ID: 1190335274

View in Genome Browser
Species Human (GRCh38)
Location X:49258232-49258254
Sequence AGGTCGGCACCTGTAGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 184}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190335269_1190335274 -7 Left 1190335269 X:49258216-49258238 CCCAGTGCCACAGTAAAGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 60
Right 1190335274 X:49258232-49258254 AGGTCGGCACCTGTAGGTCCAGG 0: 1
1: 0
2: 2
3: 11
4: 184
1190335271_1190335274 -8 Left 1190335271 X:49258217-49258239 CCAGTGCCACAGTAAAGGTCGGC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1190335274 X:49258232-49258254 AGGTCGGCACCTGTAGGTCCAGG 0: 1
1: 0
2: 2
3: 11
4: 184
1190335259_1190335274 12 Left 1190335259 X:49258197-49258219 CCAGCCAGCCCCCCTCCCGCCCA 0: 1
1: 2
2: 7
3: 119
4: 1393
Right 1190335274 X:49258232-49258254 AGGTCGGCACCTGTAGGTCCAGG 0: 1
1: 0
2: 2
3: 11
4: 184
1190335262_1190335274 3 Left 1190335262 X:49258206-49258228 CCCCCTCCCGCCCAGTGCCACAG 0: 1
1: 0
2: 2
3: 27
4: 403
Right 1190335274 X:49258232-49258254 AGGTCGGCACCTGTAGGTCCAGG 0: 1
1: 0
2: 2
3: 11
4: 184
1190335266_1190335274 -3 Left 1190335266 X:49258212-49258234 CCCGCCCAGTGCCACAGTAAAGG 0: 1
1: 0
2: 0
3: 8
4: 149
Right 1190335274 X:49258232-49258254 AGGTCGGCACCTGTAGGTCCAGG 0: 1
1: 0
2: 2
3: 11
4: 184
1190335258_1190335274 13 Left 1190335258 X:49258196-49258218 CCCAGCCAGCCCCCCTCCCGCCC 0: 1
1: 0
2: 5
3: 111
4: 1244
Right 1190335274 X:49258232-49258254 AGGTCGGCACCTGTAGGTCCAGG 0: 1
1: 0
2: 2
3: 11
4: 184
1190335257_1190335274 14 Left 1190335257 X:49258195-49258217 CCCCAGCCAGCCCCCCTCCCGCC 0: 1
1: 0
2: 15
3: 152
4: 1476
Right 1190335274 X:49258232-49258254 AGGTCGGCACCTGTAGGTCCAGG 0: 1
1: 0
2: 2
3: 11
4: 184
1190335264_1190335274 1 Left 1190335264 X:49258208-49258230 CCCTCCCGCCCAGTGCCACAGTA 0: 1
1: 0
2: 1
3: 12
4: 138
Right 1190335274 X:49258232-49258254 AGGTCGGCACCTGTAGGTCCAGG 0: 1
1: 0
2: 2
3: 11
4: 184
1190335260_1190335274 8 Left 1190335260 X:49258201-49258223 CCAGCCCCCCTCCCGCCCAGTGC 0: 1
1: 1
2: 13
3: 103
4: 924
Right 1190335274 X:49258232-49258254 AGGTCGGCACCTGTAGGTCCAGG 0: 1
1: 0
2: 2
3: 11
4: 184
1190335261_1190335274 4 Left 1190335261 X:49258205-49258227 CCCCCCTCCCGCCCAGTGCCACA 0: 1
1: 0
2: 1
3: 48
4: 457
Right 1190335274 X:49258232-49258254 AGGTCGGCACCTGTAGGTCCAGG 0: 1
1: 0
2: 2
3: 11
4: 184
1190335265_1190335274 0 Left 1190335265 X:49258209-49258231 CCTCCCGCCCAGTGCCACAGTAA 0: 1
1: 0
2: 2
3: 7
4: 133
Right 1190335274 X:49258232-49258254 AGGTCGGCACCTGTAGGTCCAGG 0: 1
1: 0
2: 2
3: 11
4: 184
1190335263_1190335274 2 Left 1190335263 X:49258207-49258229 CCCCTCCCGCCCAGTGCCACAGT 0: 1
1: 0
2: 3
3: 16
4: 269
Right 1190335274 X:49258232-49258254 AGGTCGGCACCTGTAGGTCCAGG 0: 1
1: 0
2: 2
3: 11
4: 184
1190335256_1190335274 20 Left 1190335256 X:49258189-49258211 CCTGTGCCCCAGCCAGCCCCCCT 0: 1
1: 0
2: 4
3: 65
4: 732
Right 1190335274 X:49258232-49258254 AGGTCGGCACCTGTAGGTCCAGG 0: 1
1: 0
2: 2
