ID: 1190327360

View in Genome Browser
Species Human (GRCh38)
Location X:49215044-49215066
Sequence TAGGGTCAGGAGTCTGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 6, 3: 12, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190327352_1190327360 -1 Left 1190327352 X:49215022-49215044 CCAAGGGATTATGTGGAGATAAT 0: 1
1: 0
2: 0
3: 9
4: 178
Right 1190327360 X:49215044-49215066 TAGGGTCAGGAGTCTGGCGGGGG 0: 1
1: 0
2: 6
3: 12
4: 178
1190327351_1190327360 0 Left 1190327351 X:49215021-49215043 CCCAAGGGATTATGTGGAGATAA 0: 1
1: 0
2: 2
3: 12
4: 158
Right 1190327360 X:49215044-49215066 TAGGGTCAGGAGTCTGGCGGGGG 0: 1
1: 0
2: 6
3: 12
4: 178
1190327348_1190327360 10 Left 1190327348 X:49215011-49215033 CCCAATGGTTCCCAAGGGATTAT 0: 1
1: 0
2: 0
3: 10
4: 140
Right 1190327360 X:49215044-49215066 TAGGGTCAGGAGTCTGGCGGGGG 0: 1
1: 0
2: 6
3: 12
4: 178
1190327345_1190327360 21 Left 1190327345 X:49215000-49215022 CCTTAAATGTTCCCAATGGTTCC 0: 1
1: 0
2: 1
3: 11
4: 139
Right 1190327360 X:49215044-49215066 TAGGGTCAGGAGTCTGGCGGGGG 0: 1
1: 0
2: 6
3: 12
4: 178
1190327349_1190327360 9 Left 1190327349 X:49215012-49215034 CCAATGGTTCCCAAGGGATTATG 0: 1
1: 0
2: 1
3: 11
4: 135
Right 1190327360 X:49215044-49215066 TAGGGTCAGGAGTCTGGCGGGGG 0: 1
1: 0
2: 6
3: 12
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190327360 Original CRISPR TAGGGTCAGGAGTCTGGCGG GGG Intronic
904092653 1:27956079-27956101 GAAGGTCAGGAGTCCTGCGGAGG + Exonic
904285591 1:29451566-29451588 TCGCGTCAGGAGTCTGGGGAAGG - Intergenic
904289780 1:29477483-29477505 ATGGGTCAGGAGTCTGGCATAGG + Intergenic
904419836 1:30384481-30384503 TTGTGTCAGGAGTCTGGGGAAGG + Intergenic
905306139 1:37019619-37019641 TAGGGTCAGGGGATTTGCGGGGG - Intronic
907677070 1:56527992-56528014 TAGGGGCAGGAGTCTGGGAGTGG - Intronic
907920461 1:58906456-58906478 TAGGGTTTGGAGTGTGGTGGAGG + Intergenic
908594163 1:65668113-65668135 ATGGGTCAGGAGTCTGGCCATGG + Intergenic
912769007 1:112445229-112445251 GAGGGTCAGGAATCTGGGAGGGG - Intronic
915354292 1:155246704-155246726 TAGGGGAAGGAGTCTGATGGGGG + Intergenic
915436573 1:155911216-155911238 AGGGGTGGGGAGTCTGGCGGCGG - Intronic
921494647 1:215824499-215824521 TAGTGTGAGGAGGCTGGCTGAGG + Intronic
922052882 1:222011071-222011093 TAGGGTCAGGAATTTGGAAGTGG + Intergenic
922978746 1:229806736-229806758 AAGGGACGGGAGTCTGGCTGGGG + Intergenic
1065882324 10:30047478-30047500 TTGACTCAGGAGTTTGGCGGTGG - Intronic
1066952311 10:42132864-42132886 GAGGGTCAGAGGTCTGGCTGTGG + Intergenic
