ID: 1190339388

View in Genome Browser
Species Human (GRCh38)
Location X:49284929-49284951
Sequence CCCTTTCAAAAGATGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1003
Summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 947}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190339388 Original CRISPR CCCTTTCAAAAGATGGAGCT AGG Intronic
900692677 1:3990945-3990967 CCCATTCAATAAATGGTGCTTGG - Intergenic
901360515 1:8695180-8695202 CCTATTCAAAAAATGGTGCTGGG + Intronic
901857901 1:12055936-12055958 CCCTTACAACAGATGGCTCTGGG + Intergenic
901890542 1:12259746-12259768 CGCTTTTAAAAAATGTAGCTGGG + Intronic
902590563 1:17471326-17471348 CCATTTAAAAAAATGGGGCTGGG + Intergenic
902613191 1:17609089-17609111 TCCTTTTAAAAGATGTAGCGGGG + Intronic
903555500 1:24190179-24190201 CCCTTTCAACAGATGAAACTCGG + Intergenic
903584349 1:24399333-24399355 GCCTTTCAATAAATGGTGCTGGG + Intronic
904448295 1:30593585-30593607 TCTTTTCAAAAAATGGTGCTGGG + Intergenic
904776362 1:32909894-32909916 GTCTTTCAACAAATGGAGCTGGG + Intergenic
905155030 1:35970202-35970224 CCCTTTCAATGGATAGAGGTAGG + Intronic
905466943 1:38162069-38162091 GCTTTTCAAAAGATGGACCTGGG - Intergenic
905633695 1:39534384-39534406 CCTTTTCAACAAATGGTGCTAGG + Intergenic
906369838 1:45243388-45243410 CCTTTTCAATAAATGGTGCTGGG + Intronic
907949458 1:59167708-59167730 TCTTTTCAACAGATGGTGCTGGG + Intergenic
907949464 1:59167744-59167766 CCCATTCAAAAGAATGAGGTGGG + Intergenic
908095683 1:60735015-60735037 CCCTTTCAGCAGACAGAGCTAGG - Intergenic
908104564 1:60828183-60828205 CCTTTTCAACAAATGGTGCTGGG - Intergenic
908298975 1:62742688-62742710 CCTTTTCAACAAATGGTGCTGGG + Intergenic
908442057 1:64164750-64164772 GCCTTTCAGAGGGTGGAGCTTGG - Intronic
909025284 1:70474827-70474849 GCCTATCAGAAGGTGGAGCTTGG + Intergenic
909304733 1:74059471-74059493 TCTTTTCAAAAAATGGTGCTGGG - Intronic
909674088 1:78219789-78219811 CCTTTTCAACAAATGGTGCTGGG + Intergenic
909680892 1:78290383-78290405 CCTTTTCAACAAATGGTGCTCGG - Intergenic
909947958 1:81684867-81684889 CCTTTTCAACAAATGGTGCTGGG - Intronic
910078054 1:83303789-83303811 CCTTTTCAATAAATGGTGCTGGG + Intergenic
910101884 1:83585987-83586009 CCTTTTCAACAAATGGTGCTGGG - Intergenic
910380833 1:86624932-86624954 CCTTTTCAACAAATGGTGCTGGG + Intergenic
910734028 1:90432368-90432390 CCTTTTCAACAAATGGTGCTGGG + Intergenic
911310302 1:96284511-96284533 CCTATTCAATAAATGGAGCTGGG - Intergenic
911481478 1:98447474-98447496 CCTTTTCAATAAATGGTGCTGGG - Intergenic
911689536 1:100816924-100816946 CCTTTTCAACAAATGGTGCTGGG + Intergenic
912227543 1:107752246-107752268 CCTTTTCAACAAATGGTGCTGGG + Intronic
912279647 1:108299486-108299508 CCTATTCAATAGATGGTGCTGGG - Intergenic
912288579 1:108394871-108394893 CCTATTCAATAGATGGTGCTGGG + Intronic
912524901 1:110274772-110274794 CCTTTTCAATAAATGGTGCTGGG + Intronic
912611814 1:111054982-111055004 CCTATTCAACAGATGGTGCTGGG - Intergenic
913060561 1:115201914-115201936 CCTTTTCAATAAATGGTGCTGGG + Intergenic
913143574 1:115966552-115966574 CCTTTTCAACAAATGGTGCTGGG + Intergenic
913151761 1:116051472-116051494 CCTTTTCAACATATGGTGCTGGG + Intronic
913587661 1:120291772-120291794 CCTTTTCAACAAATGGTGCTGGG - Intergenic
913620524 1:120606597-120606619 CCTTTTCAACAAATGGTGCTGGG + Intergenic
914346482 1:146803924-146803946 CCTTTTCAACAAATGGTGCTGGG + Intergenic
914569681 1:148903641-148903663 CCTTTTCAACAAATGGTGCTGGG - Intronic
914603148 1:149226617-149226639 CCTTTTCAACAAATGGTGCTGGG + Intergenic
915045843 1:153014828-153014850 CCTTTTCAACAAATGGTGCTGGG - Intergenic
915757206 1:158273685-158273707 ATCTTTTAAAAGATGGAGCCAGG - Intergenic
915818425 1:158995089-158995111 CCTTTTCAATAAATGGTGCTAGG - Intergenic
916608092 1:166363002-166363024 CCCTTTCAAAGGACAGAGCTGGG + Intergenic
916910762 1:169343341-169343363 TCTTTTCAACAGATGGTGCTAGG - Intronic
916981087 1:170137794-170137816 CCCTCTCAACAAATGGTGCTGGG + Intergenic
917007956 1:170436623-170436645 CCCTCTCTAAAAATAGAGCTCGG - Intergenic
917053789 1:170956048-170956070 CCTTTTCAACAAATGGTGCTGGG - Intronic
917228416 1:172809248-172809270 CCTTTTCAATAAATGGTGCTGGG - Intergenic
917303641 1:173605141-173605163 TCTTTTCAGAAGATGGAGTTGGG - Intergenic
917461985 1:175239390-175239412 CCTTTTCAACAAATGGTGCTAGG + Intergenic
917746521 1:178013941-178013963 CCCATTCAATAAATGGTGCTAGG - Intergenic
917879500 1:179320265-179320287 TCTTTTCAACAAATGGAGCTGGG - Intronic
917886727 1:179393199-179393221 CCTTTTCAACAAATGGTGCTGGG - Intronic
