ID: 1190337195

View in Genome Browser
Species Human (GRCh38)
Location X:49269821-49269843
Sequence CACCGGCGGCGGGACCGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190337195_1190337205 7 Left 1190337195 X:49269821-49269843 CCCCGCCGGTCCCGCCGCCGGTG 0: 1
1: 0
2: 2
3: 21
4: 212
Right 1190337205 X:49269851-49269873 TGCCGCCGCCGCCGCCGATATGG 0: 1
1: 0
2: 6
3: 72
4: 390
1190337195_1190337212 25 Left 1190337195 X:49269821-49269843 CCCCGCCGGTCCCGCCGCCGGTG 0: 1
1: 0
2: 2
3: 21
4: 212
Right 1190337212 X:49269869-49269891 TATGGCGCGTACGGCCCCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 10
1190337195_1190337209 16 Left 1190337195 X:49269821-49269843 CCCCGCCGGTCCCGCCGCCGGTG 0: 1
1: 0
2: 2
3: 21
4: 212
Right 1190337209 X:49269860-49269882 CGCCGCCGATATGGCGCGTACGG 0: 1
1: 0
2: 0
3: 0
4: 3

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190337195 Original CRISPR CACCGGCGGCGGGACCGGCG GGG (reversed) Intronic
900137916 1:1126263-1126285 CTCCCGGGGCGGCACCGGCGTGG + Intergenic
900175076 1:1287977-1287999 CACCGCCGGCGGGGAAGGCGTGG + Exonic
900349481 1:2227947-2227969 CGCGGGGGGCGGGGCCGGCGCGG + Intergenic
901007702 1:6179851-6179873 CGCGGGCGGCGGGGGCGGCGCGG - Intronic
901433992 1:9235076-9235098 GGGCGGCGGCGGGGCCGGCGGGG - Intronic
903078109 1:20787344-20787366 CGCGGGAGGCGGGGCCGGCGGGG - Intergenic
903446418 1:23425018-23425040 CACAGGCGGCGGTCGCGGCGCGG + Intergenic
903907459 1:26696670-26696692 CAGCGGCGGCGGGCCCGGCGCGG + Exonic
904775019 1:32901246-32901268 AGCCGGGGGCGGGACCAGCGCGG - Exonic
905414378 1:37794379-37794401 CGGCGGCGGCGGGGGCGGCGCGG - Exonic
905647198 1:39633019-39633041 CCCCGGGGGCGGGGCGGGCGAGG + Intronic
908355702 1:63323403-63323425 GAGCGGCGGCGGGCCTGGCGCGG + Exonic
911527348 1:99004018-99004040 CAGCGGCGGGCGGGCCGGCGAGG - Intronic
912533016 1:110339885-110339907 TCCCGGCGGCGGGGACGGCGCGG + Exonic
913144514 1:115976485-115976507 CGCTGGCGGCGGGGCCGGGGCGG - Exonic
914197336 1:145454429-145454451 CCGGGGCGGCGGGGCCGGCGGGG - Intergenic
914255322 1:145957760-145957782 CAGCGGCGGCGGGGGCGGTGCGG + Exonic
914889700 1:151612073-151612095 CGCCGGCCGCGGGACCGACTCGG - Exonic
915519906 1:156436123-156436145 CTCCGGCCGCGGGCGCGGCGGGG + Intergenic
920528482 1:206685273-206685295 CTGCGGCGGCGGGGCCGGGGCGG - Exonic
922950927 1:229558277-229558299 CAGCGGCTGCGGGACCGCCCGGG + Exonic
922958619 1:229626014-229626036 GAGCGGCGGCGGGGGCGGCGGGG - Exonic
923372333 1:233327325-233327347 CACCTGCGGCGGGGGCGGGGTGG + Intergenic
924502801 1:244652995-244653017 CCCCGGGGGCGGGGCCGGCCCGG - Exonic
924775261 1:247111642-247111664 CACGGGCCCCGGCACCGGCGGGG - Exonic
1065100376 10:22325589-22325611 CCGCGGGGGCGGGGCCGGCGCGG - Intronic
1065589776 10:27252564-27252586 CGGCGGCGGCGGGGGCGGCGGGG - Intergenic
1070328333 10:75401880-75401902 CAGCGGCGGCGGCGGCGGCGCGG - Exonic
1070800836 10:79243560-79243582 CCCCGGCGGCGGCGGCGGCGCGG - Intronic