3: 11
4: 184
1190335268_1190335274 -4 Left 1190335268 X:49258213-49258235 CCGCCCAGTGCCACAGTAAAGGT 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1190335274 X:49258232-49258254 AGGTCGGCACCTGTAGGTCCAGG 0: 1
1: 0
2: 2
3: 11
4: 184
1190335255_1190335274 26 Left 1190335255 X:49258183-49258205 CCACTTCCTGTGCCCCAGCCAGC 0: 1
1: 0
2: 6
3: 64
4: 717
Right 1190335274 X:49258232-49258254 AGGTCGGCACCTGTAGGTCCAGG 0: 1
1: 0
2: 2
3: 11
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190335274 Original CRISPR AGGTCGGCACCTGTAGGTCC AGG Intronic
900165897 1:1244235-1244257 ACTTCTGCACCTGGAGGTCCTGG + Exonic
900848155 1:5120365-5120387 TGGTAGGCACCTGTAGTCCCAGG + Intergenic
901514520 1:9736033-9736055 AGGTCGCCACCTTTGGGTCAGGG + Exonic
903208112 1:21798213-21798235 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
906532388 1:46531220-46531242 AGGTCATCAGCTGTAGGTACTGG + Intergenic
906534045 1:46541716-46541738 AGGTGCGCACCTGTAGTCCCAGG - Intergenic
907743775 1:57192182-57192204 TGGTGGGCACCTGTAGTCCCAGG + Intronic
907897094 1:58702136-58702158 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
910664730 1:89712243-89712265 TGGTAGGCACCTGTAATTCCAGG - Intronic
912249767 1:107999083-107999105 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
915402948 1:155637120-155637142 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
915632183 1:157161117-157161139 AGGTCGGGACCTCTGGGACCTGG + Intergenic
915849356 1:159304472-159304494 TGGTGGGCACCTGTAGTCCCAGG + Intronic
917944546 1:179955141-179955163 AGGTGAGCTCCTGTAGGACCTGG + Exonic
921349509 1:214221411-214221433 TGGTGGGCGCCTGTAGTTCCAGG - Intergenic
923847519 1:237752283-237752305 TGGTGTGCACCTGTAGGCCCAGG - Intronic
1062987261 10:1780285-1780307 AGGTGGGCAGGTGTATGTCCCGG + Intergenic
1063432074 10:5999620-5999642 TGGGTGGCACCTGTAGATCCCGG + Intergenic
1066165887 10:32788178-32788200 AGGTCAGCCCCAGTAGCTCCAGG + Intronic
1067947761 10:50701194-50701216 AGGTCGGCAGCTGTCTGTCCTGG - Intergenic
1069427295 10:68300021-68300043 TGGTCTGCACCTGTAGTCCCAGG - Intronic
1069728121 10:70594226-70594248 AGGTCGGCACCTGCATCCCCTGG + Intergenic
1070106378 10:73435800-73435822 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
1070883077 10:79866187-79866209 AGGTCGGCAGCTGTCTGTCCTGG - Intergenic
1071649645 10:87382502-87382524 AGGTCGGCAGCTGTCTGTCCTGG - Intergenic
1072039987 10:91597788-91597810 AGGCAGCCAGCTGTAGGTCCAGG + Intergenic
1072154832 10:92714965-92714987 AGGTCTACAGCTGCAGGTCCAGG + Intergenic
1073951381 10:108813543-108813565 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
1073973827 10:109076437-109076459 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
1075519757 10:123136438-123136460 AGGTCGGTACCTTCAGGTCGCGG - Exonic
1077445095 11:2587119-2587141 TGCTCAGCACCTGCAGGTCCTGG + Intronic
1078044199 11:7898463-7898485 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
1078888061 11:15525805-15525827 AGGCCAGCACCTGTAACTCCAGG + Intergenic
