ID: 1190326369

View in Genome Browser
Species Human (GRCh38)
Location X:49209478-49209500
Sequence AAGGAGTCCTTCAGCCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 266}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190326362_1190326369 2 Left 1190326362 X:49209453-49209475 CCCCTGCAGGCGGGTAGGGTGGG 0: 1
1: 1
2: 1
3: 17
4: 200
Right 1190326369 X:49209478-49209500 AAGGAGTCCTTCAGCCACCCTGG 0: 1
1: 0
2: 1
3: 21
4: 266
1190326366_1190326369 0 Left 1190326366 X:49209455-49209477 CCTGCAGGCGGGTAGGGTGGGGG 0: 1
1: 0
2: 2
3: 56
4: 384
Right 1190326369 X:49209478-49209500 AAGGAGTCCTTCAGCCACCCTGG 0: 1
1: 0
2: 1
3: 21
4: 266
1190326355_1190326369 12 Left 1190326355 X:49209443-49209465 CCCTCTGTTTCCCCTGCAGGCGG 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1190326369 X:49209478-49209500 AAGGAGTCCTTCAGCCACCCTGG 0: 1
1: 0
2: 1
3: 21
4: 266
1190326364_1190326369 1 Left 1190326364 X:49209454-49209476 CCCTGCAGGCGGGTAGGGTGGGG 0: 1
1: 0
2: 6
3: 30
4: 248
Right 1190326369 X:49209478-49209500 AAGGAGTCCTTCAGCCACCCTGG 0: 1
1: 0
2: 1
3: 21
4: 266
1190326357_1190326369 11 Left 1190326357 X:49209444-49209466 CCTCTGTTTCCCCTGCAGGCGGG 0: 1
1: 0
2: 2
3: 10
4: 208
Right 1190326369 X:49209478-49209500 AAGGAGTCCTTCAGCCACCCTGG 0: 1
1: 0
2: 1
3: 21
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190326369 Original CRISPR AAGGAGTCCTTCAGCCACCC TGG Intronic
900970448 1:5989776-5989798 ACTGAGTCCTGCAGACACCCAGG - Intronic
901414730 1:9108809-9108831 AAGGAGTCTCTCTGTCACCCAGG + Intronic
901448312 1:9321289-9321311 AAGGAGTTCTTCCTTCACCCTGG - Intronic
903386999 1:22933416-22933438 AAGGAGCCCTTCAGAAAACCTGG - Intergenic
903622427 1:24707615-24707637 CAGGAGTCCTTCAGCCATCCTGG - Intergenic
904240198 1:29139332-29139354 AAGGTTTCCTTCTGTCACCCAGG + Intergenic
905253618 1:36665821-36665843 CAGAAGTGCTTCAGCCATCCAGG + Intergenic
905909681 1:41645238-41645260 AAGGAGCCCTGCAGCCAGCAGGG - Intronic
906787213 1:48626677-48626699 AATGAGTGGTTCAGCCACCCTGG + Intronic
906935293 1:50209220-50209242 AAGGAATCCTTAACCCAGCCAGG - Intergenic
907413148 1:54296514-54296536 AAGGAGTCCCACAGCCAGGCTGG + Intronic
910248178 1:85165206-85165228 AGGGTCTCGTTCAGCCACCCAGG - Intronic
910799974 1:91135608-91135630 ATGGAGTCTGTCTGCCACCCAGG - Intergenic
910803830 1:91170919-91170941 AAGGAGTCCTTGATGGACCCTGG - Intergenic
910988402 1:93028730-93028752 AAGGAGTCCTGCAGAGAGCCAGG - Intergenic
913679221 1:121172735-121172757 ATGGAGTCATTCTGTCACCCAGG - Intronic
914031053 1:143960378-143960400 ATGGAGTCATTCTGTCACCCAGG - Intronic
914158395 1:145107581-145107603 ATGGAGTCATTCTGTCACCCAGG + Intronic
916185855 1:162132163-162132185 CAGGAGTCCTTCACCCTCCCAGG - Intronic
