884 GCTGCTGGGGTGGAGAGGGTGGG + Intronic
1036197526 8:6733350-6733372 ACCCCTGGTGAGGGGAGGGCAGG - Intronic
1036764983 8:11543759-11543781 CCTGCTCGGGAGGTGAGGACAGG - Intronic
1037127150 8:15365369-15365391 AGGGCTGGGGAGGGGAGGGGTGG + Intergenic
1037217520 8:16475664-16475686 ACTACTGGGGAGGGGAGGTGGGG - Intronic
1037471408 8:19215125-19215147 CATGCGGGAGAGGGGAGGGGAGG + Intergenic
1037803691 8:22048388-22048410 CCAGCTGGGAAGGGGCAGGCCGG + Exonic
1037807412 8:22066420-22066442 CGGGCCGGGGCGGGGAGGGCAGG + Intronic
1037816882 8:22117065-22117087 CGAGATGGGGAGGGAAGGGCAGG + Intronic
1037820819 8:22133772-22133794 CCTGGAGGGGAGGGGAGGTGGGG - Intergenic
1037889837 8:22618200-22618222 GCTGCTGGGGAGGCTAAGGCAGG - Intronic
1037936896 8:22921061-22921083 CCTGCAGGGCAGGGCAGGCCGGG + Intronic
1038247300 8:25870694-25870716 GGAGCTGGGGAGGGGAGGGCAGG - Intronic
1038338262 8:26662616-26662638 CCTGGTGGGGTGCGGAGGACAGG - Intergenic
1038834097 8:31099290-31099312 GCTACTGGGGAGGGTAAGGCAGG + Intronic
1038958478 8:32492855-32492877 TCTGGTGGGGAGGGGAGGCTGGG + Intronic
1039069083 8:33633959-33633981 CCTGCAGGGCGGGGCAGGGCTGG - Intergenic
1039140979 8:34387984-34388006 CCTGTTGTGGAGTGGGGGGCAGG - Intergenic
1039373000 8:37005372-37005394 ACAGCTGGGGAGGGCTGGGCAGG + Intergenic
1039453916 8:37695940-37695962 GCTGGGGGGGCGGGGAGGGCGGG - Exonic
1039470301 8:37809346-37809368 CTATCTGGGGAGAGGAGGGCAGG - Intronic
1039504496 8:38042164-38042186 AGTGCTGGGTAGGGCAGGGCAGG - Intronic
1039755595 8:40518788-40518810 CCTGGCAGGGAGGAGAGGGCTGG - Intergenic
1039947228 8:42140426-42140448 CCGGCGGGGGAGGGGAGCCCGGG - Intergenic
1039983590 8:42429387-42429409 GCAGCTGGGGTGGGGAGGACCGG - Intronic
1040599567 8:48870401-48870423 CCTGCGCGGGAGGGGCGGCCGGG + Intergenic
1041090495 8:54297081-54297103 TCTGCAGGGCAGGGCAGGGCAGG + Intergenic
1041466120 8:58159263-58159285 CCTTCTGGGAGGTGGAGGGCAGG - Intronic
1041564179 8:59257966-59257988 CCTGTTGGGGAGTGGGGGTCTGG - Intergenic
1041648690 8:60280769-60280791 CCTGCTGCGGTCCGGAGGGCGGG - Intronic
1041715024 8:60924644-60924666 CAGGATGGGGAGGGGAGGGGAGG - Intergenic
1042109666 8:65367442-65367464 CCTGCATGGGAAGGGTGGGCTGG - Intergenic
1042111489 8:65385998-65386020 CCTGTTGGGGTGTGGAGGCCTGG + Intergenic
1042290039 8:67160936-67160958 GCTACTGGGGAGGCTAGGGCAGG - Intronic
1042356277 8:67831361-67831383 GCTGCTCGGGAGGCGGGGGCAGG + Intergenic
1042399513 8:68330289-68330311 CCAACTTTGGAGGGGAGGGCTGG + Intronic
1042459360 8:69044969-69044991 ACTGCTGGGGAGGCTAAGGCAGG + Intergenic
1043303389 8:78762548-78762570 CGCGCGGGGGAGGGGCGGGCGGG + Intronic
1043633232 8:82363440-82363462 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
1044053388 8:87538392-87538414 CCTGCTGGGGGGTGGGGGGAGGG - Intronic
1045136233 8:99221818-99221840 GCTGCTGGGGAGGCTGGGGCAGG - Intronic