917887342 1:179399336-179399358 CCTTTTCAATAAATGGTGCTGGG + Intronic
918021393 1:180695664-180695686 CCTCTTCAAAAAATGGTGCTGGG - Intronic
918162395 1:181913719-181913741 CACTGTTAAAAGATGGTGCTGGG + Intergenic
918172297 1:182010123-182010145 CCTATTCAACAGATGGTGCTGGG + Intergenic
918179803 1:182077033-182077055 CCTTTTCAAATAATGGTGCTAGG + Intergenic
918739748 1:188114083-188114105 CCCTTTAAAAAGATGGACTGGGG - Intergenic
918746560 1:188208828-188208850 CCTTTTCAATAAATGGTGCTGGG + Intergenic
918873883 1:190012804-190012826 CCTCTTCAAAAAATGGTGCTGGG + Intergenic
918974366 1:191462883-191462905 CCTATTCAAAAAATGGTGCTGGG + Intergenic
919109184 1:193196222-193196244 CCTTTTCAACAAATGGTGCTGGG - Intronic
919459151 1:197856114-197856136 CCCTTTCAGAGGATGGAGGGTGG + Intergenic
919533853 1:198761537-198761559 CCTTTTCAATAAATGGTGCTGGG + Intergenic
920037438 1:203075446-203075468 CCCTTTGGAAAGAGGGAGCGAGG - Intronic
921104717 1:211964730-211964752 CCTGTTCAATAGATGGTGCTGGG + Intronic
921236729 1:213139573-213139595 CCTATTCAAAAAATGGTGCTGGG - Intronic
921409559 1:214820906-214820928 CCTTTTCAACAAATGGTGCTGGG - Intergenic
921438374 1:215154813-215154835 CCTATTCAATAGATGGTGCTGGG - Intronic
921834921 1:219768635-219768657 CCTTTTCAACAAATGGTGCTGGG + Intronic
922658391 1:227406330-227406352 CCTTTTCAACAAATGGTGCTGGG + Intergenic
922926959 1:229356628-229356650 CCTTTTCAACAAATGGTGCTGGG - Intergenic
922995536 1:229955881-229955903 CCTTTTCAACAAATGGTGCTGGG - Intergenic
924568661 1:245218790-245218812 CCTTTTTAAAAAAGGGAGCTTGG + Intronic
924682747 1:246254369-246254391 CCCTGTCAATAAATGGTGCTGGG - Intronic
924882914 1:248182409-248182431 CCTATTCAACAGATGGTGCTGGG - Intergenic
924891162 1:248281834-248281856 CCTGTTCAAAAAATGGTGCTGGG - Intergenic
1062851753 10:748859-748881 CCCTTTTAATAAATGGTGCTGGG + Intergenic
1063081188 10:2769061-2769083 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1063542391 10:6947169-6947191 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1063701597 10:8389652-8389674 TTCTTTCAAAAATTGGAGCTGGG - Intergenic
1063815015 10:9761139-9761161 CTCTTTCAAGAGACCGAGCTGGG - Intergenic
1063962903 10:11321859-11321881 ACCCTTCAGAAGATGTAGCTGGG - Intronic
1064700450 10:18013700-18013722 TCCTTTCAAGAGATGGTGCTGGG - Intronic
1064830843 10:19464442-19464464 CCTATTCAAAAAATGGTGCTGGG - Intronic
1065041299 10:21699607-21699629 CCTCTTCAAAAAATGGTGCTGGG - Intronic
1065227658 10:23561728-23561750 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1065470560 10:26076727-26076749 CCTTTTCAACAAATGGTGCTGGG - Intronic
1066356720 10:34691854-34691876 CCCATTCAATAAATGGTGCTGGG + Intronic
1067351818 10:45482899-45482921 CCCTCTCAATAAATGGTGCTGGG + Intronic
1067522654 10:47019837-47019859 TCCTCTGAGAAGATGGAGCTTGG + Intergenic
1068073558 10:52225719-52225741 CCTTTTCAACAAATGGTGCTGGG - Intronic
1068227347 10:54122928-54122950 CCTATTCAATAAATGGAGCTTGG + Intronic
1068693789 10:59944326-59944348 CACTGTCAAGGGATGGAGCTTGG + Intergenic
1068991633 10:63157014-63157036 CCCTTCCAAAGGATGGGGCATGG - Intergenic
1069150064 10:64949089-64949111 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1069278126 10:66618468-66618490 CCCTTTTAATAAATGGTGCTGGG + Intronic
1069298210 10:66873669-66873691 CCCATTCAACAAATGGTGCTGGG + Intronic
1069302823 10:66928988-66929010 AACTATCAAAAGATGGTGCTAGG + Intronic
1069325796 10:67230230-67230252 CCTTTTCAACAAATGGTGCTGGG + Intronic
1069343109 10:67436232-67436254 CCTTTTCAACAAATGGTGCTGGG + Intronic
1069569847 10:69487718-69487740 TTCTTTCAAGTGATGGAGCTGGG + Intronic
1070433617 10:76365973-76365995 CCTTTTCAACAAATGGTGCTGGG - Intronic
1071023795 10:81088442-81088464 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1071035036 10:81234533-81234555 CCTTTTCAACAAATGGTGCTCGG - Intergenic
1071301619 10:84260474-84260496 CCTTTTCAATAAATGGTGCTGGG - Intergenic
1071355831 10:84793237-84793259 TCTTTGCAAAAGATGGAGCTGGG - Intergenic
1071405430 10:85325564-85325586 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1071560532 10:86643458-86643480 CCCATTCAAAATTTGGGGCTGGG - Intergenic
1072380502 10:94864287-94864309 CCTTTTCAACAGATGGTGCTGGG - Intergenic
1073389330 10:103160151-103160173 TCTTTTCAAAAAATGGTGCTAGG + Intronic
1073994884 10:109304171-109304193 CCTTTTCAATAAATGGTGCTGGG + Intergenic
1074179930 10:111051061-111051083 TCCTTTCAGCAGATAGAGCTAGG - Intergenic
1074985401 10:118654261-118654283 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1075538407 10:123291545-123291567 CCTTTTCAACATATGGTGCTGGG + Intergenic