917521785 1:175753703-175753725 AAATGTTCCTTCAGCCACCCTGG - Intergenic
919455819 1:197818583-197818605 AAGTACTCCTTTAGCCACCCAGG - Intergenic
919569970 1:199236023-199236045 AAGGATTCATTCAGTCTCCCAGG - Intergenic
919790208 1:201285702-201285724 AAGGGGTCCTTGGGGCACCCAGG - Intronic
920430385 1:205915027-205915049 AAGGTGTCCTTCAGCTGCCAAGG + Exonic
920466521 1:206191273-206191295 ATGGAGTCATTCTGTCACCCAGG - Intronic
922864291 1:228846149-228846171 ACGGCATCCTACAGCCACCCTGG - Intergenic
1064795109 10:19003592-19003614 AATGCCTCCTTCGGCCACCCTGG - Intergenic
1064956127 10:20912423-20912445 AAGGTCTCATTCAGTCACCCAGG - Intronic
1065515268 10:26518271-26518293 AAAGAGTCCTTCTGTCACCCAGG + Intronic
1065745087 10:28832900-28832922 AAGGCCTCATTCAGTCACCCAGG - Intergenic
1065914875 10:30346013-30346035 AAGGAGTCTCTCAGTCACCCAGG - Intronic
1067011898 10:42722035-42722057 AAGGAGCCCTTCAGGCACTTTGG + Intergenic
1069802258 10:71089357-71089379 GAACAGTCCTTCAGCCTCCCAGG + Intergenic
1070165453 10:73894228-73894250 ATGGGGAGCTTCAGCCACCCAGG - Intergenic
1070288447 10:75099986-75100008 GAGGAGTCCAACAGCCACACTGG + Intronic
1071585504 10:86816659-86816681 AAAGAGTCCTTCAGTCTCCTAGG - Intronic
1071977655 10:90970933-90970955 ACGGAGTCTTTCTGTCACCCAGG - Intergenic
1072292961 10:93982488-93982510 AAACAGTCCTTTAGGCACCCAGG + Intergenic
1072842977 10:98795691-98795713 AAGCACTCCCTTAGCCACCCTGG - Intronic
1072961389 10:99932582-99932604 AAGGAGTCCGTGAGGAACCCAGG + Intronic
1072964939 10:99963779-99963801 AAGGAGTCCGTGAGGAACCCAGG - Intronic
1073393957 10:103202868-103202890 AGGGTGTCATTCTGCCACCCAGG - Intergenic
1074319564 10:112389243-112389265 AAGGCGTCCTTCAGCTAACTTGG + Intronic
1075950612 10:126474425-126474447 AAGGACTCCTACAGTCAGCCTGG + Intronic
1076166262 10:128285053-128285075 AAGGAGACCTTCAGAAACACTGG - Intergenic
1076407466 10:130222205-130222227 GAGCAGTCCTGCTGCCACCCGGG + Intergenic
1076658681 10:132041075-132041097 ATGGAGTCTTGCTGCCACCCAGG + Intergenic
1076843980 10:133060160-133060182 GAGGGGTCCTCCTGCCACCCAGG - Intergenic
1077599400 11:3563468-3563490 AAGCAGTCCTCCATCCACCTCGG - Intergenic
1077874345 11:6291359-6291381 TTGGAGTACTTCAACCACCCTGG + Intergenic
1078268690 11:9774634-9774656 AAGAAGTCCTTGAGCCATCAGGG - Intergenic
1079416246 11:20238859-20238881 AAGCACTCCATTAGCCACCCTGG + Intergenic
1082741788 11:56918860-56918882 TTGGAGTCCTTCAGTCTCCCTGG - Intergenic
1082923031 11:58516328-58516350 AAGGTCTCCCTCTGCCACCCAGG - Intergenic
1083545986 11:63549789-63549811 AAGGAGACTTTAAGCCACCCAGG - Intergenic
1083667763 11:64284959-64284981 AACAAGTCCTTCAGCCCCTCTGG + Intronic
1084207076 11:67601528-67601550 ACGGAGTCGCTCTGCCACCCAGG + Intergenic