1071309416 10:84328682-84328704 CTCGGGCGGCGGGGCTGGCGGGG + Exonic
1071527488 10:86366727-86366749 CGGCGGCGGCCGGGCCGGCGTGG + Intergenic
1072915546 10:99535529-99535551 CGGCGGCGGCGGGACCTCCGCGG + Exonic
1074591900 10:114821800-114821822 CTCCGGCGGCGGCACCGGTTGGG - Exonic
1075498875 10:122954055-122954077 CACCGGGGCCGAGACCGGCCCGG + Exonic
1075754797 10:124802033-124802055 CACCGGGGGCGGGAGCCGCCCGG - Intronic
1076638940 10:131901123-131901145 AGCCGGCGGCGGGACGGGCGGGG - Exonic
1076683530 10:132186903-132186925 CAGCGGGGGCGGGACCGGAACGG + Exonic
1077898787 11:6473908-6473930 GTCCGGCGGCGGCGCCGGCGCGG - Intronic
1079308565 11:19345359-19345381 GCCCGGCGGCGGGACCGGCCTGG + Intergenic
1081804960 11:45885556-45885578 CTCCGGGGGCGGGGCTGGCGGGG + Intergenic
1083656990 11:64234580-64234602 CAGCGGCGGCGGGGACGGCGGGG - Exonic
1084680151 11:70662287-70662309 CGCCGGCGCCGGGACGGGAGAGG - Intronic
1084936621 11:72590322-72590344 AGCCGGCGGCGGGCCCGGCGCGG - Intronic
1089242974 11:117097987-117098009 CAGCCGCGGCGGGGCGGGCGCGG - Intronic
1089432651 11:118436557-118436579 CACCGGGGGCGGCGGCGGCGGGG + Exonic
1089729453 11:120511510-120511532 CGGGGGCGGCGGGAACGGCGGGG - Intergenic
1089845083 11:121452177-121452199 CAGCGGCGGCGGGCGCAGCGGGG + Intergenic
1091259747 11:134224832-134224854 CACCGGCCGCGGGACTGGCTGGG + Exonic
1095180935 12:39145532-39145554 CTTTGGCGCCGGGACCGGCGGGG - Intergenic
1096078486 12:48818878-48818900 CGCCGGGGGCGGGAGCGGCCCGG - Exonic
1096495504 12:52037290-52037312 CGGCGGCGGCGGAACTGGCGGGG + Intronic
1096983748 12:55743420-55743442 CGGCGGCGGCGGCAGCGGCGGGG + Exonic
1100844520 12:98645044-98645066 CAGCGGCGGCGCGCCCGACGTGG - Exonic
1101150223 12:101877212-101877234 CGCCGGCGGCGGGACCTCGGAGG + Intergenic
1103048754 12:117761160-117761182 CATGGGCGGCGTGCCCGGCGGGG + Exonic
1103604841 12:122078881-122078903 CCCCGGCTGCGAGGCCGGCGCGG - Exonic
1104862115 12:131929309-131929331 CACCCGCGTCGGGACCAGAGAGG - Exonic
1106057711 13:26254267-26254289 CTGCTGCGGCGGGAGCGGCGGGG - Exonic
1106517166 13:30465403-30465425 CCGGGGCGGCGGGGCCGGCGCGG - Intronic
1110860622 13:80341482-80341504 CTCGGGCGGCAGGACCGGCCTGG - Intergenic
1111396066 13:87671795-87671817 CGGCGGCGGCGGGCTCGGCGCGG + Intergenic
1112290823 13:98143115-98143137 CAGAGGCGGCGGGTCCGGCGCGG + Intronic
1113981853 13:114282483-114282505 CACTGGCTGCGGCACCAGCGTGG - Intronic
1113985783 13:114314627-114314649 CGCCCGCGGCCGGACCGGTGAGG + Exonic
1115754275 14:36517673-36517695 CGGCGGCGGCGGGGGCGGCGGGG - Exonic
1119322229 14:73738960-73738982 GAGAGGCGGCGGGAGCGGCGGGG + Exonic
1121050492 14:90816453-90816475 CGGCGGCGGCGGGCGCGGCGGGG + Intronic
1122221170 14:100239799-100239821 CCTCAGCGGCGGGGCCGGCGCGG + Exonic
1122787766 14:104171821-104171843 GACCGGCGGCGGGATCGTAGAGG - Exonic
1124469319 15:29968961-29968983 CGGCGGCGGCGGGAGCGGCCGGG - Intergenic