1075660212 10:124188821-124188843 CCTTTTCAACAAATGGTGCTAGG - Intergenic
1075821118 10:125312528-125312550 CCTATTCAATAAATGGAGCTGGG + Intergenic
1075889280 10:125931939-125931961 CCTTTTCAACAAATGGTGCTGGG - Intronic
1076584951 10:131540541-131540563 CCTATTCAAAAAATGGTGCTGGG + Intergenic
1076663928 10:132074910-132074932 CCTTTTCAATAAATGGTGCTGGG - Intergenic
1076665137 10:132083764-132083786 CCCTTTTAACAAATGGTGCTGGG - Intergenic
1076699291 10:132262202-132262224 CCCATTCAATAAATGGTGCTGGG + Intronic
1076700342 10:132269710-132269732 GCCTTGCAAAAGGTGGAGGTGGG + Intronic
1078029110 11:7730857-7730879 TCCTTTCAATAAATGGTGCTGGG - Intergenic
1078289047 11:9988171-9988193 CCTTTTCAACAAATGGTGCTGGG + Intronic
1078684246 11:13512779-13512801 CCCTATCAATAAATGGTGCTGGG - Intergenic
1078960788 11:16266950-16266972 TCTCTTCAATAGATGGAGCTGGG + Intronic
1079791261 11:24742925-24742947 CCTTTTCAACAAATGGTGCTGGG - Intronic
1079807724 11:24955459-24955481 GCCTTTCAAAAGATTGAGAGAGG + Intronic
1080635959 11:34123425-34123447 CGCTTTCAAATGGTGAAGCTGGG - Intronic
1080672127 11:34390243-34390265 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1080831866 11:35902002-35902024 CCCTCTCAACAGAAAGAGCTAGG - Intergenic
1081009384 11:37789615-37789637 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1081062775 11:38501653-38501675 CCTTTTCAATAAATGGTGCTGGG - Intergenic
1081106110 11:39071880-39071902 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1081195646 11:40157168-40157190 CCCCTTCAACAAATGGTGCTGGG + Intronic
1081221243 11:40465218-40465240 CCCGTTCAATAAATGGTGCTGGG + Intronic
1082685875 11:56238897-56238919 CCTTTTCAATAAATGGTGCTGGG - Intergenic
1082949823 11:58801555-58801577 CCCATTCAAAAAATGGTGCTAGG + Intergenic
1083017085 11:59465484-59465506 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1084505440 11:69563918-69563940 GCCCTTCAAAAGACCGAGCTGGG - Intergenic
1085025722 11:73235410-73235432 CCCTGTCAAATGACGGAGCATGG - Exonic
1085149849 11:74242209-74242231 CCTTTTCAATAAATGGAGCTGGG - Intronic
1085342139 11:75739287-75739309 CCCTCTCAGAAGACAGAGCTAGG - Intergenic
1085437878 11:76525238-76525260 CTCTTTCCAGAGATGGTGCTGGG + Intronic
1085481087 11:76823604-76823626 CCCTTTCAGGAGAAGGAGGTGGG + Intergenic
1086013848 11:82139870-82139892 CCCTATCAATAAATGGTGCTAGG + Intergenic
1086082397 11:82918317-82918339 CCTTTTCAACAAATGGTGCTGGG - Intronic
1086510392 11:87551221-87551243 CCCTTTCAATAAATGGTGCTGGG - Intergenic
1086587235 11:88467772-88467794 CCTTTTCAATAAATGGTGCTAGG - Intergenic
1086819384 11:91416197-91416219 CCTATTCAACAGATGGTGCTAGG + Intergenic
1086824877 11:91484427-91484449 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1086984126 11:93229979-93230001 CCCTTTCAGCAGAAAGAGCTAGG + Intergenic
1087398529 11:97634201-97634223 CCTATTCAATAAATGGAGCTGGG - Intergenic
1087602432 11:100333693-100333715 CCATTTCAACAAATGGTGCTGGG + Intronic
1087672467 11:101124510-101124532 ATCTTTCAAAAGAAGGAGCTGGG + Intronic
1088010039 11:104989294-104989316 CCTTTTCAATAAATGGTGCTGGG + Intergenic
1088206839 11:107401990-107402012 CCTTTTCAACAAATGGTGCTGGG + Intronic
1088414207 11:109570966-109570988 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1088946767 11:114521624-114521646 CCTTTTCAATAGACAGAGCTAGG + Intergenic
1089159814 11:116428741-116428763 CAGTTTCTGAAGATGGAGCTCGG + Intergenic
1089380319 11:118026025-118026047 CCTATTCAAAAAATGGTGCTGGG - Intergenic
1089952489 11:122542218-122542240 CCCTTTAAACAAATGGTGCTGGG - Intergenic
1090142651 11:124281168-124281190 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1090665558 11:128912882-128912904 CACTTTCGAATGATAGAGCTAGG + Intronic
1090894605 11:130959867-130959889 CCTTTTCAAGAAATGGTGCTGGG - Intergenic
1091210056 11:133849608-133849630 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1091563811 12:1633414-1633436 CTCTTTCAAAAGAAAAAGCTGGG - Intronic
1091842942 12:3633556-3633578 CCCTTCCCAAAGATGGGCCTAGG + Intronic
1091874650 12:3924016-3924038 CCTTTTCAATAGATGGAGAAGGG + Intergenic
1092399300 12:8160056-8160078 CCTTTTCAACAAATGGTGCTGGG - Intronic
1092961527 12:13601030-13601052 CACTTTGAAAGGATGGGGCTGGG + Intronic
1093011034 12:14107044-14107066 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1093408812 12:18840483-18840505 CCCTTTCAACAAATGGTGCTGGG - Intergenic
1093864050 12:24203459-24203481 CCCTCTCAGCAGATAGAGCTGGG + Intergenic