1084255306 11:67938073-67938095 AAGCAGTCCTCCATCCACCTCGG - Intergenic
1084365338 11:68693860-68693882 AAGGTGTTCTCCAGCCACCTCGG + Intergenic
1084479914 11:69413937-69413959 ATGGAGTCTTTCTGTCACCCAGG - Intergenic
1084817444 11:71657222-71657244 AAGCAGTCCTCCATCCACCTCGG + Intergenic
1090082127 11:123620697-123620719 AGGGTGGCCTTCAGACACCCAGG + Intronic
1090676980 11:129007700-129007722 AAGCACTCCCTTAGCCACCCTGG + Intronic
1090829821 11:130413449-130413471 GAGGAGTGCTTGGGCCACCCTGG + Intronic
1092343235 12:7694028-7694050 AGGGAGTACTTCAGGCAGCCTGG + Intronic
1094855040 12:34399102-34399124 AAGGGGTCCTTCAGGCCCACAGG + Intergenic
1095240062 12:39847550-39847572 TAGAACTCCTGCAGCCACCCTGG + Intronic
1095533910 12:43224227-43224249 GAGGAGCCCTTCAGCCCGCCGGG + Intergenic
1096853627 12:54461117-54461139 AAGGACTCTTTCTGTCACCCAGG + Intronic
1100374202 12:93997539-93997561 AAGGAGACCTTCTTCCACCATGG - Intergenic
1101941829 12:109104937-109104959 ATGGAGTCTTTCTGTCACCCAGG + Intronic
1103312762 12:120025073-120025095 GAGGAGTCTTTCTGTCACCCAGG + Intronic
1103670207 12:122608135-122608157 AGGGTCTCATTCAGCCACCCAGG + Intronic
1104710427 12:130982042-130982064 GAGGCCTCCTTCAGCCCCCCAGG + Exonic
1106113879 13:26800683-26800705 AAGGAGTCCTTCCACCATCTTGG + Intergenic
1107086194 13:36430661-36430683 ACTGAGTCCTTCAGCGACCCAGG + Intergenic
1107541174 13:41390643-41390665 AGGGTCTCCTTCTGCCACCCAGG + Intergenic
1107671244 13:42748541-42748563 AAGGATTCCTTCAGCATCACAGG - Intergenic
1107926981 13:45272764-45272786 AAGGTCTCCTGCTGCCACCCAGG + Intronic
1111645659 13:91028837-91028859 AAAGAGTCCCTCAGACACTCTGG - Intergenic
1112178997 13:97058173-97058195 AAGGATTTCTTCAGGCATCCAGG - Intergenic
1113492156 13:110700532-110700554 AAGATCTCCTGCAGCCACCCTGG - Intronic
1114886987 14:26864837-26864859 AAGGAGTCCCTTTGCCGCCCAGG - Intergenic
1116583634 14:46674598-46674620 AAGGACTCCCTGAGCCACCCTGG - Intergenic
1119632703 14:76247733-76247755 AAGGAGGTCTTCAGACACCCAGG + Intronic
1120424852 14:84334346-84334368 AAGGAGTATTTCAGCTTCCCAGG + Intergenic
1120985749 14:90332982-90333004 AAGGTCTCCTTCTGCCACCCAGG + Intergenic
1121463503 14:94099720-94099742 TGGGAGTTCTTCAGTCACCCTGG - Intronic
1121567766 14:94923528-94923550 CAGGATCCCTTCAGCAACCCTGG + Intergenic
1122133598 14:99620209-99620231 AAAGAGTCCCTCAGCTCCCCAGG + Intergenic
1125509689 15:40286290-40286312 AGGGAGCCCTTCTGCCAGCCTGG - Intronic
1125693663 15:41617239-41617261 AAGGATTCCTTCAGCCTGCAAGG + Intergenic
1128593606 15:68925064-68925086 GAGAAGGACTTCAGCCACCCGGG - Intronic
1130211770 15:81930516-81930538 AGGGAGTCCTTGAGCCAAGCTGG + Intergenic
1132691883 16:1185414-1185436 CAGGAGTCCAGCTGCCACCCGGG - Intronic