1083588406 11:63877241-63877263 TGGTGGGCACCTGTAGTCCCAGG - Intronic
1084019601 11:66409704-66409726 AGGTCAGCATCTGTGGGTTCTGG - Intergenic
1089158409 11:116419748-116419770 TGGTGTGCACCTGTAGTTCCAGG - Intergenic
1092465119 12:8724709-8724731 AGGTCAGCAACTGTAGACCCAGG - Intronic
1094492874 12:30972172-30972194 TGGTCTGCCCCTGCAGGTCCAGG - Intronic
1096681073 12:53255625-53255647 AGGTTGGGACCTGCAGGTCTTGG - Intergenic
1100651592 12:96595771-96595793 AGGTCGGCACCTTTGGGTTTTGG - Intronic
1101259826 12:103017712-103017734 AGGTGGGCACCACTAGCTCCAGG + Intergenic
1103660073 12:122507244-122507266 TGGTGGGCACCTGTAGACCCAGG + Intronic
1104154878 12:126121628-126121650 TGGTGGGCACCTGTAGTTCCAGG + Intergenic
1105291384 13:19055860-19055882 AGGTGGGCACTTGTGGGTGCAGG - Intergenic
1106218267 13:27722186-27722208 AGGTCTGCGCCTGTGTGTCCCGG + Intergenic
1106879648 13:34115242-34115264 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
1107187021 13:37535264-37535286 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
1107457445 13:40567833-40567855 TGGTGGGCACCTGTAGTCCCAGG + Intronic
1110995417 13:82101816-82101838 TGGTGCGCACCTGTAGTTCCAGG - Intergenic
1116131704 14:40862661-40862683 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
1116372552 14:44154598-44154620 AGGTTGGCCCCTGTAGGACCAGG + Intergenic
1116925048 14:50625775-50625797 AGGCGGGCACCTGTAGTCCCAGG + Intronic
1118704816 14:68471118-68471140 AGGTTGGCACCTGGAGCTCTGGG + Intronic
1118797943 14:69161066-69161088 TGGTGGGCGCCTGTAAGTCCAGG + Intergenic
1121055877 14:90852225-90852247 TGGTGGGCACCTGTAGTCCCAGG - Exonic
1122010412 14:98741732-98741754 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
1122914454 14:104851476-104851498 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
1122954871 14:105065922-105065944 AGGATGGCACCTGCATGTCCTGG + Intergenic
1124349537 15:28944926-28944948 AGGTGGGAACCTGAGGGTCCTGG + Intronic
1125582423 15:40795760-40795782 TGGTGGGCACCTGTAGTCCCAGG + Intronic
1128680934 15:69650894-69650916 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
1132713981 16:1281638-1281660 AGGTCAGCAACAGCAGGTCCGGG + Intergenic
1133968662 16:10550840-10550862 TGGTGGGCACCTGTAATTCCAGG + Intronic
1134778437 16:16873240-16873262 TGGTGGGCACCTGTAATTCCAGG + Intergenic
1134797688 16:17056856-17056878 AGGCCAGCACCTGCAGGCCCAGG - Intergenic
1140192811 16:72832721-72832743 AGGGCGACACCTGTAGGTCCTGG - Intronic
1141732452 16:85832001-85832023 TGGTGTGCACCTGTAGTTCCAGG + Intergenic
1142292185 16:89198275-89198297 AGGTCGGCACCTGAGGTGCCAGG + Exonic
1142329255 16:89440481-89440503 AGGTGTGCACCTGTAGTCCCAGG + Intronic
1142819226 17:2451486-2451508 TGGTGCGCACCTGTAGTTCCAGG + Intronic
1142847575 17:2689742-2689764 ACGTCGGCACCTGTAACTCCCGG + Exonic
1146036038 17:29407577-29407599 TGGTGGGCACCTGTAGTCCCAGG - Intronic
1146049377 17:29536830-29536852 TGGTGGGCACCTGTAGTCCCAGG - Intronic
1148179817 17:45596219-45596241 AGGTGGGGAGCTGTAGGACCAGG - Intergenic