1093951978 12:25172861-25172883 CCTTTTCAACAAATGGTGCTGGG + Intronic
1093995413 12:25635892-25635914 CCTTTTCAACAAATGGTGCTGGG + Intronic
1094253081 12:28388765-28388787 CCTTTTCAACAAATGGTGCTGGG + Intronic
1094276351 12:28680502-28680524 CCATTTCATAAGATGAAGCTAGG + Intergenic
1094802444 12:34052376-34052398 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1095115605 12:38348315-38348337 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1095229044 12:39715294-39715316 CCTTTTCAACAAATGGTGCTGGG - Intronic
1095247671 12:39941942-39941964 CCTTTTCAACAGATGGTGTTGGG - Intronic
1095400253 12:41806345-41806367 CCCGTTCAATAAATGGTGCTGGG - Intergenic
1095858788 12:46891526-46891548 CCCTTTCCACAAATAGAGCTGGG - Intergenic
1095867389 12:46987406-46987428 CCCATTTAATAAATGGAGCTAGG + Intergenic
1095911047 12:47426788-47426810 CCCATTTAAAAGATAGAGGTGGG + Intergenic
1096345884 12:50846372-50846394 ACTTTTCAATAGATGGTGCTGGG - Intronic
1096348368 12:50871355-50871377 CCCTTTCAACAAATGGGGCTGGG + Intronic
1096437463 12:51606321-51606343 CCTTTTCAACAAATGGTGCTGGG - Intronic
1096961910 12:55587987-55588009 CATTTTCAAAAAATGGTGCTGGG + Intergenic
1096992666 12:55817884-55817906 CTCTTTCAAAAGGTGGAACTGGG + Intronic
1097200611 12:57275227-57275249 CCTTTTCAACAAATGGTGCTGGG + Intronic
1097337535 12:58399771-58399793 CCTATTCAAAAAATGGTGCTGGG + Intergenic
1097465956 12:59924785-59924807 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1097607500 12:61773615-61773637 CCTTTTCAACAAATGGTGCTAGG + Intronic
1097638943 12:62155702-62155724 CCTTTTCAACAAATGGTGCTGGG + Intronic
1097760867 12:63462430-63462452 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1098999281 12:77158961-77158983 CCTTTTCAATAAATGGTGCTGGG - Intergenic
1099236607 12:80090272-80090294 CCTTTTCAATAAATGGTGCTAGG + Intergenic
1099323314 12:81179052-81179074 TCCATTCAATAAATGGAGCTAGG + Intronic
1099393136 12:82103964-82103986 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1099472604 12:83069921-83069943 CCTTTTCAACAAATGGTGCTGGG - Intronic
1100420794 12:94431202-94431224 CCCCTTCAATAAATGGTGCTGGG + Intronic
1101634868 12:106531006-106531028 CCTTTTCAACAAATGGTGCTGGG - Intronic
1102887124 12:116530603-116530625 CTCATCTAAAAGATGGAGCTAGG + Intergenic
1102910351 12:116708884-116708906 CCCTTGCAGAAGAGGGAACTGGG - Intergenic
1102916270 12:116755219-116755241 CCTTTTCAACAAATGGTGCTGGG - Intronic
1103173991 12:118845675-118845697 CCCTTACAGAAGGTGGTGCTGGG - Intergenic
1103179366 12:118895888-118895910 CCCATTCAATAAATGGTGCTGGG + Intergenic
1104112027 12:125713143-125713165 ACTTTTCAAAAGAAGTAGCTTGG - Intergenic
1104332956 12:127864780-127864802 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1105203598 13:18200682-18200704 TCCTCTCAATAGATGGTGCTGGG - Intergenic
1105296296 13:19090261-19090283 CCACGTCAAAAGATGGGGCTTGG + Intergenic
1105603563 13:21908822-21908844 CCCTTTCACAAAATGTAGCTCGG + Intergenic
1105908693 13:24839640-24839662 CCTTTTCAACAAATGGTGCTGGG + Intronic
1105931206 13:25054265-25054287 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1106060501 13:26286421-26286443 CCCATTCAATAAATGGTGCTGGG + Intronic
1106105701 13:26731626-26731648 CCTTTTCAATAAATGGTGCTGGG - Intergenic
1106140850 13:27010151-27010173 CTCTTTCAGTGGATGGAGCTAGG + Intergenic
1106691472 13:32122011-32122033 CCTTTTCAACAAATGGTGCTGGG - Intronic
1106905440 13:34404016-34404038 CCTTTTCAATAAATGGTGCTGGG + Intergenic
1106921169 13:34564864-34564886 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1106958969 13:34975369-34975391 CCTATTCAACAGATGGTGCTGGG + Intronic
1106977886 13:35244347-35244369 CTCTTTCAACAAATGGTGCTGGG - Intronic
1107453163 13:40530595-40530617 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1107755579 13:43618471-43618493 CCTTTTCAACAAATGGTGCTGGG - Intronic
1108833824 13:54515196-54515218 GCCTTTCATAAGGTGGAGGTTGG - Intergenic
1108989616 13:56638759-56638781 CCCTTTTAATAAATGGTGCTGGG - Intergenic
1109213208 13:59558800-59558822 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1109288139 13:60436505-60436527 CCTTTTCAATAAATGGTGCTGGG - Intronic
1110204862 13:72900508-72900530 CCTTTTCAATAAATGGTGCTGGG + Intronic
1110258084 13:73454217-73454239 CCCTTTTAATAAATGGTGCTGGG - Intergenic
1110272123 13:73602751-73602773 CCTTTTCAATAAATGGTGCTGGG + Intergenic
1110418921 13:75282831-75282853 CCCATTCAACAAATGGTGCTTGG - Intergenic
1110634583 13:77751728-77751750 GCCTTTCAGAAGAGGGAGCAGGG + Intronic