1133223730 16:4330249-4330271 ATGGAGTCTCTCAGTCACCCAGG - Intronic
1133372808 16:5258113-5258135 AAGCAGTCCTCCATCCACCTCGG + Intergenic
1135715222 16:24758937-24758959 CAGGAGTTCTTCACCCTCCCAGG + Intronic
1136088069 16:27899689-27899711 AGGGTGTCCTTCTGTCACCCTGG - Intronic
1137781111 16:51098600-51098622 AAGGAGTCGTTTCCCCACCCAGG + Intergenic
1139563076 16:67756090-67756112 AATGATTTCTGCAGCCACCCTGG - Intronic
1141719435 16:85747547-85747569 AAAGAGACCTTCAGCCCCCCAGG - Intronic
1142177654 16:88652356-88652378 AGGGAGTCCTGCGGCCGCCCAGG - Exonic
1142613519 17:1122249-1122271 TATTATTCCTTCAGCCACCCAGG - Intronic
1142743821 17:1945117-1945139 CAGGAGTCCCCCAGACACCCTGG - Intronic
1142977722 17:3655747-3655769 AAGCTGTCCTGCAGTCACCCTGG + Intronic
1143643478 17:8213907-8213929 ATGGAGTCTCTCTGCCACCCAGG + Intergenic
1144697087 17:17312210-17312232 AAGGCATCCTTAAGCCACCACGG + Intronic
1144728193 17:17512192-17512214 AAGGAGTCCTGCACCCAGCCCGG + Intronic
1145359469 17:22200429-22200451 AAGGAGTCTTGCTGTCACCCAGG + Intergenic
1147243387 17:39105346-39105368 AAGGAGTGCTTCTCCCTCCCAGG - Intronic
1148350423 17:46937891-46937913 AGGGCCTCCTTCTGCCACCCAGG + Intronic
1148538829 17:48463485-48463507 TGGGACTCCCTCAGCCACCCAGG - Intergenic
1150621528 17:66811557-66811579 AAGGTCTCCTTCTGTCACCCAGG - Intergenic
1152234816 17:79133093-79133115 AAGGAGACCTTCTGCCTCCAGGG + Intronic
1152531547 17:80922168-80922190 AGGGAGTGCTTCATCCACCCGGG - Intronic
1152761293 17:82108353-82108375 AAGGAGTCCCCCAGCCCCTCAGG + Intronic
1153908984 18:9689947-9689969 AAGGTCTCATTCTGCCACCCAGG + Intergenic
1155918782 18:31581875-31581897 AAGAAATCCTGCAGCCACACAGG + Intergenic
1160069200 18:75610741-75610763 ATGGAGTCCTGCTGTCACCCAGG + Intergenic
1160774429 19:848523-848545 AAGGAGTCCCTGAGCCAGCAGGG - Intergenic
1161343152 19:3753618-3753640 AAGGTCTCCTTCTGTCACCCAGG - Intronic
1162117636 19:8440925-8440947 AAGGAGTCCTGGTGTCACCCCGG - Intronic
1162962368 19:14135895-14135917 ACGGAGATCTTCAGCCACCGTGG - Intronic
1165458711 19:35931390-35931412 AATGTGCCCTGCAGCCACCCTGG - Intergenic
1165995337 19:39839940-39839962 CAAGTGTCCTCCAGCCACCCTGG - Intronic
1167037370 19:47002235-47002257 AAGGTGTCCATCAGGCCCCCTGG - Exonic
1167538104 19:50068312-50068334 AAGGAGTCCCGGAGTCACCCTGG - Intergenic
1167682438 19:50932264-50932286 AGGGAGGCCCTCAGCCAGCCAGG - Intergenic
1167697548 19:51024218-51024240 ACTGAGTCCTTCCCCCACCCCGG - Exonic
1202634029 1_KI270706v1_random:27531-27553 ATGGACTCATTCTGCCACCCAGG - Intergenic
925422287 2:3722581-3722603 ATGGCGTCCTTCAGCCTCTCAGG + Intronic
925424056 2:3734218-3734240 AATGATTCATTCAGCCACCTGGG + Intronic
928293492 2:30060930-30060952 AAGCACTCCCTTAGCCACCCTGG - Intergenic