1124484678 15:30103876-30103898 CACCTCCGGCGGGAGGGGCGCGG - Intergenic
1124518903 15:30393362-30393384 CACCTCCGGCGGGAGGGGCGCGG + Exonic
1124539753 15:30572884-30572906 CACCTCCGGCGGGAGGGGCGCGG - Intergenic
1124758899 15:32434698-32434720 CACCTCCGGCGGGAGGGGCGCGG + Intergenic
1127117546 15:55743045-55743067 CTCCGGCTCCGGCACCGGCGTGG + Intronic
1128067748 15:64775259-64775281 CACCGGCACCGGCTCCGGCGCGG - Exonic
1129144246 15:73633092-73633114 CGCCGGGGGCGGGCCGGGCGGGG - Intronic
1130390061 15:83447430-83447452 CAGCCGCGGGGGGACCGGCCCGG + Exonic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1131466048 15:92655584-92655606 CGCGGGCGGCGGGAGCGGCCAGG + Exonic
1132560074 16:589603-589625 CGCCGGCGACGGGGCGGGCGAGG + Intronic
1132579991 16:680372-680394 GGCCGGGGGCGGGACCAGCGGGG - Exonic
1132889556 16:2196954-2196976 CAGAGGCTGCGGGACCCGCGGGG + Intergenic
1133156391 16:3879946-3879968 CACGGGCGGCCGGGCCGGCGAGG + Exonic
1133311219 16:4847833-4847855 CACGGGCGGCGGGAGCGGACGGG - Intronic
1137673671 16:50293290-50293312 GACCGGCGGAGGGACCAGCGGGG - Intronic
1139509174 16:67416545-67416567 CCCTGGCCGGGGGACCGGCGCGG - Intronic
1142300975 16:89257586-89257608 CACCGGCGGCGGGACCAGGCGGG - Intergenic
1144656928 17:17042729-17042751 GGCCTGCGGCGGGGCCGGCGAGG + Intronic
1145291662 17:21551445-21551467 CTGGGGCGGCGGGACCGGTGCGG + Exonic
1146167437 17:30600840-30600862 CCCCGGCGGCGGGGTTGGCGGGG - Intergenic
1146492356 17:33292138-33292160 CAGCGGCGGCGGCCCCGGCCGGG + Exonic
1148722488 17:49763900-49763922 CACCAGCGCCGGGACGGGGGTGG - Exonic
1150373506 17:64661883-64661905 CCCCGGCGGCGGGGGCGGCGGGG + Exonic
1150373662 17:64662367-64662389 GACGGGAGGCGGGGCCGGCGGGG + Intergenic
1152345535 17:79748481-79748503 CACCGCCGGCGGCCCAGGCGCGG - Intergenic
1152349711 17:79777951-79777973 CTCCGGCGGGGGGTCCCGCGCGG - Intergenic
1152357715 17:79814835-79814857 CGGCGGCGGCGGGAGGGGCGCGG + Intergenic
1152751812 17:82065750-82065772 GCCCGGCGGCGGCCCCGGCGCGG - Intronic
1154173772 18:12068425-12068447 CCCCGGCGGCGGCGGCGGCGCGG - Intergenic
1158836278 18:61334198-61334220 CACCGCCTGCGGGGCCAGCGAGG - Intronic
1160719164 19:589998-590020 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1160782966 19:885967-885989 CACCGGCGGCGGCAACATCGTGG - Exonic
1160835470 19:1122725-1122747 CATCGGCGATGGGGCCGGCGTGG - Exonic
1160860453 19:1235255-1235277 CACGGGCGGCCGGGCTGGCGGGG + Intronic
1160940876 19:1619939-1619961 CACCGGAGGCTGGACAGGCGGGG - Intronic
1161203649 19:3029231-3029253 CGCGGGCGGCGGGCCCCGCGCGG + Intronic
1161266406 19:3366674-3366696 CGCCGGCGGGGGGCCGGGCGAGG - Intronic
1161450704 19:4343859-4343881 CGGCGGCGGCGGGGCCGGGGCGG + Exonic
1162740224 19:12769870-12769892 CAGCGGCGGCAGGTGCGGCGGGG - Exonic
1162954337 19:14090079-14090101 CGGCGCCGGCGGGGCCGGCGGGG + Exonic
1163085857 19:14979510-14979532 CACCGGCGTCCGGAGCGGCGGGG + Intronic
