ID: 1190338382

View in Genome Browser
Species Human (GRCh38)
Location X:49277141-49277163
Sequence CAGAGTAAGCGAGCGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 137}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190338382_1190338388 10 Left 1190338382 X:49277141-49277163 CCCTCACCCGCTCGCTTACTCTG 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1190338388 X:49277174-49277196 ATCACCTTTCTTGGCTTTCTTGG 0: 1
1: 0
2: 0
3: 20
4: 255
1190338382_1190338393 25 Left 1190338382 X:49277141-49277163 CCCTCACCCGCTCGCTTACTCTG 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1190338393 X:49277189-49277211 TTTCTTGGCTGGCCTAGGCCGGG 0: 1
1: 0
2: 5
3: 24
4: 156
1190338382_1190338391 20 Left 1190338382 X:49277141-49277163 CCCTCACCCGCTCGCTTACTCTG 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1190338391 X:49277184-49277206 TTGGCTTTCTTGGCTGGCCTAGG 0: 1
1: 0
2: 2
3: 65
4: 322
1190338382_1190338390 14 Left 1190338382 X:49277141-49277163 CCCTCACCCGCTCGCTTACTCTG 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1190338390 X:49277178-49277200 CCTTTCTTGGCTTTCTTGGCTGG 0: 1
1: 0
2: 0
3: 31
4: 404
1190338382_1190338394 26 Left 1190338382 X:49277141-49277163 CCCTCACCCGCTCGCTTACTCTG 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1190338394 X:49277190-49277212 TTCTTGGCTGGCCTAGGCCGGGG 0: 1
1: 0
2: 4
3: 15
4: 126
1190338382_1190338392 24 Left 1190338382 X:49277141-49277163 CCCTCACCCGCTCGCTTACTCTG 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1190338392 X:49277188-49277210 CTTTCTTGGCTGGCCTAGGCCGG 0: 1
1: 6
2: 691
3: 493
4: 480
1190338382_1190338387 1 Left 1190338382 X:49277141-49277163 CCCTCACCCGCTCGCTTACTCTG 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1190338387 X:49277165-49277187 GACTGGCGAATCACCTTTCTTGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190338382 Original CRISPR CAGAGTAAGCGAGCGGGTGA GGG (reversed) Intronic
900348456 1:2223178-2223200 CAGAGCAAGTGAGCGGGGGAGGG - Intergenic
902921263 1:19667102-19667124 CAGAGTAAGAGAGAGGGAGAGGG - Intronic
905744507 1:40403018-40403040 CAGAGAAAGGGAACAGGTGAGGG + Intronic
907483934 1:54764087-54764109 CAGGGTCACCGAGCGAGTGAAGG - Intronic
910394652 1:86779736-86779758 CTGAGAAAGCGAGAGGGAGAAGG - Intergenic
915309845 1:155001461-155001483 CTGAGAAAGGTAGCGGGTGAAGG - Intergenic
918003995 1:180524820-180524842 CAGAGTGAGCAAGTGGGAGAGGG + Intergenic
919316693 1:195979748-195979770 CAGAGCAAGCAAGAGAGTGATGG - Intergenic
921195865 1:212757193-212757215 CACAGTAAGCGAGGGTGAGATGG + Intronic
921696436 1:218215670-218215692 CAGAGAAAGTGAGTGGGTGGAGG - Intergenic
922677161 1:227560201-227560223 AAGAGAAAGAGAGAGGGTGAGGG - Intergenic
924260255 1:242222467-242222489 CAGAATAAGAGAGCAGGGGAAGG - Intronic
1063453126 10:6164353-6164375 GAGAGTGAGTGAGCGGGTGAAGG + Intronic
1063656346 10:7994023-7994045 CAGAGAAAGAGAGAGGGGGAGGG - Intronic
1064933851 10:20657894-20657916 CAGAGAAAGCCAGCTGGAGAAGG - Intergenic
1067775489 10:49161964-49161986 TAGAGGAAGCAAGTGGGTGAGGG - Intronic
1070424909 10:76277072-76277094 CAGAGTGAGAGAGCTGGAGAAGG - Intronic