1072147873 10:92658820-92658842 TAGAGTCAGCAGACTGGTGGTGG + Intergenic
1072958360 10:99906805-99906827 GTAGGTCAGGAGTCTGGAGGTGG - Intronic
1073059924 10:100727557-100727579 TGGAGTCAGCAGTCTGGAGGTGG - Intergenic
1073512734 10:104052734-104052756 GAGGGTGAGGAGTCAGGCCGAGG - Intronic
1074702672 10:116106209-116106231 TAGGGTCAGAAGTCTGACTCGGG - Intronic
1076743352 10:132499289-132499311 GAGCGACAGGAGGCTGGCGGGGG + Intergenic
1081913787 11:46718356-46718378 GAGGGACAGGAGTAGGGCGGAGG + Intergenic
1082777052 11:57253816-57253838 CTGGGTCAGGAGCCTGGCTGTGG - Intergenic
1085218531 11:74852835-74852857 AGGGGTCAGGAGTCAGGCAGTGG + Intronic
1085806958 11:79645179-79645201 GAGGTTCAGGAGACTGGCTGGGG + Intergenic
1088401317 11:109424132-109424154 TGGGGACTGGAGGCTGGCGGTGG - Exonic
1091239439 11:134042735-134042757 TTGGGGCAGGGGTCTGGGGGTGG - Intergenic
1091302157 11:134514691-134514713 TAGGGTCAGGAGGCGGGAGTGGG - Intergenic
1097120428 12:56727214-56727236 TACGGTCAGGAGTCCGGGCGGGG - Intronic
1102620320 12:114189381-114189403 TAGGATGATGAGTCTGGCAGAGG + Intergenic
1102673713 12:114641945-114641967 TAGGTCCAGGAGCCTGGAGGAGG - Intergenic
1105257906 13:18756803-18756825 TATGGACAGGAGTTTGGTGGTGG - Intergenic
1106229926 13:27813950-27813972 CAGGGGCAGGAGGGTGGCGGGGG - Intergenic
1109264883 13:60186731-60186753 TTGGGTCAAGAGTCTGGATGTGG + Intergenic
1113793433 13:113042735-113042757 TTGGGTCACGGGTCTGGGGGAGG + Intronic
1119683002 14:76606823-76606845 TAGGGTCAGGGGTTTGGGGGTGG + Intergenic
1120946204 14:89999954-89999976 GTGGGTCAGGAGTCTGGGCGTGG + Intronic
1121434306 14:93908933-93908955 GTGGGTCAGGAGTCTGGGAGTGG + Intergenic
1122873059 14:104650383-104650405 GAGGGTCCGCAGTCAGGCGGGGG - Intergenic
1123115742 14:105893289-105893311 TAGGGTGGGCAGCCTGGCGGGGG - Intergenic
1128093878 15:64938432-64938454 TGGGGTTAGGAGTTTGGGGGAGG - Intronic
1128300404 15:66563397-66563419 TAGGGTCTGGATTCTGGCGCAGG - Intronic
1129656763 15:77529708-77529730 TCAGGTCAGGAGTCTGGGAGGGG + Intergenic
1129986979 15:79926530-79926552 TGGGCTCCTGAGTCTGGCGGGGG + Intergenic
1132591200 16:727172-727194 CCGGGTCAGGGGTCTTGCGGCGG + Intronic
1133131210 16:3677078-3677100 TAGGGTGAGGAGCCTGCTGGGGG - Intronic
1134476873 16:14581627-14581649 AAGGGTCAGGAGGCTGGGTGCGG + Intronic
1135157080 16:20061743-20061765 TAGGGTCAGGCGTGGGGAGGAGG - Intronic
1135984548 16:27174456-27174478 CAGGGTCTGGAATCTGGGGGAGG - Intergenic
1137002802 16:35246010-35246032 CAGGGCCAGGAGTGTGGCTGAGG + Intergenic
1137512490 16:49113948-49113970 AAGGGTCAGGAATCTGGAAGTGG + Intergenic