1045202282 8:99996104-99996126 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
1045205545 8:100035951-100035973 CCTGTTGTGGAGTGGGGGGCTGG + Intronic
1045383746 8:101651637-101651659 GCTGCTGAGGCGGGGAGGGTAGG - Intronic
1045459198 8:102412104-102412126 CCCGTGGGGGAGGGGAGGGAGGG + Intronic
1045509960 8:102806546-102806568 CCTCCGGGGGAGGCGGGGGCGGG - Intergenic
1046837827 8:118822514-118822536 GCTGAAGGGGAGGGGAAGGCAGG + Intergenic
1047219875 8:122910730-122910752 CCTGCTGGGGGGTGGGGGGTGGG + Intronic
1047311549 8:123696654-123696676 CCTGGGTGGGAGGGAAGGGCAGG + Intronic
1047575977 8:126155655-126155677 ACTGCTAGAGAGGGGAGGGAGGG + Intergenic
1047693127 8:127376979-127377001 TCTTTTGGGGAGGGGAGGGCGGG - Intergenic
1047761156 8:127955585-127955607 CGGGAAGGGGAGGGGAGGGCAGG - Intergenic
1048214212 8:132480702-132480724 CCTGGGGGGCAGGGGAGGCCAGG + Exonic
1048282374 8:133114793-133114815 CCTGTTGGGAAGGGATGGGCTGG + Intronic
1048445524 8:134490036-134490058 CCCTCTGGGGAGGGGAGGACTGG - Intronic
1048485635 8:134844827-134844849 CCTGCAGTGGAGGGGAAGACAGG - Intergenic
1048526098 8:135204430-135204452 ACTACTGGAGTGGGGAGGGCAGG + Intergenic
1048866300 8:138764221-138764243 CCCTCTGGGGATGGCAGGGCAGG + Intronic
1048987082 8:139740460-139740482 CATGCTGGGCAGGGGGAGGCAGG + Intronic
1049201529 8:141342858-141342880 AGTGCTGGGGAGGGGTCGGCCGG + Intergenic
1049221580 8:141431116-141431138 CCTGCTGGGCTGGGCAGAGCAGG - Exonic
1049288303 8:141788444-141788466 CATGCTGGGGAGGGGGTGGCTGG - Intergenic
1049322810 8:142006041-142006063 CTTGTTGGGGAGGGGGGTGCAGG - Intergenic
1049325195 8:142017978-142018000 GCAGCTGGGGTGGGGACGGCCGG - Intergenic
1049378662 8:142301354-142301376 CCTGCTGGCATGGGCAGGGCAGG - Intronic
1049528597 8:143142359-143142381 CCTCCTGGGGAGGGAAGGACAGG - Intergenic
1049528628 8:143142462-143142484 CCTCCTGGGGAGGGAGGGACAGG - Intergenic
1049528647 8:143142517-143142539 CCTCCTGGGGAGGGAGGGACAGG - Intergenic
1049528666 8:143142573-143142595 CCTCCTGGGGAGGGAGGGACAGG - Intergenic
1049528685 8:143142628-143142650 CCTCCTGGGGAGGGAGGGACAGG - Intergenic
1049528701 8:143142683-143142705 CCTCCTGCGGAGGGAAGGACAGG - Intergenic
1049528717 8:143142738-143142760 CCTCCTGGGGAGGGAGGGACAGG - Intergenic
1049708026 8:144051680-144051702 CCGGGAGGGGAGGGGAGGGGAGG + Intronic
1049721296 8:144116661-144116683 CCTGGTGTGGAGGGGAGTCCGGG + Exonic
1049741512 8:144243157-144243179 CCTGCGGTGGCTGGGAGGGCGGG + Intronic
1049745800 8:144262808-144262830 CCTGCAGGTGAGGGGTGGGGGGG - Intronic
1049761670 8:144334477-144334499 CCCGAGGGGGAGGGGAGGGTGGG - Intronic
1049774833 8:144399441-144399463 CCGGCTGGTCAGGTGAGGGCCGG - Exonic
1049795791 8:144496776-144496798 GCTGAGGGGGAAGGGAGGGCAGG - Exonic
1049800867 8:144517034-144517056 CCTGCAGGTGAGGAGTGGGCAGG - Exonic
1049804833 8:144534095-144534117 CCTGGGGGGCCGGGGAGGGCAGG - Intronic