1110975565 13:81829603-81829625 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1111851915 13:93586522-93586544 CCTGTTCAAAAAATGGTGCTGGG + Intronic
1111988827 13:95094427-95094449 CCTTTTCAACAAATGGTGCTGGG + Intronic
1112250729 13:97776901-97776923 CCTATTCAAAAAATGGTGCTGGG - Intergenic
1112348981 13:98617129-98617151 CTCTTTCAGCAGATAGAGCTAGG - Intergenic
1112419839 13:99238263-99238285 CACTTTCAAAACATCGACCTGGG - Intronic
1112747714 13:102545928-102545950 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1113337280 13:109389171-109389193 CCCTTTCAACAGATGAATTTTGG - Intergenic
1113610623 13:111642398-111642420 CCCTTTCCTCAGGTGGAGCTGGG + Intronic
1113988113 13:114335462-114335484 CCCGTTCAATAAATGGTGCTGGG + Intergenic
1114918451 14:27296325-27296347 CCATTCCAAAAGATGGAAATGGG + Intergenic
1114951874 14:27764781-27764803 CCCATTCAATAAATGGTGCTGGG + Intergenic
1114961117 14:27891050-27891072 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1114998922 14:28397382-28397404 TCCTTTCAATAAATGGTGCTGGG - Intergenic
1115023636 14:28713996-28714018 CCCTTTTAAAAGATGTAGACTGG + Intergenic
1115365755 14:32555244-32555266 CACTTGCTAGAGATGGAGCTGGG + Intronic
1115526784 14:34288644-34288666 CCTTTTCAACAAATGGTGCTGGG - Intronic
1115680681 14:35734462-35734484 CCTTTTCAATAAATGGTGCTGGG + Intronic
1116223724 14:42120601-42120623 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1116299429 14:43158817-43158839 GCCTTTCAAAGGGTGGAGGTTGG + Intergenic
1116583759 14:46676033-46676055 TCTTTTCAAAAAATGGTGCTAGG + Intergenic
1116732395 14:48640600-48640622 CATTTTCAAAAAATGGTGCTGGG + Intergenic
1116773998 14:49158954-49158976 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1117466049 14:55995280-55995302 CCTTTTTAAAAAATGGTGCTGGG - Intergenic
1117697433 14:58379900-58379922 CCCATTCAACAAATGGTGCTAGG - Intergenic
1118162714 14:63306695-63306717 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1118197033 14:63636674-63636696 CCTTTTCAACAAATGGTGCTGGG + Intronic
1118479581 14:66150786-66150808 CCTTTTCAATAAATGGTGCTGGG + Intergenic
1118531665 14:66713367-66713389 CCTTTTCAAGAAATGGTGCTAGG - Intronic
1118592161 14:67410044-67410066 CCCTTGGAAAAGACGGGGCTTGG - Intronic
1119056247 14:71423544-71423566 TCCTTTCAACAAATGGTGCTGGG - Intronic
1119637307 14:76285396-76285418 CCTTTTCAATATATGGAACTGGG - Intergenic
1121088813 14:91167262-91167284 ATCTTTCAAAAGCTGGAGCAAGG - Exonic
1121516180 14:94551911-94551933 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1123155607 14:106222260-106222282 CCCATTCAATAAATGGTGCTGGG - Intergenic
1123402265 15:19999390-19999412 CCCATTCAATAAATGGTGCTGGG - Intergenic
1123511606 15:21006056-21006078 CCCATTCAATAAATGGTGCTGGG - Intergenic
1124008881 15:25818845-25818867 CCTTTTCAATAAATGGTGCTGGG + Intronic
1124806683 15:32890970-32890992 CCTTTTCAACAAATGGTGCTGGG - Intronic
1125002017 15:34781359-34781381 CCCATTCAATAAATGGTGCTGGG - Intergenic
1125126303 15:36226003-36226025 CCTATTCAAAACATGGTGCTGGG + Intergenic
1125268952 15:37916865-37916887 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1125377427 15:39045479-39045501 CCCTTTCAACAAATGGTGCTGGG + Intergenic
1126060060 15:44772102-44772124 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1126460385 15:48908783-48908805 CCTTTTCAACAAATGGTGCTGGG - Intronic
1126571253 15:50154009-50154031 GTCTTTCTAAAGATTGAGCTTGG - Intronic
1126659556 15:51019238-51019260 CCTTTTCAATAAATGGTGCTGGG - Intergenic
1126904471 15:53349520-53349542 ATCTTTCAAAAGATGGAGGAAGG + Intergenic
1127050557 15:55079151-55079173 CCCTTTCAACAAATGGTGCTGGG + Intergenic
1127194864 15:56573276-56573298 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1127226540 15:56936711-56936733 CCCATTCAACAAATGGTGCTGGG - Intronic
1127525190 15:59785989-59786011 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1127723815 15:61728171-61728193 CCCTCTTCAGAGATGGAGCTTGG + Intergenic
1127929703 15:63584981-63585003 TCTTTTCAAAAGATGGTGCTGGG - Intronic
1128143797 15:65320904-65320926 TCTTTTCAAAAAATGGTGCTAGG - Intergenic
1128415469 15:67441645-67441667 CCTTTTCAACAAATGGTGCTGGG + Intronic
1128531812 15:68457463-68457485 TCATTTCAATAGATGGTGCTAGG + Intergenic
1128569372 15:68722688-68722710 CCCTCTCAACAGATGTAACTGGG + Intronic
1129046710 15:72741683-72741705 CCTATTCAACAGATGGTGCTGGG + Intergenic
1129096500 15:73214504-73214526 CCTTTTCAACAAATGGTGCTGGG - Intronic