1071610510 10:87027334-87027356 CAGAGTCAGCCTGGGGGTGATGG + Intergenic
1076401905 10:130190343-130190365 AAGAGTAAGCCCGCGGGTGCCGG + Intergenic
1076732137 10:132444289-132444311 GGGAGTGAGCGAGCGGGGGAGGG - Intergenic
1078451115 11:11441679-11441701 CACAGTAAGCGAGCAGGTGACGG + Intronic
1084211566 11:67626319-67626341 GAGAGTGAGCGAGCGAGTGAGGG - Intergenic
1088793598 11:113248541-113248563 GAGAGTAAGCTGGGGGGTGAGGG + Intronic
1089496686 11:118911609-118911631 GAGAATCAGCGAGCTGGTGAAGG - Intronic
1089983334 11:122790334-122790356 CAGAGTGAGGGAGAGGGGGAGGG - Intronic
1093181744 12:15974872-15974894 CAGAGGAAGGGAGCGAGGGAAGG - Intronic
1104230314 12:126878091-126878113 CAGAATAATCAGGCGGGTGAGGG + Intergenic
1113112688 13:106841108-106841130 CAGAGTAGGAGAGGGGATGAGGG - Intergenic
1113238893 13:108314596-108314618 CAGAGCAAGTGGCCGGGTGAGGG - Intergenic
1117062531 14:51977872-51977894 CAGATTAAGGGAGAGCGTGAAGG - Intronic
1118412515 14:65496577-65496599 AAGAGAGAGCGAGTGGGTGAAGG - Intronic
1119214860 14:72861164-72861186 CAGAGTGAGCGAGAGAGGGAGGG - Intronic
1121156125 14:91686148-91686170 CAGAGTAAGAGAAAGAGTGAGGG - Intronic
1121720598 14:96106013-96106035 CAGAGTAAGCGGGGGGGCGGGGG - Intergenic
1123045087 14:105508275-105508297 CAGAGTAGCCGAGCCGGTGGGGG + Intergenic
1126066073 15:44827423-44827445 CAGAGTGAGCGGGTGGGTGAGGG - Intergenic
1126093762 15:45073141-45073163 CAGAGTGAGCGGGTGGGTGAGGG + Intronic
1131543581 15:93297069-93297091 CAGAGGCAGCGAGGGGGTGAGGG - Intergenic
1131737106 15:95345442-95345464 CAGCATAAGCTAGCGGGTGTTGG - Intergenic
1136502197 16:30677521-30677543 CAGAGTCAGTGAGAGGGCGAGGG - Intergenic
1136909310 16:34133482-34133504 TAGAGAAAGGGAGAGGGTGAGGG - Intergenic
1138553198 16:57758346-57758368 CAGAGGCAGCCAGCGGGTGGGGG - Exonic
1142280963 16:89147315-89147337 CAGAGTGAGCAAGGGGGGGAGGG + Intronic
1147513813 17:41097371-41097393 CAGAGTCAGCGGGATGGTGATGG + Exonic
1147549242 17:41427365-41427387 CGGGGGAAGGGAGCGGGTGAGGG - Intergenic
1152519153 17:80845345-80845367 CAGAGAAGGCGCGCGGGTGAGGG - Intronic
1153475829 18:5497388-5497410 CAGAGCAAGGTAGCAGGTGAGGG + Intronic
1153788991 18:8560789-8560811 CAGAGGAAGGGAGAGGGAGAGGG - Intergenic
1156500015 18:37551565-37551587 CAGAGTAAGGGTGAGGGTGCAGG + Intronic
1159378751 18:67629085-67629107 CACAATAAGCCAGAGGGTGATGG - Intergenic
1159939698 18:74397425-74397447 CAGAGTGAGCGAGAGCGAGAGGG + Intergenic
1160129592 18:76212928-76212950 CAGAGGAAGAGAGAGGGAGAGGG - Intergenic
1161507304 19:4650773-4650795 CCGAGTGAGCCAGGGGGTGATGG - Intronic
1162311162 19:9908115-9908137 CATAGTGAGCGAGCGGAAGAGGG - Intronic
1162363192 19:10231495-10231517 CAGAGTGAGAGATCGGGTGGGGG - Intergenic
1163342987 19:16721693-16721715 CAGAGTCAGGGAGCGAGTGCGGG - Intronic
1164179715 19:22807708-22807730 CCGAGTGACCGAGCGGGTGCGGG - Intergenic
1165434090 19:35787354-35787376 CAGAGACAGCGAGCGGTGGAAGG - Exonic
1165700475 19:37933387-37933409 AAGAGTAAGGGCGAGGGTGAGGG - Intronic
1165830121 19:38726472-38726494 CAGAGCCAGCCAGCGGGTGCCGG + Intronic