1049811222 8:144573449-144573471 CCTGTTGGGGGGTGGGGGGCTGG + Intronic
1050113831 9:2242684-2242706 GCAGCTGGGGAGGTGCGGGCGGG - Intergenic
1050461724 9:5883002-5883024 CCTGTTGTGGAGTGGGGGGCTGG + Intronic
1051084712 9:13334887-13334909 GCTGCTGGGGAGGCTAAGGCAGG - Intergenic
1051155176 9:14134783-14134805 GCTACTGGGGAGGTTAGGGCAGG + Intronic
1051384672 9:16494823-16494845 CCTGTTGTGGGGTGGAGGGCTGG + Intronic
1051481827 9:17569977-17569999 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1051893411 9:21965694-21965716 CCTGCTGGCGAGTGGAGCGTAGG + Intronic
1051896675 9:21995351-21995373 CCAGCAGGGGAGGGGAGCGCGGG - Intronic
1052024072 9:23555816-23555838 CCTCCTGGGAAGGGGAGAGAAGG + Intergenic
1052261104 9:26517157-26517179 CCTGCTTGGGAAGGGTTGGCAGG - Intergenic
1052380110 9:27761267-27761289 TGTGTTGGGGAGTGGAGGGCAGG - Intergenic
1052996384 9:34553602-34553624 CCTGCTGGGGCGGAAAGGGGTGG + Intronic
1053003789 9:34591491-34591513 CCGGCCGGGGAGGGGCGGACGGG + Intergenic
1053054752 9:34987921-34987943 AGGGCTGGGGAGGGGAGGGAAGG - Intergenic
1053153392 9:35756968-35756990 CCTGCTGGGGAGGGGGTGAGTGG + Exonic
1053214321 9:36258220-36258242 GCGGCCGGGGAGGGGAGGCCTGG + Intronic
1053424525 9:38002443-38002465 CCTACAGGGGAAGGCAGGGCAGG + Intronic
1053425730 9:38008771-38008793 CTTGGTGGGGAGGGCAGGCCAGG + Intronic
1053530160 9:38873143-38873165 CCTGGTGGGGGGCGGAGGGGGGG + Intergenic
1053883507 9:42619212-42619234 GCTGCTGGGGAGGGTGAGGCAGG + Intergenic
1053889162 9:42675087-42675109 GCTGCTGGGGAGGGTGAGGCAGG - Intergenic
1054222527 9:62426679-62426701 GCTGCTGGGGAGGGTGAGGCAGG + Intergenic
1054228183 9:62482493-62482515 GCTGCTGGGGAGGGTGAGGCAGG - Intergenic
1054451178 9:65404279-65404301 CCTCCTGGGGTGGGGTGGGAGGG - Intergenic
1054635973 9:67490790-67490812 CCTGGTGGGGGGCGGAGGGGGGG - Intergenic
1055029089 9:71754056-71754078 CCTGTTGAGGGGTGGAGGGCTGG + Intronic
1055658742 9:78479447-78479469 CTTTCTGGGGAGGGCAGGGCTGG + Intergenic
1055736899 9:79340070-79340092 GCTGCTGGGGAGGCTAAGGCAGG + Intergenic
1055760892 9:79606524-79606546 CCTGTTGGGGAGTGGGGGACTGG - Intronic
1055818927 9:80238770-80238792 CCTGTTGGTGTGGGGAGGGGGGG - Intergenic
1056506461 9:87262826-87262848 CCTGCTGGGGAGGGGGGTCAGGG + Intergenic
1056533460 9:87507602-87507624 AGTGGTGGGGAGGGGAGGGAAGG + Intronic
1056715241 9:89023074-89023096 CCTTCTTTGGAAGGGAGGGCAGG + Intronic
1057018972 9:91681165-91681187 CCTGCTGGGGTGGGGTGGGGCGG - Intronic
1057080429 9:92170918-92170940 ACTGAGGGGGAGGGGTGGGCCGG + Intergenic
1057143270 9:92740522-92740544 TGTGCTGGGGCGGGGAGGGGGGG + Intronic
1057207713 9:93183722-93183744 CCTGGTGGTGAAGTGAGGGCAGG + Intergenic
1057346972 9:94259735-94259757 GATGGTGGGGAGGGGATGGCGGG - Intronic
1057792089 9:98131059-98131081 CCTGCAGGGGAAGGGGAGGCAGG + Exonic
1057928019 9:99170216-99170238 CGTGCAGAGGAGGGGAGTGCAGG - Intergenic