1129924085 15:79346750-79346772 CCCATTCAATAAATGGTGCTGGG - Intronic
1130731813 15:86501679-86501701 CCTTTTCAACAAATGGTGCTAGG - Intronic
1130739588 15:86584418-86584440 CCTTTTCAATAAATGGTGCTGGG - Intronic
1130779960 15:87025916-87025938 CCTTTTCAACAAATGGTGCTGGG + Intronic
1130790851 15:87154521-87154543 CTTTTTCAACAGATGGTGCTGGG + Intergenic
1130852396 15:87807534-87807556 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1131877138 15:96820245-96820267 CCCTTTTAAAAGATGAAATTTGG + Intergenic
1132144778 15:99423152-99423174 TCCTTTCAATAAATGGTGCTGGG - Intergenic
1133225956 16:4340490-4340512 GCCCTTCAAAAAATGGACCTGGG - Intronic
1134333947 16:13277147-13277169 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1135935581 16:26777153-26777175 CCCATTCATAGGATGGGGCTGGG - Intergenic
1136562869 16:31051090-31051112 CCCTTTTTAAAAATAGAGCTAGG - Intergenic
1138924316 16:61572219-61572241 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1138998731 16:62482592-62482614 CCTTTTCAATAAATGGTGCTGGG - Intergenic
1139177436 16:64706252-64706274 CCCATTCATATGAGGGAGCTGGG - Intergenic
1139215699 16:65122831-65122853 CCCTCCCAAAAGCTGGAGCGAGG - Intronic
1140064386 16:71598339-71598361 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1140198150 16:72872804-72872826 GCCTTTCAAAAGATGGTGGGGGG + Intronic
1140620088 16:76719293-76719315 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1141075191 16:80999808-80999830 CCCATTCAATAAATGGTGCTGGG + Intronic
1143099023 17:4494794-4494816 CCCTGTCTAGAGATGGAGGTTGG + Intergenic
1143992242 17:10975528-10975550 CCTTTGCAAATGAAGGAGCTGGG - Intergenic
1144139256 17:12332065-12332087 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1144532583 17:16053952-16053974 CCCTATCAATAAATGGTGCTGGG + Intronic
1145183956 17:20778288-20778310 GCCTTTCAATATATGGCGCTGGG - Intergenic
1146554073 17:33808258-33808280 TCTTTTCAAAAAATGGTGCTGGG - Intronic
1146583798 17:34064285-34064307 CCTTTTCAACAAATGGTGCTGGG + Intronic
1146750931 17:35379388-35379410 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1146751045 17:35380837-35380859 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1147424545 17:40339860-40339882 ATCTTTCAAATGATGGAGCAAGG - Intronic
1147462733 17:40584325-40584347 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1147477572 17:40727392-40727414 ACCTTTCAATAGATGAAGTTAGG - Intergenic
1148082617 17:44976042-44976064 CCTCCTCAGAAGATGGAGCTGGG - Intergenic
1149202740 17:54206830-54206852 CCCATTCAATAAATGGTGCTGGG + Intergenic
1149390963 17:56189955-56189977 CCCTTTCAACAAATGATGCTGGG + Intronic
1149395315 17:56235586-56235608 CCTTTTCAAGAAATGGTGCTGGG - Intronic
1149410501 17:56400820-56400842 CCTTTTCAACAAATGGTGCTGGG - Intronic
1149586914 17:57795860-57795882 CCTTTTCAAAAACTGGTGCTGGG + Intergenic
1149934852 17:60794636-60794658 CCTTTTCAACAAATGGTGCTGGG - Intronic
1150088877 17:62302093-62302115 CCTATTCAAAAAATGGTGCTGGG - Intergenic
1150467808 17:65409351-65409373 CCTCTTCAAAAAATGGTGCTGGG + Intergenic
1150853477 17:68727998-68728020 CCCATTCAATAAATGGTGCTGGG + Intergenic
1151048779 17:70952400-70952422 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1152250597 17:79210674-79210696 GCCCTTCAAGAGATGGGGCTGGG + Intronic
1153069095 18:1084783-1084805 CCTTTTCAACAAATGGTGCTAGG - Intergenic
1153079516 18:1206015-1206037 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1153165305 18:2254953-2254975 CCCATTCAACAAATGGGGCTGGG + Intergenic
1153168519 18:2289144-2289166 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1153264625 18:3258069-3258091 CCATTTCAAAAGATCTGGCTAGG + Intergenic
1153402286 18:4694304-4694326 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1154129674 18:11725988-11726010 TCTTTTCAAAAGATGGTGCTGGG - Intronic
1155152420 18:23133981-23134003 CCTTTTGAAAACATGGAGCCTGG - Intergenic
1155467624 18:26155560-26155582 CCACTTCAATAAATGGAGCTGGG + Intronic
1155627839 18:27856900-27856922 CCCATTCAATAAATGGTGCTGGG - Intergenic
1156614197 18:38764076-38764098 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1157023962 18:43820534-43820556 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1157219420 18:45816048-45816070 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1158003023 18:52641124-52641146 CCTTTTCAACAAATGGTGCTGGG + Intronic
1158321446 18:56268536-56268558 TTCTTTGAAGAGATGGAGCTGGG - Intergenic
1158338527 18:56439697-56439719 CCTTTTCAATAAATGGTGCTGGG + Intergenic