1148269083 17:46249682-46249704 AGGTGGGGAGCTGTAGGACCAGG + Intergenic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1150767634 17:68014813-68014835 AGGTGGGGAGCTGTAGGACCAGG - Intergenic
1158829632 18:61263455-61263477 AGGACTGCTCCTGTAGGACCTGG + Intergenic
1160850318 19:1188172-1188194 TGGTGGGCGCCTGTAGTTCCAGG - Intronic
1161460713 19:4395524-4395546 AGGTGAGCACCTGTATTTCCTGG - Intronic
1162613445 19:11775460-11775482 TGGTGGGCACCTGTAGTCCCAGG - Intronic
1162989834 19:14294777-14294799 TGGTGGGCGCCTGTAGTTCCAGG + Intergenic
1163788805 19:19293449-19293471 TGGTGGGCACCTGTAGTCCCAGG + Intronic
1164786365 19:30934300-30934322 TGGTGGGCACCTATAGTTCCAGG - Intergenic
1165663505 19:37604438-37604460 TGGTGGGCACCTGTAGTCCCAGG - Intronic
1166230334 19:41422758-41422780 CGGCAGGCACCTGTAGGTCATGG - Exonic
1166291923 19:41869038-41869060 AGCGCGGCACCTGTACCTCCGGG + Exonic
1166828368 19:45623399-45623421 TGGTGGGCACCTGTAGTCCCAGG + Intronic
1167422101 19:49409919-49409941 AGGGCGGCACCTGGAGCTCCTGG - Intronic
1167594065 19:50418291-50418313 AGGTCAGCACCTGGAGGGCGGGG - Intronic
1168264556 19:55215151-55215173 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
927217557 2:20676660-20676682 AGGTGGGTACCTGCAGGTCATGG - Intergenic
928080890 2:28311126-28311148 TGGTGGGCACCTGTAGTCCCAGG + Intronic
930616570 2:53600252-53600274 TGGTGCGCACCTGTAGTTCCAGG - Intronic
932046392 2:68354785-68354807 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
935004313 2:99056070-99056092 TGGTGGGCACCTGTAGTCCCAGG + Intronic
935993033 2:108738759-108738781 TGGTAGGCACCTGTAATTCCAGG - Intronic
936009503 2:108916500-108916522 AGGTGGGCGCCTGTGGGTGCAGG - Intronic
936870990 2:117133987-117134009 AGGTAGACACCTGTAGGTGGAGG - Intergenic
937323777 2:120976756-120976778 AGGTGGCCACCTATAGCTCCAGG - Intronic
941455468 2:165708895-165708917 AGGTAGGCACATGTAGGTAGAGG + Intergenic
944630434 2:201618860-201618882 TGGCCGGCACCTGGAGGACCGGG - Intronic
946380172 2:219342459-219342481 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
948063550 2:235060261-235060283 AGGTCGGCCCATGTCAGTCCTGG + Intergenic
948231250 2:236351202-236351224 AGGTGGGCTCCTGGAGGTCAGGG - Intronic
948349667 2:237328332-237328354 AGGTAGGCACCTGTGGCTTCTGG - Intronic
948911405 2:241005334-241005356 TGGTGGGCACCTGTAGTCCCAGG - Intronic
1169078287 20:2776577-2776599 AGGTAGGCACCTGTAGGGCCAGG - Intergenic
1170678588 20:18504812-18504834 AGCGCGGCACCTGTACCTCCAGG + Intergenic
1172967786 20:38850833-38850855 TGGTGGGCACCTGTAGTCCCAGG + Intronic
1173197580 20:40928496-40928518 AGGTCTCCACTTGTGGGTCCAGG - Intergenic
1174357959 20:50010597-50010619 GGCTGGGCACCTGCAGGTCCTGG - Intergenic
1174682714 20:52423902-52423924 AGGTGGGCACAGGTAGGTACAGG - Intergenic
1177559314 21:22729864-22729886 AAGTGGGCACCTGAAGGTCAAGG + Intergenic
1177742840 21:25174679-25174701 TGGTGGGCACCTGTAGTTCCAGG - Intergenic
1179303868 21:40137039-40137061 TGGTGGGCACCTGTAGTCCCAGG + Intronic