929020692 2:37549684-37549706 CATGTTTCCTTCAGCCACCCTGG + Intergenic
929525120 2:42694238-42694260 AATCACTCCTTTAGCCACCCTGG + Intronic
930108873 2:47660970-47660992 AAGGTGTCATTCTGTCACCCAGG + Intergenic
930469205 2:51792164-51792186 AAGCAGTCCCTTGGCCACCCTGG - Intergenic
935651442 2:105385680-105385702 AGGGTGTCCTTCAGCAATCCAGG + Intronic
936008791 2:108911608-108911630 AGGCAGTCCCTCAGTCACCCCGG + Intronic
936992987 2:118385880-118385902 AAGGAGGCCCTGAGCCAGCCAGG - Intergenic
937112013 2:119373700-119373722 CAGGAGTCCTTGTACCACCCAGG + Intergenic
938039138 2:128061509-128061531 AAGGGCTCCCTCTGCCACCCAGG + Intergenic
939993457 2:148898173-148898195 ATGGAGACCTTCAGGCACCTAGG + Intronic
943647172 2:190418729-190418751 AGGGGCTCCTTCTGCCACCCAGG - Intronic
946170801 2:217894251-217894273 GAGAAGTCCATCACCCACCCAGG + Intronic
947591160 2:231386814-231386836 AAGGTGTCTGTCAGCCACCGGGG + Intergenic
948679735 2:239625704-239625726 AAAGTGTCCTTCAGCCTCTCAGG - Intergenic
948922210 2:241071103-241071125 ACAGCGTCCTTCAGCCTCCCAGG - Intronic
1169232222 20:3898223-3898245 ATGGAGTCTTTCTGTCACCCAGG + Intronic
1169874621 20:10283411-10283433 AAGGACTCCTGAGGCCACCCTGG + Intronic
1170118035 20:12882522-12882544 AAGGAGTCCATCAGTATCCCAGG + Intergenic
1170580281 20:17693967-17693989 ACGGATTCCTTCAGCCACTGGGG + Intronic
1172206721 20:33167684-33167706 AAGGAGTCAGACAGCCTCCCAGG - Intronic
1173477688 20:43373408-43373430 ATGGAGTCTCTCTGCCACCCAGG - Intergenic
1173690072 20:44953787-44953809 AAGGAGTCATGCAGCAATCCAGG - Intronic
1173709651 20:45143479-45143501 AAGCACTCCTTCAGCTGCCCAGG + Intergenic
1174010353 20:47444679-47444701 AAGGTCTCATTCTGCCACCCGGG + Intergenic
1176189083 20:63799054-63799076 AAGGTGTCACTCAGTCACCCAGG + Intronic
1176227872 20:64012980-64013002 AGGGAGTCTTTCTGTCACCCAGG + Intronic
1176806242 21:13486877-13486899 AAGGTCTCCTTCTGTCACCCAGG + Intergenic
1177276038 21:18913870-18913892 AAGTACTCCCTTAGCCACCCTGG + Intergenic
1180366671 22:11945685-11945707 ATGGACTCATTCTGCCACCCAGG + Intergenic
1180793874 22:18592363-18592385 TAGGATTCCTTCCCCCACCCTGG - Intergenic
1180945453 22:19689972-19689994 AAGGTGTCACTCTGCCACCCAGG + Intergenic
1181227866 22:21402957-21402979 TAGGATTCCTTCCCCCACCCTGG + Intergenic
1181250786 22:21531882-21531904 TAGGATTCCTTCCCCCACCCTGG - Intergenic
1181711493 22:24694563-24694585 ATGGAGTCTTACAGCTACCCTGG + Intergenic
1183063650 22:35349796-35349818 AAGGAGGCCTTCAGGCAGCCTGG - Intergenic
1183404125 22:37621786-37621808 AAGGAGCCCTGCAGTGACCCGGG + Intronic
1184253486 22:43274186-43274208 AAGGACACCTCCAGCCTCCCGGG - Intronic
1184309520 22:43632109-43632131 AATGACTCCTTCAGCCTCCTAGG + Exonic
1184355732 22:43978407-43978429 AAGGAGTCTCTCTGTCACCCAGG - Intronic