1158756912 18:60336236-60336258 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1159170571 18:64761118-64761140 CTCTTTCAAAAAATTGAGGTTGG + Intergenic
1159288203 18:66380291-66380313 CCCTTAAAAAAAATGGTGCTGGG - Intergenic
1160267118 18:77348393-77348415 TCCTTTCAACAAATGGTGCTGGG - Intergenic
1161842732 19:6692799-6692821 CCCTTTGCAAAGATTGGGCTGGG - Intronic
1163239951 19:16055305-16055327 CCCATTCAATAAATGGTGCTGGG - Intergenic
1164002103 19:21110819-21110841 CCCTTTTAATAAATGGTGCTGGG - Intronic
1164008721 19:21177261-21177283 CCCTTTTAATAAATGGTGCTGGG - Intronic
1164238085 19:23355362-23355384 CCCTTTCAACAAATGGTTCTGGG + Intronic
1164298812 19:23940248-23940270 CCTTTTCAACAAATGGTGCTGGG - Intronic
1168011115 19:53533805-53533827 CCCTTGAACAACATGGAGCTGGG + Intronic
1168367647 19:55802924-55802946 CCTTTTCAATAAATGGTGCTGGG + Intronic
1168563333 19:57402129-57402151 TCTTTTCAAAAAATGGTGCTTGG - Intronic
925074374 2:1002021-1002043 CCCTATCCAAAAATGGTGCTGGG + Intronic
925109631 2:1322869-1322891 CTCTTTCAAAAGGTGGAGGGTGG - Intronic
926560573 2:14412924-14412946 CCTTTTCAACAAATGGTGCTGGG + Intergenic
926915567 2:17888444-17888466 CCTTTTCAATAAATGGTGCTGGG - Intronic
927327940 2:21828005-21828027 CCTTTTCAACAAATGGTGCTGGG - Intergenic
928647539 2:33370423-33370445 CACTTGCAAAAGATGGGGCGGGG + Intronic
929009883 2:37430639-37430661 CCTTTTCAACAAATGGTGCTGGG - Intergenic
929207748 2:39317170-39317192 CCCATTCAATAAATGGTGCTAGG + Intronic
929806260 2:45148226-45148248 CCTTTTCAACAAATGGTGCTGGG + Intergenic
929844687 2:45511061-45511083 CCTTGTCAAAAGAGGGAGCAAGG - Intronic
930277275 2:49326873-49326895 CCTTTTCAATAAATGGTGCTGGG + Intergenic
930486112 2:52013360-52013382 CCTTTTCAACAAATGGTGCTGGG - Intergenic
930559670 2:52945065-52945087 CCCATTCAATAAATGGTGCTGGG + Intergenic
930734523 2:54762898-54762920 CCTTTTCAGCAGATGGAGCTGGG + Intronic
931524690 2:63140045-63140067 CCTTTTCAACAAATGGTGCTGGG - Intronic
931536302 2:63280737-63280759 CCGTTTCAATAAATGGTGCTGGG + Intronic
931993278 2:67812466-67812488 CCTTTTCAACAGATGGTGCTGGG + Intergenic
932270772 2:70407424-70407446 CCTTTTCAACAAATGGTGCTGGG + Intergenic
932754764 2:74399624-74399646 ACCATTCAAAAAATGGTGCTGGG + Intergenic
932806427 2:74787630-74787652 CCCATTCAATAAATGGTGCTGGG - Intergenic
932865996 2:75343813-75343835 CAGATTCAAAAGATGGAGCAAGG - Intergenic
933085999 2:78054622-78054644 CCCATTCAACAAATGGTGCTGGG - Intergenic
934044180 2:88158327-88158349 CCTTTTCAACAAATGGTGCTGGG - Intergenic
935467564 2:103417063-103417085 CCTTTTCAACAAATGGTGCTGGG + Intergenic
935662731 2:105483602-105483624 CCTTTTCAATAAATGGGGCTGGG + Intergenic
935662792 2:105484468-105484490 CCCTTTCAATAAATGGTGCTGGG + Intergenic
935733371 2:106085023-106085045 CTCTTTAAAAAGATGGCGGTAGG - Intergenic
936555255 2:113491405-113491427 CCTTTTCAACAAATGGTGCTGGG + Intronic
937058277 2:118958895-118958917 CCTTTTCAACAAATGGTGCTGGG + Intronic
937068832 2:119045902-119045924 CCTTTTCAACAAATGGTGCTGGG - Intergenic
937471666 2:122179122-122179144 CCATTTCAAAGGATGGCACTGGG - Intergenic
937486462 2:122320304-122320326 CCATTTCAGAAAATGGAGCATGG - Intergenic
937609793 2:123847022-123847044 CCTGTTCAATATATGGAGCTAGG + Intergenic
938128648 2:128692428-128692450 CTCTTTAAAAAGATGGAGTTAGG + Intergenic
938597845 2:132806989-132807011 CCTTTTCAACAAATGGTGCTAGG - Intronic
939236963 2:139507089-139507111 CCTATTCAAAACATGGTGCTGGG + Intergenic
939305645 2:140407100-140407122 CCCATTCAATAAATGGTGCTGGG + Intronic
939610591 2:144305334-144305356 TCTTTTCAACAGATGGTGCTGGG - Intronic
939650997 2:144761834-144761856 CCTTTTCAAAAAATGGTACTGGG + Intergenic
940028263 2:149231867-149231889 CCTTTTCAACAAATGGTGCTGGG + Intergenic
940472635 2:154117747-154117769 CCTGTTCAAAAAATGGTGCTGGG + Intronic
940674490 2:156712149-156712171 CCTATTCAATAGATGGTGCTGGG - Intergenic
940680726 2:156781694-156781716 CCTTTTCAACAAATGGTGCTGGG + Intergenic
940707212 2:157120278-157120300 CCTTTTCAACAAATGGTGCTGGG - Intergenic
940709002 2:157139570-157139592 CCTTTTCAACAAATGGTGCTGGG - Intergenic
941425201 2:165335511-165335533 CCTTTTCAACAAATGGTGCTTGG + Intronic
941627841 2:167849489-167849511 CCTTTTCAACAAATGGTGCTGGG + Intergenic
942154330 2:173111656-173111678 CCTTTTCAACAAATGGTGCTGGG - Intronic
942726536 2:179014180-179014202 CCTTTTCAACAAATGGTGCTGGG + Intronic
942739390 2:179157054-179157076 CCTTTTCAACAAATGGTGCTGGG - Intronic
942819651 2:180097357-180097379 CCCATTCAATAAATGGTGCTGGG + Intergenic