1165889341 19:39101122-39101144 CAGGGTGAATGAGCGGGTGAGGG - Intronic
1168452195 19:56475386-56475408 AAGAGTAAGGGAGCTGGGGAAGG - Intronic
1168709602 19:58491419-58491441 CAGAGGAATGGAGCTGGTGATGG - Intronic
927985702 2:27409231-27409253 CGGAGAAAGAGAGCGGGGGATGG - Intronic
932865134 2:75333841-75333863 CAGAGGAAGCCATCTGGTGAAGG + Intergenic
946408398 2:219504844-219504866 CAGAGCAAGGCAGCTGGTGAGGG - Intronic
948883071 2:240870155-240870177 CAGAGACAGGGAGGGGGTGAGGG + Intronic
1169083948 20:2815584-2815606 CAGAGTCAGGGGGCCGGTGAAGG + Exonic
1169244547 20:4015418-4015440 CCGAGTAAGTGAGCGAGCGAGGG - Intronic
1171147243 20:22795614-22795636 CAGAGGAAGGGAGCTCGTGAAGG + Intergenic
1171771728 20:29327245-29327267 TAGAGAAAGAGAGAGGGTGAGGG + Intergenic
1171779792 20:29408623-29408645 TAGAGAAAGGGAGAGGGTGAGGG - Intergenic
1171820807 20:29836126-29836148 TAGAGAAAGGGAGAGGGTGAGGG - Intergenic
1171823393 20:29875030-29875052 TAGAGAAAGGGAGAGGGTGAGGG - Intergenic
1171896317 20:30813467-30813489 CAGAGAAAGGGAAAGGGTGAGGG + Intergenic
1171896705 20:30815278-30815300 TAGAGAAAGGGAGAGGGTGAGGG + Intergenic
1171904774 20:30892252-30892274 TAGAGAAAGGGAGAGGGTGAGGG - Intergenic
1173370020 20:42426876-42426898 CAGGGGAAGCCAGCAGGTGATGG + Intronic
1173654348 20:44689713-44689735 CACAGTCAGTGAGGGGGTGAAGG - Intergenic
1174231068 20:49046094-49046116 CAGATTCAGCGAGCGGCTGCTGG - Intergenic
1178191075 21:30281853-30281875 CAAAGTAAGAAAGCCGGTGATGG + Exonic
1179519008 21:41930006-41930028 GGGAGGAAGCGAGCAGGTGAGGG + Intronic
1180317125 22:11285077-11285099 TAGAGAAAGGGAGAGGGTGAGGG + Intergenic
1180338201 22:11598387-11598409 TAGAGAAAGGGAGAGGGTGAGGG - Intergenic
1183101839 22:35588908-35588930 CAGAGCCAGGGAGCAGGTGAAGG + Intergenic
1185292136 22:50032445-50032467 CAGAGGCAGTGAGCAGGTGAGGG + Intronic
951924309 3:27890486-27890508 CAGAGAGAGCGAGAGGGAGAGGG - Intergenic
952077873 3:29720097-29720119 CAGAGGGAGCTAGCGGGTAATGG - Intronic
954131460 3:48563211-48563233 CAGAGTGACAGAGCGGGGGATGG + Intronic
954593089 3:51800932-51800954 CAGAGTAAGGGAGGGGGAGAGGG + Intergenic
955936107 3:64104151-64104173 CAGAGTAAGCAAGCGATTGGAGG - Intronic
957085335 3:75672001-75672023 TAGAGAAAGGGAGAGGGTGAGGG + Intergenic
961474861 3:127140273-127140295 GAGAGTGAGCGAGAGGGTGAGGG + Intergenic
964071644 3:152641667-152641689 AAGAGTAGGCTAGAGGGTGAGGG - Intergenic
965360723 3:167735225-167735247 CAGAGGAAGGAAGGGGGTGAGGG + Intronic
975260043 4:72287420-72287442 AAGAGAAAGGGAGAGGGTGAAGG + Intronic
978547964 4:109893520-109893542 CAGAGCAAGAGAGAGAGTGAAGG - Intergenic
979292995 4:118998860-118998882 CAGAGTAAGAGAGAGAGGGAGGG - Intronic
981085429 4:140678405-140678427 CAGAGCTAGAGAGAGGGTGATGG - Intronic
985445621 4:190019696-190019718 TAGAGAAAGGGAGCGGGCGAGGG - Intergenic
986232155 5:5876118-5876140 CAGAGAAAGAGAGAGGGAGATGG - Intergenic
997791755 5:136768314-136768336 CAGAGTGAGAGAGAGGGTCAAGG + Intergenic
999820993 5:155228583-155228605 CAGAGTAAGCAAGCGGAGAATGG + Intergenic
1008869930 6:56261155-56261177 CAGAGTGAGGGAGAGGGAGAGGG - Intronic
1009817615 6:68756104-68756126 CCGAGTTAGCTAGCAGGTGAAGG - Intronic