1185357126 22:50380384-50380406 ATGGAGTCTCTCTGCCACCCAGG + Intronic
1185395930 22:50588224-50588246 CAGGCTTCATTCAGCCACCCAGG - Intronic
949504175 3:4711183-4711205 AAGGTCTCGTTCTGCCACCCAGG - Intronic
950196905 3:11015680-11015702 AAGGCCTCCTTCTGCCACCCTGG - Exonic
950218943 3:11179794-11179816 AAGGTGTCACTCTGCCACCCAGG + Intronic
950643969 3:14366222-14366244 GAGGAATCCTTCAGCCCCCGTGG + Intergenic
950751226 3:15129670-15129692 AAGCAGTCCTCCATCCACCTCGG + Intergenic
952639719 3:35579260-35579282 AAGCACTCCCTTAGCCACCCTGG - Intergenic
953466429 3:43124758-43124780 AAGGTCTCCTTCGGTCACCCAGG - Intergenic
953760116 3:45679997-45680019 AATCATTCCATCAGCCACCCAGG - Exonic
953941274 3:47100284-47100306 ATGGAGTCCCTCTGTCACCCAGG + Intronic
956641941 3:71423740-71423762 ACTGAGCCCTTCAGCAACCCTGG + Intronic
956656756 3:71559819-71559841 AAGGTTTCCTTCTGTCACCCAGG - Intronic
957907668 3:86578625-86578647 AAGCATTCCTTTAGCCATCCTGG + Intergenic
958197327 3:90257905-90257927 AAGGAGTCTTGCTGTCACCCAGG + Intergenic
960869948 3:122238589-122238611 AAGCACTCCCTTAGCCACCCTGG - Intronic
961283866 3:125784417-125784439 AAGCAGTCCTCCATCCACCTCGG + Intergenic
966454028 3:180094458-180094480 AAGCACTCCTTTGGCCACCCCGG + Intergenic
967023904 3:185547113-185547135 ACGGAGTCTTTCTGTCACCCAGG - Intronic
967888892 3:194351211-194351233 CTGGAGCCCTTCAGCGACCCCGG + Intronic
968342126 3:197965038-197965060 AAGGTGTCCCTCTGTCACCCAGG + Intronic
969013837 4:4089784-4089806 AAGTAGTCCTCCATCCACCTTGG - Intergenic
969740147 4:9018645-9018667 AAGCAGTCCTCCATCCACCTCGG + Intergenic
969799312 4:9550160-9550182 AAGCAGTCCTCCATCCACCTCGG + Intergenic
971274591 4:25183703-25183725 AAGGAGTCCTTCAGCCTAGTAGG - Intronic
972144600 4:36007020-36007042 AAGGACTCCTTCTGTCACCCAGG - Intronic
974014172 4:56634023-56634045 AGGGTGTCCCTCAGTCACCCAGG - Intergenic
975369558 4:73568722-73568744 AAGCACTCCCTTAGCCACCCTGG + Intergenic
976107491 4:81634634-81634656 AAGAAGTTCTTCAGCAACACTGG + Intronic
976817312 4:89163936-89163958 AAGGTCTCCTTCTGTCACCCAGG + Intergenic
977325070 4:95564614-95564636 AAGGAGACCATCAGAGACCCAGG - Intergenic
977862991 4:101989097-101989119 AAGGACTGCTTGAGCCAGCCTGG + Intronic
978691097 4:111511646-111511668 CAGGTGTCCTTCTGTCACCCAGG + Intergenic
978934684 4:114359972-114359994 AAGGATTCCCTTGGCCACCCAGG + Intergenic
979253374 4:118588121-118588143 AGGGAGTCCCTCAGCTACTCAGG + Intergenic
980982206 4:139664497-139664519 AAGGTGTCCTTCTGCAAACCAGG + Intergenic
984774827 4:183472397-183472419 AAGGGATCCTTTAGCCACCAGGG + Intergenic
984952076 4:185015517-185015539 ATGGGGGCCTTCAGGCACCCAGG - Intergenic
985229400 4:187798904-187798926 AAGCACTCCCTTAGCCACCCTGG - Intergenic