1058504115 9:105651885-105651907 AGGGCTGGGGAGGGAAGGGCAGG - Intergenic
1058528362 9:105882555-105882577 CCTGTTGGGGAATGGGGGGCTGG - Intergenic
1058973295 9:110102605-110102627 CCCAATGGGGAGGGGAGGGGAGG - Intronic
1059016306 9:110519705-110519727 CCTGATGGAGAGTGGAGGGTGGG + Intronic
1059245325 9:112844833-112844855 CCTGTGGGGAAGGGGCGGGCAGG - Intronic
1059354481 9:113688114-113688136 CCCGCGGGTGAGGGGAGGACGGG - Intergenic
1059358285 9:113718437-113718459 CATGCTGGGGAGGGCAGCTCTGG - Intergenic
1059451817 9:114376002-114376024 GCTGGTGGGGTGGGGAGGCCTGG - Intronic
1059451839 9:114376063-114376085 GCTGGTGGGGTGGGGAGGCCTGG - Intronic
1059451863 9:114376124-114376146 GCTGGTGGGGTGGGGAGGCCTGG - Intronic
1059451887 9:114376185-114376207 CCTGGTGGGGTGGGGAGGCCTGG - Intronic
1059451933 9:114376291-114376313 GCTGGTGGGGTGGGGAGGCCTGG - Intronic
1059456222 9:114402015-114402037 CCATGTGGGGAGGGGTGGGCAGG - Intergenic
1060047471 9:120352040-120352062 CCTGCAGGGGAGGGAAGTGAAGG - Intergenic
1060172036 9:121469799-121469821 CCTCCTGGGGTGTGCAGGGCAGG - Intergenic
1060519450 9:124286071-124286093 ACTGCGGGGGAGGGCAGGGAGGG - Intronic
1060547399 9:124469368-124469390 CCTGCAGGGGAGGGGCGTGTTGG + Intronic
1060744797 9:126124209-126124231 CCTCCTGGGGCGGGGGGGGGGGG - Intergenic
1060790767 9:126484042-126484064 CCATCAGGGGAGGGGAGGGCAGG + Intronic
1060820615 9:126659441-126659463 CCTGCTGGGATGAGGAGGGATGG - Intronic
1060821011 9:126661659-126661681 GCAGGTGGGGAGGGGTGGGCGGG - Intronic
1061178438 9:129010718-129010740 CCAGCAGGGGAGGGGAGAGGAGG + Intronic
1061202864 9:129147507-129147529 ACTGCTGGGGTGGGGAAGGCAGG - Exonic
1061280824 9:129597035-129597057 CCTGCGGGGGATGGGAGGGAAGG - Intergenic
1061306647 9:129736376-129736398 CCTGCTGGGGAGCGGCTGCCTGG - Intergenic
1061431784 9:130535922-130535944 CCTGCTCCGGAGGGGAGGCTCGG - Intergenic
1061505286 9:131028375-131028397 TCTGGAGGGGAGGAGAGGGCAGG - Intronic
1061542183 9:131283298-131283320 GCTGCAGGGGAGAGGAGGGAGGG - Intergenic
1061555299 9:131364475-131364497 GCTGCTGGGGAGGCTAAGGCAGG - Intergenic
1061807134 9:133142813-133142835 GCTGCTGGGCAGGGCGGGGCTGG - Intronic
1061895172 9:133643352-133643374 GCTGCTGGGGAGGGGAGGGTGGG + Intronic
1062051624 9:134450219-134450241 CTTGCTGCTGAGGGGAGGGAGGG + Intergenic
1062070665 9:134553502-134553524 CAGGCTGGGGAGAGGAGAGCAGG + Intergenic
1062174575 9:135153821-135153843 CCTGCTGGGGTGCAGAGGGGTGG - Intergenic
1062186798 9:135222519-135222541 GCTGCTAGGGAGGCGAGGCCTGG + Intergenic
1062208170 9:135348638-135348660 CCTGCCAGGGAGGGGGGGGCGGG - Intergenic
1062221682 9:135419425-135419447 CCTGCTGGGGAAGGGAGGGATGG - Intergenic
1062250569 9:135591801-135591823 CCTGCCTGGGGAGGGAGGGCAGG - Intergenic
1062279908 9:135747246-135747268 CCTGCCGGAGAGGAGAGGGTGGG + Intronic
1062318227 9:135978450-135978472 GCTGCTGAGGAGGGGATGGGGGG - Intergenic