1163334338 19:16661152-16661174 CGCGGGCGGCGGGACGGACGAGG + Exonic
1163596761 19:18225171-18225193 CCCCGGCTGTGGGAACGGCGCGG + Intronic
1166351957 19:42203455-42203477 CACAGGCTGAGGGGCCGGCGTGG + Intronic
1167264132 19:48474966-48474988 CTCCTGCGGAGGGACCAGCGGGG - Intronic
1167428408 19:49441417-49441439 CGCGGGCGGGGGGATCGGCGGGG - Exonic
1167495712 19:49817631-49817653 CAAGGGCAGCGGGCCCGGCGCGG + Intergenic
1168272632 19:55258483-55258505 CGCCGGCGGCGGGGCGGGGGGGG - Exonic
1168536423 19:57174101-57174123 CACCTGAGGTGGGCCCGGCGTGG - Intergenic
1168694423 19:58396604-58396626 CAGAGGCGGCGGGGGCGGCGGGG - Exonic
927957380 2:27217333-27217355 CACAGGCGGCGTGAGGGGCGGGG - Intergenic
928518271 2:32063921-32063943 GCCCGGCGGCGGGAGGGGCGGGG - Exonic
928606429 2:32947864-32947886 CGCCCGCGGAGGGACCTGCGGGG + Intronic
929778329 2:44942197-44942219 TAGCGGCGGCGGGAACGGTGCGG + Exonic
929778344 2:44942245-44942267 CAGCGGCGGCGGGAACGGTGCGG + Exonic
931052301 2:58428473-58428495 CGCCGGCCGCGGGCCCGGGGCGG + Intergenic
932567314 2:72918002-72918024 CAAGGACGGCGGCACCGGCGGGG + Exonic
934031859 2:88055592-88055614 CCCCGGCGGCGGGGGCGGCCCGG - Intronic
934655965 2:96116905-96116927 CACCGGCGCCGGGCCCAGCCCGG - Intergenic
935137718 2:100322064-100322086 CGGCGGCGGCGGGACCGGCTCGG + Exonic
935592463 2:104855346-104855368 CGAAGGCGGCGGGGCCGGCGGGG + Intergenic
935731064 2:106065460-106065482 CGCCGGCGGCGGGGGCCGCGTGG - Intronic
936038400 2:109129987-109130009 CGCGGGCGGCGGGGGCGGCGCGG + Exonic
939969661 2:148644965-148644987 CGGCGGCGGCGGGGCGGGCGGGG - Exonic
942450914 2:176107619-176107641 CAGCGGGGGCGGCCCCGGCGGGG + Exonic
944221683 2:197310292-197310314 CGGCGGCCGCGGGCCCGGCGGGG - Intronic
946322138 2:218960305-218960327 CACCGGCGGCGCCACCTGCGGGG - Exonic
947992299 2:234497154-234497176 CCCCGGCGGCGGGCGGGGCGGGG - Intergenic
948854753 2:240724925-240724947 CACCGGCGGCGGGGGGGGGGGGG + Intronic
1171011501 20:21511858-21511880 CCCCGGCGGCGGTGGCGGCGAGG - Exonic
1172098726 20:32473362-32473384 CACGGGGGTGGGGACCGGCGGGG - Intronic
1172101219 20:32484584-32484606 GACCGGCGGCGGGGCGGGGGCGG - Intronic
1172118474 20:32584698-32584720 GGGCGGCGGCGGGACTGGCGCGG - Intronic
1172367906 20:34363722-34363744 GCCCGGCGGCGGGGCCGGCGCGG + Intronic
1172474488 20:35226764-35226786 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1173251604 20:41366698-41366720 GACCAGCGGCGGGGGCGGCGCGG - Exonic
1173827605 20:46057659-46057681 CAGCGGCGGGGGGCGCGGCGAGG - Exonic
1174357823 20:50010104-50010126 CAGCGGCGGCGGCGGCGGCGAGG + Intergenic
1176194621 20:63831414-63831436 GGCCGGCGGCCGGGCCGGCGTGG - Intergenic
1176550183 21:8217407-8217429 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176569111 21:8400445-8400467 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176577025 21:8444677-8444699 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1179882645 21:44299991-44300013 CGCCGGGGGCGGGCCCGGGGCGG + Intergenic