987836165 5:23165440-23165462 AAGGTGTCATTCTGTCACCCAGG - Intergenic
987970442 5:24937426-24937448 AAGGAGTCACTCTGTCACCCAGG + Intergenic
989087015 5:37686287-37686309 AGGGTGTCCTTCTGTCACCCAGG - Intronic
994665273 5:102697262-102697284 AAGGAGGCCTTAAACCAGCCTGG - Intergenic
1000778711 5:165452403-165452425 CCGGAGTCCTTCAGCTTCCCTGG + Intergenic
1001990889 5:176114533-176114555 CAGGAGTCCTTCAGCCTCTGGGG + Exonic
1002225985 5:177723607-177723629 CAGGAGTCCTTCAGCCTCTGGGG - Exonic
1002267862 5:178047603-178047625 CAGGAGTCCTTCAGCCTCTGGGG + Exonic
1002644587 5:180646890-180646912 CAGGACTCCTTCAGCCACACTGG + Intronic
1005071312 6:21864995-21865017 AAGGTTTCCTTCTGTCACCCAGG + Intergenic
1005279943 6:24262523-24262545 AAGCACTCCCTTAGCCACCCTGG - Intronic
1007395673 6:41576246-41576268 AAGGTGTCCTGCAGCAAACCTGG - Intronic
1007854501 6:44840798-44840820 TAGAAGCCCTTTAGCCACCCAGG + Intronic
1008284411 6:49630003-49630025 GAGGAGCCCTTCAGCCCACCAGG - Intronic
1008416533 6:51247277-51247299 AAGTAGTCCCTCAGTCACACGGG - Intergenic
1010280632 6:74018941-74018963 AAGCACTCCCTTAGCCACCCAGG - Intergenic
1014451557 6:121587551-121587573 AAGGATTGCTTGAGCCCCCCTGG - Intergenic
1014644782 6:123959385-123959407 CAGGAGTCCTTCAGGCAACTAGG + Intronic
1016912841 6:149215855-149215877 ATACAGTCCTTCAGCCATCCCGG - Intergenic
1017064643 6:150517980-150518002 AAGGGGTCCTCCTGCCTCCCCGG + Intergenic
1018332088 6:162740623-162740645 ATGGACTCGCTCAGCCACCCAGG + Intronic
1019333929 7:473766-473788 CAGGAGTCCAACAGCCAACCAGG + Intergenic
1019505071 7:1386536-1386558 CGGGGGTCCTGCAGCCACCCCGG + Intergenic
1023436402 7:40144527-40144549 AAGGAAAACTCCAGCCACCCTGG - Intronic
1024195583 7:47055440-47055462 CAGGTCTCCTTCTGCCACCCAGG + Intergenic
1027882805 7:83863425-83863447 AAGGAGGCCTTCTGCAAACCAGG + Intergenic
1028899522 7:96081042-96081064 ATGGAGTCTCTCTGCCACCCAGG - Intronic
1028929615 7:96398108-96398130 AAGTACTCCCTTAGCCACCCCGG + Intergenic
1028985810 7:97007246-97007268 AAGCTGTGCTTGAGCCACCCAGG - Intronic
1029072491 7:97911403-97911425 AAGCAGTCCTCCATCCACCTCGG - Intergenic
1029175234 7:98659879-98659901 GATGAGTCCCTCAGCCTCCCAGG + Intergenic
1030900738 7:115120321-115120343 AAGGTCTCCTTCTGCCACCCAGG - Intergenic
1031441748 7:121803178-121803200 AAGGAGTGCTTCAGTAACCTTGG + Intergenic
1032138854 7:129308073-129308095 AAGCACTCCCTTAGCCACCCTGG + Intronic
1032193138 7:129775704-129775726 GAGAAGTCCTGCAGCCACCCAGG + Intergenic
1033661502 7:143406169-143406191 AAGGTTGCCTTCTGCCACCCAGG - Intronic
1033975387 7:147094425-147094447 AAGGAGTCTTGCTGTCACCCAGG + Intronic
1034003502 7:147442989-147443011 AAGCACTCCTTTAGCCACCCTGG + Intronic
1034386554 7:150745377-150745399 AGGGAGACCTGCAGCCATCCCGG - Intronic