1138198893 16:55074423-55074445 AAGGGCCAGGAGGGTGGCGGTGG + Intergenic
1138412620 16:56851979-56852001 TAGGGTCAGTGGTGTGGTGGGGG - Intergenic
1139531117 16:67543141-67543163 TGGGGACAGGAGCCTGGAGGAGG + Exonic
1140749096 16:78007227-78007249 AAGGGTCAGGAGTTTGGGAGTGG + Intergenic
1141495902 16:84409299-84409321 TAGGGTCAGGGGGCTGGGGGAGG + Intronic
1142033825 16:87851764-87851786 CAGGGCCAGGAGCTTGGCGGCGG + Exonic
1142242589 16:88954377-88954399 TAGGGTCAGGAGTCTTGGGTGGG - Intronic
1142242595 16:88954396-88954418 TGGGGTCAGGAGTCTTGGGTAGG - Intronic
1142242963 16:88955612-88955634 TAGGGTCAGGAGCCTTGGGTGGG - Intronic
1142337981 16:89502542-89502564 GAGGGTCAGGAATCTGGGAGTGG - Intronic
1145232203 17:21181466-21181488 AAGGGTCTGGTGTCTGGCAGGGG + Intronic
1146496485 17:33327148-33327170 TACGGTCAGAAGTGTGGTGGAGG - Intronic
1148919631 17:51019183-51019205 CAGGGTCAGGTGTCTGGTGAGGG - Intronic
1149523547 17:57336855-57336877 GAGGGTCAGGAATCTGGAGTGGG + Intronic
1151715998 17:75831336-75831358 CAGGGTCAGGAGGCTGGGGCGGG + Exonic
1151733705 17:75926011-75926033 CAGGGTAAGGAGGCTTGCGGGGG - Exonic
1152030657 17:77840615-77840637 GTGGGTCAGGAGTCTGGGTGTGG + Intergenic
1152441420 17:80312434-80312456 CCGGGTCAGGAGCCTGGCTGTGG + Intronic
1152441447 17:80312521-80312543 CCGGGTCAGGAGCCTGGCTGTGG + Intronic
1152741484 17:82020320-82020342 TTGGGTCTGGAGGCTGGAGGTGG + Intronic
1155659283 18:28228717-28228739 TAGAGGCAGCAGCCTGGCGGGGG - Intergenic
1157438818 18:47694243-47694265 TAGGGGCAGGATTCTGGAGTTGG + Intergenic
1157712610 18:49860216-49860238 TAGGGGCAGGAGTGTGGCCAGGG - Intronic
1160750915 19:734087-734109 TGGGGTCAGGAGCCTGGGGAGGG - Intronic
1160917903 19:1506522-1506544 TAGGGTCAGAGGTCAGGAGGAGG + Intronic
1161872270 19:6879275-6879297 GAGGATCAGGAGTCTGGGGGTGG + Intergenic
1162869045 19:13571947-13571969 TAAGGCCTGGAGTCTGGTGGTGG - Intronic
1162892083 19:13740961-13740983 TTGGGTCAGGAATCTGGGTGTGG - Intronic
1163386054 19:17001361-17001383 TCGGGTCAGCACACTGGCGGGGG + Intronic
1163675169 19:18652086-18652108 TGGGCTCAGGAGTGTGGTGGAGG + Intronic
1164455858 19:28406023-28406045 TATGGGCAGGAGTGTGGCAGTGG - Intergenic
1165092210 19:33393238-33393260 TGGGGTCTGGGGTCTGGCGTGGG + Intronic
1166228932 19:41414300-41414322 CAGGGTTAGGACTCTGGAGGGGG + Intronic
1167038433 19:47008136-47008158 AAGGGTCAGGAGTTTGGCTGTGG - Intergenic
1168176448 19:54631157-54631179 TAGGGACAAGAGTTTGGCTGTGG - Intronic
925019267 2:555777-555799 TGGGGTCTGGAGGCTGGCAGAGG - Intergenic