1180215759 21:46323163-46323185 GACCTGTGGCGGGACCGCCGGGG - Exonic
1180707443 22:17818191-17818213 CAAGGGCGGCGGGACCACCGAGG + Exonic
1180837258 22:18936138-18936160 CACCGGCGGCCGCACTGCCGTGG + Exonic
1181934521 22:26429303-26429325 CACCGGCAGGGGCACCGGCGCGG + Exonic
1182547703 22:31085377-31085399 CACCGCCGGCGGGACCCCCATGG + Intronic
1183299397 22:37051613-37051635 GACCGGGGGCGGGAGCAGCGCGG + Intergenic
1183358932 22:37373464-37373486 CAGCGGCGGGGGCAGCGGCGGGG - Exonic
1184412231 22:44331877-44331899 CGGCGGCGGCGGGCGCGGCGCGG - Intergenic
1184680821 22:46071408-46071430 CACCCGCAGCGGGCACGGCGGGG + Intronic
1185133959 22:49058104-49058126 CACCGGCCGTGGGCCAGGCGGGG - Intergenic
1185255402 22:49828344-49828366 CACAGGCGGGGGGACGGGCCGGG + Intergenic
1185278857 22:49961380-49961402 CACGGGCGGCGGCGGCGGCGGGG + Intronic
1185302535 22:50090012-50090034 GGCGGGCGGCGGGAGCGGCGCGG + Exonic
1185397656 22:50600970-50600992 CGCCGGCGGCGGGGCTGGGGCGG - Intronic
1185409414 22:50674363-50674385 CCCCGGGGGCGGGGGCGGCGGGG - Intergenic
1203255078 22_KI270733v1_random:133745-133767 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1203263134 22_KI270733v1_random:178824-178846 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1203287351 22_KI270734v1_random:161437-161459 CACCGGCGGCCGCACTGCCGTGG + Intergenic
949552402 3:5122254-5122276 CGGCGGCGCCGGGACGGGCGTGG + Exonic
953705341 3:45226242-45226264 CCCCGGCGCCGGGGGCGGCGGGG - Exonic
954004237 3:47578925-47578947 TACGTGCGGCGGGGCCGGCGCGG - Exonic
954384250 3:50236154-50236176 CACCGACGGCGGGGCGGGCCGGG - Exonic
956659081 3:71582052-71582074 CACAGGGGGCGGGAGCTGCGCGG + Intronic
956678028 3:71753682-71753704 CGGCGGCGGCGGGCCCGGCGGGG + Intronic
958692151 3:97481688-97481710 CACAGGGGGCGGGGCCGGGGCGG - Intronic
963798755 3:149657265-149657287 CCCAGGCGGCGGGAGCGGAGGGG + Exonic
963904451 3:150762651-150762673 CGGCGGCGGCGGGGCCGGCCCGG - Exonic
964484606 3:157174802-157174824 CGCCGGCGGCCGGACCTGCAGGG - Intergenic
968571968 4:1346802-1346824 CGCCGGGGGCGGGGCCGGCCGGG - Intergenic
969460697 4:7327279-7327301 CACCGGAGGTGGGACAGGTGAGG - Intronic
969714348 4:8861153-8861175 CAGCGGCGCCCGGACCCGCGGGG - Intronic
985611630 5:892663-892685 CGCCGGCGGCGGGCCCGAGGCGG + Exonic
989102332 5:37834808-37834830 GTCCGGCGGCGGCACCTGCGCGG + Exonic
990955035 5:61332353-61332375 CAGCGGCGGCGGCGGCGGCGCGG + Exonic
994072824 5:95620838-95620860 CGGCGGCGGCGGCAGCGGCGAGG - Exonic
997635104 5:135398997-135399019 CACCCGCGGCCGGACCCGAGCGG + Intronic
1001826805 5:174751737-174751759 CAAGGGCGGCGCGACCGGCCCGG + Intergenic
1005959874 6:30687111-30687133 CACAGGCCGCGGGACCCCCGGGG + Exonic
1007614402 6:43171749-43171771 CGGCGGCGGCGGGACACGCGGGG + Exonic
1019307083 7:340788-340810 CACCGGAGGCGGGAGGGGCCTGG - Intergenic
1019689650 7:2403567-2403589 CGCCGGGGGCGGGGCCGGCGAGG + Exonic