1062319411 9:135983087-135983109 AGTGCAGGAGAGGGGAGGGCTGG - Intergenic
1062392123 9:136338057-136338079 CCTTCTGGGGAGGGGAGGGGAGG - Intronic
1062410092 9:136419220-136419242 CCGGCAGGGCAGGGCAGGGCAGG + Intronic
1062435733 9:136545894-136545916 CCAGCCGGGGAAGAGAGGGCGGG - Intergenic
1062463590 9:136671807-136671829 CCTGCCGCGGAGGCGGGGGCTGG + Intronic
1062621009 9:137422720-137422742 TCTCCCGGGGAGGGCAGGGCGGG + Intronic
1203792875 EBV:160985-161007 GCTGCTGGGTGGAGGAGGGCAGG - Intergenic
1203470543 Un_GL000220v1:113891-113913 GCGGCGGGGGAAGGGAGGGCGGG - Intergenic
1203478364 Un_GL000220v1:157863-157885 GCGGCGGGGGAAGGGAGGGCGGG - Intergenic
1203602350 Un_KI270748v1:26261-26283 CCTGGTGGGGAGTGAGGGGCAGG - Intergenic
1185608253 X:1379592-1379614 CCCGCTGGGCAGGGCAGGGGAGG - Intronic
1185732441 X:2472319-2472341 CCTGCTGGAGGGTGGAGGGTGGG + Intronic
1185790028 X:2922293-2922315 CTTTCTGGGGAGAGCAGGGCAGG + Intronic
1186082356 X:5946829-5946851 CCTGCTGGAGGGTGGAGGGTAGG - Intronic
1186347354 X:8707767-8707789 TCTGCCGGGGTGGGGAGGGGAGG + Intronic
1186586039 X:10874035-10874057 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1186813241 X:13210506-13210528 CCTGTTGGGGGGTGGTGGGCTGG + Intergenic
1186876109 X:13819885-13819907 CCTGCTGGGTAGGGTAGGGAAGG + Intronic
1187173738 X:16875752-16875774 CCTGTTGGGGGGTGGTGGGCTGG + Intergenic
1187174314 X:16882647-16882669 GGTGCTGGGGAGGGGCGGGGCGG - Intergenic
1187177300 X:16908180-16908202 CTTGCAGGGGTGGGGAGGGTAGG + Intergenic
1187330326 X:18332865-18332887 CCTGCTTGGGAGGCCAAGGCAGG + Intronic
1187665457 X:21604309-21604331 CCTGCTGTGGAGTGGGGGGAGGG + Intronic
1188099691 X:26069306-26069328 TCTGCTGGGGAGGACAGGGGAGG - Intergenic
1188313051 X:28641212-28641234 CCTGTTGGGGAGTGGTGGGCTGG - Intronic
1188463891 X:30456419-30456441 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1188574900 X:31636183-31636205 CCTACTGGAGTGGGGAGGGTGGG + Intronic
1188848866 X:35107463-35107485 CCTGTTAGGGGGGCGAGGGCAGG + Intergenic
1188950712 X:36370248-36370270 CCTGCTGGGGGGTGGGGGGCTGG - Intronic
1189099882 X:38177736-38177758 CGTGCTGGGGAGTGGATTGCTGG + Intronic
1189237451 X:39498141-39498163 TCTGCTGGGGAGAGGAGGAAAGG + Intergenic
1189323230 X:40098337-40098359 CGAGCTGGGGAGGGGAGGCCGGG - Intronic
1189331147 X:40145793-40145815 GCTGCTGCACAGGGGAGGGCGGG - Intronic
1189333329 X:40155839-40155861 GCGGCTGGGGTGGGGAGGGGGGG + Intronic
1189371641 X:40433767-40433789 CCTGCTGGGGATGGGGGGCATGG + Intergenic
1189840666 X:45073020-45073042 CCTGCTGTGGGGTGGAAGGCAGG - Intronic
1190081139 X:47357626-47357648 CCTGCTGGGGAGGCTGAGGCAGG + Intergenic
1190325584 X:49205081-49205103 CCTGCTGGGGAGGGGAGGGCAGG + Exonic
1191144829 X:57155068-57155090 CCTGCTGCTGTGGGGATGGCAGG + Intergenic
1192203985 X:69084101-69084123 CAGGCAGGGGTGGGGAGGGCCGG + Intergenic