1179711498 21:43266100-43266122 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
1181834743 22:25594743-25594765 CGGTGGGCACCTGTAGTCCCAGG + Intronic
1183342705 22:37290639-37290661 TGGTGGGCACCTGTAGTCCCAGG - Intronic
1184344002 22:43901895-43901917 GGGTCGGCTCCTGAAGGTCATGG - Intergenic
1184862653 22:47182975-47182997 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
952125395 3:30294015-30294037 AGGTTGGAATCTGCAGGTCCTGG - Intergenic
954422880 3:50427842-50427864 AGGTTGGCCCCTGGAGGACCAGG - Intronic
955734179 3:62019024-62019046 AGGTCAGCTTCTGCAGGTCCTGG - Intronic
955916346 3:63912180-63912202 GGGTGGGCAGCTGGAGGTCCTGG + Intronic
957509352 3:81167673-81167695 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
957842100 3:85685117-85685139 TGGTGGGCACCTGTAGTGCCAGG + Intronic
960895411 3:122499624-122499646 TGGTGTGCACCTGTAGTTCCAGG + Intronic
961445933 3:126981755-126981777 CGGTGGGCACCTTTAGATCCAGG - Intergenic
963354449 3:144193231-144193253 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
965683189 3:171273225-171273247 AGGTGGGTCCCTGTAGCTCCAGG - Intronic
966062811 3:175780141-175780163 TGGTGGGCACCTGTAGTCCCAGG + Intronic
967527222 3:190508752-190508774 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
968474234 4:795571-795593 GGGTCGGCCCCTGTACGTCGAGG - Intronic
968664011 4:1810880-1810902 AGGTAGGCACCCAGAGGTCCGGG + Intergenic
969235808 4:5864544-5864566 GGCCCAGCACCTGTAGGTCCTGG - Intronic
976278478 4:83302840-83302862 TGGTGTGCACCTGTAGTTCCAGG + Intronic
977374963 4:96190523-96190545 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
982062279 4:151616579-151616601 TGGCGGGCACCTGTAGTTCCAGG - Intronic
984368875 4:178835203-178835225 CGGTGGGCACCTGTAGTCCCAGG + Intergenic
985312412 4:188616705-188616727 TGGTGGGCACCTGTAGCCCCAGG - Intergenic
985609282 5:877933-877955 AAGACGGCACCTGCAGGCCCAGG + Intronic
986639427 5:9857939-9857961 AGGTTGGCACCTGCAGACCCAGG - Intergenic
993991932 5:94668271-94668293 TGGTGGGCACCTGTAGTCCCAGG - Intronic
995275832 5:110276835-110276857 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
999300388 5:150486636-150486658 AGCGCGGCAGCTGTAGGTCACGG + Intronic
1001904932 5:175463887-175463909 CACTCGGCACCTGTAGGTCTAGG - Intergenic
1002133010 5:177092783-177092805 AGGTGAGCACCTGAAGGGCCAGG + Exonic
1003283201 6:4711930-4711952 TGGTATGCACCTGTAGATCCAGG + Intronic
1003283371 6:4713010-4713032 TGGTATGCACCTGTAGATCCAGG + Intronic
1006195474 6:32238732-32238754 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
1006500808 6:34457824-34457846 AGGTCTGCAGCTGTTGGTCAGGG - Intergenic
1006787063 6:36675569-36675591 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
1006867736 6:37222581-37222603 AGGTCTGCAGCCGTGGGTCCTGG + Intronic
1010391196 6:75339813-75339835 TGGTGGGCACCTGTAGTTCCAGG + Intronic
1013944306 6:115704050-115704072 AGGTTGGCGCCTGTAGCCCCAGG - Intergenic
1016868109 6:148789728-148789750 TGGTGGGCACCTGTAATTCCAGG - Intronic