926044262 2:9698292-9698314 AAGGGTCAGAAGGCTGGCGAGGG + Intergenic
927313980 2:21660863-21660885 TAGTGTCAGAAGTCGGGCGGGGG - Intergenic
927357162 2:22186754-22186776 TAGGCTCCTGAGTCTGGTGGGGG + Intergenic
932836470 2:75042645-75042667 TGGGGTCAGGAGTGTGGAGTGGG - Intergenic
935847661 2:107184281-107184303 GTGGGTCAGGAGTCTGGATGTGG + Intergenic
936959815 2:118061321-118061343 TAGGGGCAGGAGCCTGAGGGTGG - Intergenic
940254794 2:151717683-151717705 TAGGGCCATGAGTCTTGAGGAGG - Intronic
943091270 2:183377640-183377662 TGGGGCCTGGAGTCTGGCTGTGG - Intergenic
944661055 2:201921987-201922009 TAGGGTCAGGGGTCAGGGAGCGG - Intergenic
1169201471 20:3712366-3712388 TAGGGGCAGGGGTCGGGGGGGGG - Intergenic
1170218436 20:13916513-13916535 AAGGGTCAGGAGGCTGGGCGTGG + Intronic
1170425861 20:16235006-16235028 TAGTGTCAGGATTCTGACAGTGG + Intergenic
1171128735 20:22628269-22628291 TAGGGGCCAGTGTCTGGCGGTGG + Intergenic
1175138361 20:56841731-56841753 CAGGGACAGGCGTCTGGAGGAGG + Intergenic
1175714855 20:61248401-61248423 GAGGGTCAGGATTCTGCTGGTGG + Intergenic
1175873453 20:62219020-62219042 TAGGGGCTGGAGTCCAGCGGGGG - Intronic
1176231164 20:64033719-64033741 TGAGGTCAGGAGTTTGGCAGCGG - Intronic
1176326130 21:5502653-5502675 TAAGGGCAGGAGTCAGGCGAGGG - Intergenic
1176331576 21:5553533-5553555 TAGGGGCAGGAGTCAGGCGGGGG + Intergenic
1176396181 21:6267418-6267440 TAGGGGCAGGAGTCAGGCGGGGG - Intergenic
1176401627 21:6318298-6318320 TAAGGGCAGGAGTCAGGCGAGGG + Intergenic
1176435530 21:6670806-6670828 TAAGGGCAGGAGTCAGGCGAGGG - Intergenic
1176440976 21:6721686-6721708 TAGGGGCAGGAGTCAGGCGGGGG + Intergenic
1176459792 21:6997876-6997898 TAAGGGCAGGAGTCAGGCGAGGG - Intergenic
1176465238 21:7048755-7048777 TAGGGGCAGGAGTCAGGCGGGGG + Intergenic
1176483353 21:7379654-7379676 TAAGGGCAGGAGTCAGGCGAGGG - Intergenic
1176488799 21:7430533-7430555 TAGGGGCAGGAGTCAGGCGGGGG + Intergenic
1178396280 21:32246457-32246479 TTGGTTTAGGAGTCTGGCAGGGG + Intergenic
1179049263 21:37874849-37874871 TTGGGTCAGGAGGGTGGCAGTGG - Intronic
1179970830 21:44836115-44836137 TGGGGTCAGGGGTGTGGTGGGGG - Intergenic
1179970897 21:44836252-44836274 TGGGGTCAGGGGTGTGGTGGGGG - Intergenic
1180701455 22:17783582-17783604 TAGGGGGAGGAGGCTGGGGGTGG + Intergenic
1181024999 22:20123011-20123033 TTGGGTGTGGTGTCTGGCGGGGG + Intronic
1181390308 22:22576014-22576036 AAGGGTCAGGGGTCAGGCTGGGG - Intergenic
1181593369 22:23897745-23897767 TGGGGTCTGGAGGCTGGCGGTGG - Intronic
1183539138 22:38419481-38419503 GAGGGTCAGGAGCCTGGCTCTGG + Intergenic