1036245174 8:7109899-7109921 AAGCAGTCCTCCATCCACCTTGG + Intergenic
1036889060 8:12583428-12583450 AAGCAGTCCTCCATCCACCTCGG - Intergenic
1036896643 8:12641572-12641594 AAGCAGTCCTCCATCCACCTCGG - Intergenic
1039691499 8:39869619-39869641 ATGGAGTCTTTCTGTCACCCAGG - Intergenic
1040278649 8:46026507-46026529 AAGGAGACCTTGAGGCAGCCAGG - Intergenic
1041210555 8:55546531-55546553 CAAGACTCCTTCAGCAACCCCGG - Intergenic
1042765571 8:72317746-72317768 AAGTGGTTCTGCAGCCACCCTGG + Intergenic
1044778875 8:95722986-95723008 ATGGAGTCATTCTGTCACCCAGG - Intergenic
1045494009 8:102692971-102692993 AAGGAGCCCTTCAGTCAACAAGG - Intergenic
1046304511 8:112346702-112346724 AAGGAGTCTCTCTGTCACCCAGG + Intronic
1046954211 8:120046664-120046686 AAGGATTGCTTGAGCCAGCCTGG - Intronic
1047268055 8:123326926-123326948 ATGGAGTCTTTCTGTCACCCAGG + Intronic
1050355687 9:4780895-4780917 AAGCAGTCCCTTAGCCATCCTGG - Intergenic
1051229951 9:14945587-14945609 AAGCTCTCCTTTAGCCACCCTGG - Intergenic
1051669331 9:19494432-19494454 AGGAAGTCCTGCAGCCACCTGGG + Intergenic
1052963689 9:34321935-34321957 AAGGAGTCCTACAGCTAGCCAGG + Intronic
1056628988 9:88277208-88277230 AGGGAGTCTTTCTGTCACCCAGG + Intergenic
1057833498 9:98425840-98425862 GAGGAGGCCTACAGCCAACCCGG - Intronic
1059661780 9:116408616-116408638 AAGGACTCATCCAACCACCCAGG - Intergenic
1061361630 9:130146635-130146657 AAGGTCTCCTTCTGTCACCCAGG + Intergenic
1061551161 9:131335422-131335444 AAGGTGTCATTCTGTCACCCAGG + Intergenic
1061638193 9:131928885-131928907 AAGCACTCCCTTAGCCACCCAGG - Intronic
1061751324 9:132779345-132779367 AAGGTCTCCTTCTGTCACCCAGG + Intronic
1062544852 9:137057152-137057174 ATGGGGTCCTGCTGCCACCCTGG - Intergenic
1062631732 9:137466130-137466152 ACTGAGTCCTTCAGGCACGCTGG - Intronic
1186932769 X:14412884-14412906 AAGCATTCCCTTAGCCACCCAGG - Intergenic
1187613830 X:20971918-20971940 AAGGAGCCCAGCAGACACCCTGG - Intergenic
1190326369 X:49209478-49209500 AAGGAGTCCTTCAGCCACCCTGG + Intronic
1192640418 X:72857020-72857042 AAGCACTCCCTTAGCCACCCTGG - Intergenic
1192641293 X:72863756-72863778 AAGCACTCCCTTAGCCACCCTGG + Intergenic
1193650248 X:84122863-84122885 AAGTACTCCCTTAGCCACCCTGG - Intronic
1194251856 X:91585660-91585682 AAGCACTCCCTTAGCCACCCTGG - Intergenic
1195642729 X:107194840-107194862 ACGGTCTCCTTCAGTCACCCAGG + Intronic
1195662699 X:107396707-107396729 AAGCACTCCCTTAGCCACCCTGG + Intergenic
1197670659 X:129273476-129273498 AAGCATTCCTTTGGCCACCCTGG + Intergenic
1199872409 X:151911967-151911989 AACGGGTGCTGCAGCCACCCAGG + Intergenic
1199922596 X:152424956-152424978 AGGGTGTCATTCTGCCACCCGGG + Intronic
1200570788 Y:4826891-4826913 AAGCACTCCCTTAGCCACCCTGG - Intergenic