1018544243 6:164918499-164918521 AGATCAGCCCCTGTAGATCCAGG - Intergenic
1024036286 7:45510034-45510056 AGCTGTTCACCTGTAGGTCCTGG - Intergenic
1025007271 7:55364376-55364398 ATGTCGGCATCAGTAGTTCCTGG + Intergenic
1025144437 7:56492229-56492251 AGCTTGGCATCTGTAGGTCTAGG + Intergenic
1026600975 7:71776974-71776996 AGGTACACACCTGTAGCTCCTGG - Intergenic
1033756047 7:144398958-144398980 AGGACGGCCCCTGTGGGTCCTGG - Exonic
1034631823 7:152536988-152537010 AGGTGGGCACCTGTAATTCTAGG + Intergenic
1035028645 7:155843620-155843642 AGGCTGGCACCTGCAGGGCCTGG + Intergenic
1035982991 8:4393696-4393718 AGGTCTGCTCCTGGAGTTCCAGG - Intronic
1040882479 8:52221775-52221797 AAGTCAGCAACTGTAGTTCCTGG + Exonic
1041775547 8:61518736-61518758 AGGTCTGTACCTGTAGTTGCAGG - Intronic
1042000095 8:64112393-64112415 AGGTGGCCACCTGTAAGTCAAGG + Intergenic
1042788183 8:72572930-72572952 AGCGCGGCACCTGAAGGGCCAGG + Intronic
1045087378 8:98701034-98701056 TGGTGTGCACCTGTAGTTCCAGG + Intronic
1045463989 8:102452261-102452283 TGGTGTGCACCTGTAGTTCCAGG - Intergenic
1049149529 8:141025652-141025674 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
1049280980 8:141744400-141744422 TGGTGGGCACCTGTAGGCCCAGG - Intergenic
1051616270 9:19009957-19009979 TGGTATGCACCTGTAGTTCCTGG - Intronic
1053823609 9:41995596-41995618 TGGTGGGCACCTGTAGTCCCAGG + Intronic
1054606964 9:67191770-67191792 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
1055331207 9:75185768-75185790 AGGCCGCCACCTGCAGGTCAAGG - Intergenic
1056575255 9:87851502-87851524 AGGTCAGCAGCTGTCTGTCCTGG + Intergenic
1056887374 9:90456447-90456469 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
1058742788 9:107960563-107960585 TGGTGGGCACCTGTAATTCCAGG + Intergenic
1059615838 9:115949945-115949967 TGGTGGGCACCTGTAGTCCCAGG + Intergenic
1060452779 9:123758931-123758953 TGGCGGGCACCTGTAGTTCCAGG - Intronic
1061167634 9:128933284-128933306 TGGTAGGCACCTGTAGTCCCAGG - Intronic
1061397500 9:130351438-130351460 AGGCCCTCACCTGCAGGTCCAGG + Intronic
1062246901 9:135573745-135573767 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
1062343841 9:136105679-136105701 AGGTCGGCTCCCGCAGGGCCTGG + Intergenic
1062697271 9:137881769-137881791 AGCTCGGCACTGGTAGGGCCTGG + Intronic
1185488900 X:504278-504300 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
1186413631 X:9364649-9364671 TGGTGGGCACCTGTAGTCCCAGG - Intergenic
1190335274 X:49258232-49258254 AGGTCGGCACCTGTAGGTCCAGG + Intronic
1190692276 X:52921406-52921428 GGGTCTGCGCCGGTAGGTCCCGG + Intergenic
1190767730 X:53489227-53489249 TGGCGGGCACCTGTAGTTCCAGG + Intergenic
1192788377 X:74355445-74355467 AGGTCAGCACCTGTGGACCCAGG + Intergenic
1195746744 X:108126226-108126248 AGGTAGGCACCTGTGGTTCAGGG + Intronic
1196866947 X:120078628-120078650 TGGTGCGCACCTGTAGTTCCAGG - Intergenic
1196876152 X:120157654-120157676 TGGTGCGCACCTGTAGTTCCAGG + Intergenic
1200247924 X:154535744-154535766 AGGAGGGGACCTGTGGGTCCTGG + Intronic