1183654024 22:39174871-39174893 AAGGGGCAGGGGTCTGGAGGGGG + Intergenic
1185399907 22:50610383-50610405 TGGGGGCAGGAGCCTGGCAGGGG + Intronic
1185402195 22:50625068-50625090 GAGGCTCAGGTGTCTGGAGGGGG - Exonic
949579338 3:5371619-5371641 AAGGGTTAGGAGGCTGGTGGAGG - Intergenic
952955219 3:38552744-38552766 TAGGGTCAGGAATCTCTGGGGGG - Intronic
953807681 3:46085605-46085627 CAAGGTCAGGAGTCTGGCCTTGG + Intergenic
954218221 3:49136153-49136175 AAGGGCCAGGAGGCTGGAGGTGG - Intergenic
955226208 3:57062434-57062456 TAGGCTCAGGAGCACGGCGGCGG + Intronic
959826789 3:110806857-110806879 TTGGGTCAGGAGTCAGGTTGGGG - Intergenic
961654568 3:128433938-128433960 TAGTGTCAGGAGTCAGGCCTGGG + Intergenic
967723661 3:192841673-192841695 GAGGGTCAGGAATCTGGGAGTGG - Intronic
968523664 4:1045862-1045884 TGGAGTTCGGAGTCTGGCGGAGG + Intergenic
971495950 4:27265401-27265423 AAGGGTCAGGAATCTGGAAGTGG - Intergenic
972900487 4:43675858-43675880 GTGGGTCAGGAATCTGGAGGTGG - Intergenic
973888462 4:55346404-55346426 TAGGGTCAGCAGGAAGGCGGCGG - Exonic
976186766 4:82449823-82449845 TGGGGTGAGGAGTCTGGAAGGGG - Intronic
981039898 4:140213420-140213442 GTGGGTCAGGAGTCTGGGTGGGG + Intergenic
982536254 4:156609724-156609746 GTGGGTCAGGAATCTGGCTGTGG - Intergenic
985350418 4:189055494-189055516 TCAGGTCAGGAGGCGGGCGGTGG + Intergenic
986690794 5:10312079-10312101 GAGGTTCAGGAGTCTGGGAGTGG - Intergenic
986691226 5:10315545-10315567 GAGGGTCAGGAATCTGGGGGTGG - Intergenic
987633418 5:20506647-20506669 GTGGGTCAGGAGTCTGGGTGTGG - Intronic
989707754 5:44358011-44358033 TAAAGTCAGGAGTCTTGAGGGGG + Intronic
995280614 5:110331425-110331447 ATGGGTCAGGAGTCTGGATGTGG - Intronic
997197124 5:131987675-131987697 TAGGTCCAGGAGTCTGGGAGAGG - Intronic
997309354 5:132866774-132866796 CAGGGGCAGGAGTCTGGGGTTGG + Intronic
997803718 5:136892217-136892239 TGAGGTCTGGAGTCTGTCGGCGG - Intergenic
998892769 5:146764207-146764229 TAGGGACCTGAGTCTGGAGGGGG + Intronic
1002649318 5:180680178-180680200 TCGGGTGAGGAGTCTGCAGGGGG - Intergenic
1003148744 6:3530982-3531004 AAGAGGCAGGAGTATGGCGGGGG + Intergenic
1003264345 6:4552351-4552373 TAGGCTGAGGAGTTTGGAGGAGG - Intergenic
1004527049 6:16418790-16418812 TAGCGTTAGGAGTATTGCGGTGG - Intronic
1005503410 6:26449849-26449871 CAGGGTCAGGAGTCTCTCAGAGG - Intronic
1005882013 6:30069252-30069274 AAGGGTCAGGAGGCTGGGGAGGG - Exonic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006402223 6:33824591-33824613 TAGGGCCAGGAGGCTGGGTGCGG + Intergenic
1007736838 6:43987223-43987245 TAGGCTCAGGAGCCAGGAGGTGG - Intergenic