1192687010 X:73317891-73317913 CCTACTGGAGAGTGGAGGGTTGG - Intergenic
1192788634 X:74358009-74358031 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1193019399 X:76774933-76774955 CCTGTTGGACAGTGGAGGGCTGG - Intergenic
1193166682 X:78289111-78289133 CCTGTCGGGGGGTGGAGGGCTGG - Intronic
1193507074 X:82357782-82357804 CCTGCTGTGGGGTGGGGGGCGGG + Intergenic
1193767417 X:85547166-85547188 CCTGCTGGAGGGTGGAGGGTGGG + Intergenic
1193909807 X:87290119-87290141 CCTGTTGGGGGGTGGCGGGCTGG - Intergenic
1194096268 X:89642890-89642912 CCTGTTGGGGGGTGGAGGCCTGG + Intergenic
1194706270 X:97179360-97179382 CTTGTTGGGGAGGTGAGGGGAGG - Intronic
1194989760 X:100534513-100534535 CCTGTTGGGGGGTGGGGGGCTGG + Intergenic
1194990013 X:100537275-100537297 CCTGTTGGGGGGTGGGGGGCTGG - Intergenic
1195013065 X:100752310-100752332 CCTGTTGGGGGGTGGGGGGCAGG - Intergenic
1195125467 X:101804876-101804898 TCTCCTGGGAAGGGGAGGTCTGG + Intergenic
1195711051 X:107774335-107774357 CCTGCTGGGGAGGCAAGGAGAGG - Intronic
1195978592 X:110554601-110554623 CCTGTTGGTGGGGGGAGGGAAGG - Intergenic
1196277430 X:113783356-113783378 CCTGTTGGGGGGTGGAGGCCCGG + Intergenic
1197045066 X:121986444-121986466 CCTACTTGAGAGGGGAGGGTGGG + Intergenic
1197079790 X:122398358-122398380 CCTGCTGTGGTGGGGGTGGCAGG - Intergenic
1197862392 X:130984672-130984694 CCTGCAGGGGAAGGGAAGGCTGG + Intergenic
1198215404 X:134550175-134550197 CTTGGTGGGGTGGCGAGGGCTGG - Intergenic
1198299793 X:135324073-135324095 CTTTCTGGGGAGAGGAGGGCAGG + Intronic
1198482359 X:137052611-137052633 CTTGGTGGGGCGGGGAGAGCTGG - Intergenic
1198482759 X:137056081-137056103 CTTTCTTGGGAGGGCAGGGCAGG + Intergenic
1199292969 X:146125177-146125199 CCTGCTGGGGTGTGGTGGGCTGG + Intergenic
1199677303 X:150199344-150199366 CCTGCCTGTGAGGGGAGGGAAGG + Intergenic
1199840193 X:151638287-151638309 CCTTTTGGGGAGTGGGGGGCTGG + Intronic
1200063648 X:153494857-153494879 GCTGGTGGGGCGGAGAGGGCGGG - Intronic
1200097528 X:153671221-153671243 CCTGCTGGGTTGGGGAGGGTGGG - Intronic
1200099900 X:153685186-153685208 GCTGCTGGGGAGGGGCAGGGTGG - Intronic
1200101072 X:153689270-153689292 CCGCGAGGGGAGGGGAGGGCAGG - Intronic
1200102120 X:153693405-153693427 GCTGCTGGGCAGGGCGGGGCAGG - Intronic
1200102478 X:153694907-153694929 ACAGCAGGGGAGGGGAGGGCGGG - Intronic
1200112023 X:153745184-153745206 CATGCAGGGGAAGGGAGGGCAGG + Intergenic
1200136248 X:153876079-153876101 GCGGATGGGGAGGGGAGGGCTGG - Intronic
1200154395 X:153967683-153967705 ACTGCTGGAGAGGGGAGGACAGG + Intronic
1200804825 Y:7422494-7422516 CCTTCTGGGGAAGGGAGAGGGGG - Intergenic
1200982345 Y:9273718-9273740 CCTGCTGGGCAGTGTGGGGCTGG - Intergenic
1201145392 Y:11062320-11062342 CCTGCTGGGGAGTGGGTGGCAGG - Intergenic
1201905066 Y:19079022-19079044 CCTGCTTAGGAGGCTAGGGCAGG - Intergenic
1202128061 Y:21586012-21586034 CCTGCTGGGCAGTGTGGGGCTGG + Intergenic