1020288887 7:6707021-6707043 GACCGGCGGCGGGTCCCGGGAGG - Intergenic
1021827887 7:24573160-24573182 CAGCCGCGGCGGGAGGGGCGGGG + Intergenic
1022207955 7:28180795-28180817 CGGCGGCGTCGGGAGCGGCGGGG + Intergenic
1026822278 7:73557578-73557600 TGGCGGCGGCGGGAGCGGCGGGG + Exonic
1026909437 7:74083829-74083851 CACCGGCGGGGAAACCGGCTCGG - Intronic
1033099979 7:138461132-138461154 CAGCGGCGGCGGCGGCGGCGCGG - Intronic
1034219439 7:149432647-149432669 CAGCAGCAGCGGAACCGGCGCGG - Exonic
1035021381 7:155803067-155803089 CAGCGGCGGCGGGGACCGCGGGG - Exonic
1035404258 7:158587835-158587857 CGCCGGGGGCGGGGCCGGGGCGG - Intergenic
1035432041 7:158829563-158829585 CACGCGGGGCGGGAGCGGCGTGG + Exonic
1035717047 8:1763331-1763353 CACGGCCGGCGGGAGGGGCGGGG - Intronic
1037827024 8:22165571-22165593 CCCCGGCGACGGGCCAGGCGGGG + Intronic
1038002575 8:23404008-23404030 CAGCGGCGGCGGAAGCGGAGGGG - Exonic
1039467837 8:37796845-37796867 GACCGGCGGCGGGAGCGGCGCGG + Intronic
1039484433 8:37899678-37899700 CGCCGGAGGCGGGGCTGGCGCGG + Intergenic
1041725119 8:61011026-61011048 CAGCGGTGACGGGACAGGCGTGG - Intergenic
1042859144 8:73295412-73295434 CACCGGCGCCGGCAGCGGCCTGG + Exonic
1049373868 8:142279994-142280016 CACAAGTGGCGGGACCTGCGAGG - Intronic
1049585303 8:143430163-143430185 CACCGGCGGCGGCGGCGGCGCGG - Exonic
1049585398 8:143430491-143430513 CGCGGGCGGCGGTCCCGGCGGGG + Intergenic
1049707372 8:144049168-144049190 CGCCGGGGGCGGGAAGGGCGAGG - Intergenic
1052192789 9:25678177-25678199 CAGCGGCGGCGGCGGCGGCGTGG - Exonic
1052991831 9:34523070-34523092 CGGCGGCGGCGGGAGCTGCGCGG + Intergenic
1057524156 9:95784463-95784485 CTCCGGCCGCGGGAGAGGCGGGG - Intergenic
1058053318 9:100427344-100427366 GACCGGGGGAGGGGCCGGCGAGG - Intronic
1061666188 9:132162083-132162105 CCACAGCGGCGGGAGCGGCGCGG + Exonic
1061878036 9:133554644-133554666 GGCCGGCGGCGGGGCCTGCGAGG + Exonic
1062341407 9:136095302-136095324 CACCGGCGGCCGCACCGCGGCGG + Intergenic
1062499094 9:136844728-136844750 CACCGGCGGCGAGGCGGGCGCGG - Exonic
1062659130 9:137619172-137619194 CAGCGGCGGCGGCGGCGGCGGGG - Intronic
1062696346 9:137877996-137878018 CCGGGGCGGCGGGGCCGGCGGGG + Exonic
1203773851 EBV:62189-62211 CAGTGGGGGCGGGGCCGGCGGGG - Intergenic
1203471476 Un_GL000220v1:116882-116904 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1203479297 Un_GL000220v1:160854-160876 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1186466396 X:9786850-9786872 CCTGGGCGCCGGGACCGGCGTGG + Intronic
1187698103 X:21940906-21940928 GCCAGGCGGCGGGAGCGGCGGGG - Intronic
1188738066 X:33742412-33742434 CACAGGCGGCGGAAGGGGCGGGG - Intergenic
1189491314 X:41473537-41473559 CGCAGGCGGCGGGACAAGCGCGG - Exonic
1190337195 X:49269821-49269843 CACCGGCGGCGGGACCGGCGGGG - Intronic
1190337286 X:49270091-49270113 CGGCGGCGGCGGGGCCGACGAGG + Exonic
1199500383 X:148500722-148500744 CAGCGGCGGCGGGGGCGGCCGGG - Exonic