1014570174 6:122997686-122997708 TGGGGGCTGGAGTCTGGTGGTGG + Exonic
1020091435 7:5344483-5344505 CAGGGTCTGGAGCCTGGCGTGGG + Intronic
1021560926 7:21968028-21968050 GAGGGTCGGGAGTCTGGGAGTGG - Intergenic
1022715115 7:32891793-32891815 CCGGGGGAGGAGTCTGGCGGTGG - Exonic
1026405273 7:70058920-70058942 TAGGGTGAGGGGTATGGTGGGGG - Intronic
1026910171 7:74086952-74086974 TAGGGTCAGGGTTGTGGCGGAGG + Intronic
1033302262 7:140196944-140196966 TTGGGTCAGGAGTCTGGGCATGG - Intergenic
1034901691 7:154911674-154911696 GAGGGCCAGGAATCTGGCTGAGG - Intergenic
1035187836 7:157139545-157139567 TGGGGCCAGGACTCTGGCTGGGG + Intronic
1035402311 7:158574933-158574955 GAGGGTGAGTAGTCTGGTGGTGG - Intronic
1036553145 8:9832888-9832910 GTGGGTCAGGAATCTGGCTGTGG + Intergenic
1036740469 8:11356809-11356831 TAGGTTCAGGACTCTGGCCAAGG - Intergenic
1037150040 8:15626144-15626166 TAGGCTCAGGAGGGTGGGGGTGG - Intronic
1039235164 8:35495050-35495072 GAGGGTCAGGATTCTGGCCCAGG + Intronic
1039286561 8:36048165-36048187 ATGGGTCAGGAGTCTGGGTGTGG + Intergenic
1044621992 8:94199813-94199835 TAGGGCCACGAGTCAGCCGGTGG - Intronic
1046608897 8:116402648-116402670 TTGGGTCAGGAGTCTGGGTATGG + Intergenic
1048726525 8:137391637-137391659 AAGGGTCAGTAGTATGGCTGGGG + Intergenic
1049795773 8:144496699-144496721 TAGGCTCAGGAGCCTGGGTGGGG - Exonic
1051609174 9:18944785-18944807 TAGGGTCCTGAGCCTGGCAGTGG + Intronic
1056394416 9:86168458-86168480 TAGGGAGGGGAGTCTGGCCGTGG + Intergenic
1056564839 9:87761927-87761949 TAGGGTCAGCTGCCTGGAGGTGG + Intergenic
1056726394 9:89122783-89122805 TAGGGTGGGGAGTCAGGTGGGGG + Intronic
1057365892 9:94420360-94420382 GAGGGGCAGGAGTCTGGTAGCGG + Intronic
1061609307 9:131735753-131735775 TATGGGCAGGAGTCAGGTGGCGG - Intronic
1203430523 Un_GL000195v1:86801-86823 TAGGGGCAGGAGTCAGGCGGGGG - Intergenic
1186817676 X:13253839-13253861 TAGGGAAAGGAAACTGGCGGAGG - Intergenic
1187505375 X:19874699-19874721 GAGGGTCAGGAGGCTGGGGGTGG + Intronic
1189248362 X:39580870-39580892 AAGGGAAAGGAGTCTGGGGGAGG - Intergenic
1190327360 X:49215044-49215066 TAGGGTCAGGAGTCTGGCGGGGG + Intronic
1195295282 X:103470410-103470432 TAGGTTAAGTAGTCTGGCTGGGG - Intergenic
1196464370 X:115958053-115958075 ATGGCTCAGGAGTCTGGTGGTGG - Intergenic
1197336061 X:125210722-125210744 TATGGTCAGGAGTCCCCCGGAGG + Intergenic
1197727982 X:129788761-129788783 ACGGGGCAGGAGGCTGGCGGGGG + Intronic
1198268622 X:135033161-135033183 TAGGAGCAGCAGTCTGTCGGTGG - Exonic
1199000697 X:142632846-142632868 CAGGGGCAGGACACTGGCGGGGG + Intergenic