1011193748 6:84762764-84762786 CAGAGAAAGGGAACTGGTGAGGG + Intronic
1011516815 6:88164556-88164578 CTGAGTTAGAGAGCGGGGGAGGG + Intronic
1012220841 6:96647232-96647254 CAGAGAAAGAGAGCAGGAGATGG - Intergenic
1013604140 6:111732467-111732489 GAAAGTAAGCGAGCGGTGGAGGG + Intronic
1016982075 6:149863389-149863411 CAGGGTAAGCGCGCGACTGAGGG - Exonic
1017510848 6:155113164-155113186 CAGAGCAAGCGAGGGGAAGAAGG - Intronic
1018684084 6:166289776-166289798 TAGAGCAAGCTAGCAGGTGAAGG - Intergenic
1019404021 7:873463-873485 CAGAGGACGTGAGCGTGTGACGG + Exonic
1029440348 7:100583788-100583810 CAGAGAAAGCGGGCAGGTGGAGG - Intronic
1033238321 7:139656107-139656129 CAGAGTGAGGGAGTGGGAGAAGG - Intronic
1034441036 7:151086309-151086331 CAGAGCCAGCGAGCGAGCGAGGG + Intronic
1034592062 7:152149337-152149359 CAGGGATAGAGAGCGGGTGATGG + Intronic
1034893436 7:154859900-154859922 CAGAGAAAGCGTGCGTGTGGCGG + Intronic
1036653774 8:10662577-10662599 CAGGGGAAGCGGGAGGGTGATGG - Intronic
1037723740 8:21466511-21466533 TAGAGTGAGCGAGCAGATGAAGG - Intergenic
1038436039 8:27536840-27536862 CAGAGCAAGCGATGAGGTGAGGG + Exonic
1039111531 8:34045467-34045489 CAGAGGAAGAGAACAGGTGATGG - Intergenic
1050797361 9:9560975-9560997 CAGAGAAAGAGAGAGAGTGAAGG - Intronic
1052524003 9:29589030-29589052 CAGAGAAAGCGAGAGAGAGAAGG - Intergenic
1053350411 9:37410321-37410343 CAGAGTGAGGGAGGGGGAGAAGG + Intergenic
1053454960 9:38226893-38226915 CAGAGTAAGGGGGCGGGGGCTGG + Intergenic
1053749338 9:41236583-41236605 TAGAGAAAGGGAGAGGGTGAGGG + Intergenic
1054254777 9:62801460-62801482 TAGAGAAAGGGAGAGGGTGAGGG + Intergenic
1054336529 9:63814142-63814164 TAGAGAAAGGGAGAGGGTGAGGG - Intergenic
1054897193 9:70327970-70327992 CAGAGTAGGAGAGAGGATGAGGG + Intronic
1057899805 9:98939557-98939579 CAGAGAAAGCGCTCAGGTGAAGG + Intergenic
1058146315 9:101415736-101415758 CAGAGTAACAGAGCAGGAGAAGG + Intergenic
1058740894 9:107941000-107941022 AAGAGCAAGAGAGAGGGTGAGGG - Intergenic
1059052545 9:110942054-110942076 CACAGTCAGCAAGCTGGTGATGG - Exonic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1061811162 9:133163503-133163525 CAGAGGAAGAGAGAGGGAGAGGG - Intronic
1203365364 Un_KI270442v1:250789-250811 TAGAGAAAGGGAGAGGGTGAGGG + Intergenic
1203376465 Un_KI270442v1:381563-381585 TAGAGAAAGGGAGAGGGTGAGGG - Intergenic
1186496174 X:10014685-10014707 CAGAGCCCGGGAGCGGGTGAAGG + Intergenic
1186854010 X:13608547-13608569 GAGAGTAAGGGAGAGGGAGAAGG - Intronic
1188819671 X:34759302-34759324 GAGAATAAGGGAGTGGGTGATGG + Intergenic
1190108482 X:47574669-47574691 CAGGGTAAGCGAGAGGCTGGCGG - Exonic
1190338382 X:49277141-49277163 CAGAGTAAGCGAGCGGGTGAGGG - Intronic
1197704999 X:129628606-129628628 CAGAGCAAGCGAGTGAGAGATGG + Intergenic
1197749993 X:129957605-129957627 CAGAGGGAGGGAGCGGGGGAAGG - Intergenic
1197829652 X:130627823-130627845 CACAGTGAGAGAGCAGGTGAGGG + Intronic
1201065592 Y:10091994-10092016 TAGAGAAAGGGAGAGGGTGAGGG + Intergenic
1201073324 Y:10169436-10169458 TAGAGAAAGGGAGAGGGTGAGGG - Intergenic
1201178415 Y:11323278-11323300 CAGAGGAAGCGAGCAGCTGGAGG - Intergenic