942827300 2:180194057-180194079 CCCTTTTAATAAATGGTGCTGGG - Intergenic
942908472 2:181211999-181212021 CCCATTCAATAAATGGTGCTGGG + Intergenic
943363065 2:186944632-186944654 CCCTTTGGAAAGTTGGACCTGGG - Intergenic
943620922 2:190147232-190147254 CCTTTTCAACAAATGGTGCTAGG - Intronic
944021165 2:195106275-195106297 CCCATTCAATAAATGGTGCTGGG + Intergenic
944421106 2:199531224-199531246 CCTTTTCAACAAATGGTGCTGGG + Intergenic
944528489 2:200644293-200644315 CCTTTTCAACAAATGGTGCTAGG - Intronic
944771996 2:202923884-202923906 CCTATTCAACAGATGGTGCTGGG + Intronic
944830653 2:203530996-203531018 TCCTTTCAACAAATGGTGCTGGG + Intronic
945075557 2:206035497-206035519 CCCTTTCAACAAATGGTGCTGGG + Intronic
945131605 2:206579466-206579488 CCTTTTCAATAAATGGTGCTGGG - Intronic
945346791 2:208727677-208727699 CCCATTCAATAAATGGTGCTAGG - Intronic
945387395 2:209219162-209219184 CCTATTCAACAAATGGAGCTGGG + Intergenic
945636959 2:212367346-212367368 CCTTTTCAACAAATGGCGCTGGG + Intronic
945758345 2:213878880-213878902 CCCTTTTCAAAAATGGTGCTGGG - Intronic
945826222 2:214723107-214723129 CCTTTTCAACAAATGGTGCTGGG + Intergenic
945838670 2:214862464-214862486 CCTTTTCAACAAATGGTGCTGGG - Intergenic
945861250 2:215125035-215125057 CCTTTTCAACAAATGGTGCTGGG - Intronic
945865187 2:215166542-215166564 CCTTTTCAACAAATGGTGCTGGG + Intergenic
946731431 2:222713313-222713335 CCCTTTGAAAAGATCAAACTGGG - Intergenic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
946884119 2:224206006-224206028 CTCTTTCAAGAGATTGAGTTGGG - Intergenic
947181981 2:227419694-227419716 CCCATTCAAACTATGGATCTTGG - Intergenic
947370634 2:229442014-229442036 CCCTTGCTACAGATGCAGCTGGG + Intronic
947858567 2:233341821-233341843 CACTTTAAAATGATGAAGCTGGG + Intronic
948851421 2:240709138-240709160 CCTTTTCAATAGATGGAACTAGG + Intergenic
948859108 2:240744317-240744339 CCCTTTCAGAACACGGAGCTGGG + Intronic
1168870993 20:1128262-1128284 CCTTTTCAGCAGATAGAGCTAGG + Intronic
1169401780 20:5287713-5287735 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1169517041 20:6328583-6328605 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1170054333 20:12182843-12182865 CCCTTTCAACAAATGGTGCTAGG - Intergenic
1170491571 20:16881173-16881195 CCCCTTCAATAAATGGTGCTTGG - Intergenic
1171130526 20:22648639-22648661 CCTTTTCAAAAAATGGTGCTGGG + Intergenic
1172090899 20:32431757-32431779 CCCTTTGAGAAGAGCGAGCTTGG - Intronic
1172313551 20:33936084-33936106 CCCTTTCCAAATATTGAACTTGG - Intergenic
1172469821 20:35184313-35184335 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1173060342 20:39654355-39654377 CACTTTCAAGAGCTAGAGCTGGG + Intergenic
1173196903 20:40922236-40922258 CCTTTTCCAAAAATGGTGCTGGG + Intergenic
1173716746 20:45214537-45214559 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1173901147 20:46589757-46589779 GCCTTTCAACAAATGGTGCTAGG + Intronic
1174411072 20:50336179-50336201 CCTTTTCAACAGATCGTGCTGGG + Intergenic
1174523379 20:51151962-51151984 TCCTTTCAACAGATATAGCTGGG + Intergenic
1174553270 20:51376469-51376491 CCCTCTGTAAAGATGGAGCTGGG - Intergenic
1174600691 20:51722099-51722121 CCTTTTCAACAAATGGTGCTGGG + Intronic
1175616823 20:60406947-60406969 CCCTCTCAAAAAAAAGAGCTAGG + Intergenic
1176402434 21:6325681-6325703 CCTATTCAAAAAATGGTGCTAGG - Intergenic
1176434723 21:6663423-6663445 CCTATTCAAAAAATGGTGCTAGG + Intergenic
1176458985 21:6990493-6990515 CCTATTCAAAAAATGGTGCTAGG + Intergenic
1176714371 21:10337395-10337417 TCCTCTCAATAGATGGTGCTGGG + Intergenic
1176906481 21:14507965-14507987 CCTTTTCAACAAATGGTGCTAGG + Intronic
1177346095 21:19873417-19873439 CCTTTTTAACAGATGGTGCTGGG + Intergenic
1177463801 21:21447308-21447330 CCTTTTCAATAAATGGTGCTGGG + Intronic
1178054876 21:28787121-28787143 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1179475112 21:41638094-41638116 CCTTTGGAAAAGATGAAGCTGGG + Intergenic
1179806493 21:43841401-43841423 TCTTTTCAACAGATGGTGCTGGG - Intergenic
1179946316 21:44679795-44679817 CCCCTTCAATAAATGGTGCTGGG + Intronic
1179976162 21:44868340-44868362 CCCTTTCAGCAGACAGAGCTAGG - Intronic
1180580685 22:16833420-16833442 GCCTTTCAACAAATGGTGCTAGG - Intergenic
1183538141 22:38415050-38415072 CCCTTATAAAAGAGGGGGCTGGG - Intergenic
949229901 3:1738431-1738453 CCCGTTCAATAAATGGTGCTGGG - Intergenic
949727400 3:7065422-7065444 CCTTTTCAACAAATGGTGCTGGG - Intronic
949814667 3:8045457-8045479 CCTTTTCAACAAATGGTGCTGGG + Intergenic
950537917 3:13591909-13591931 CCTTTTCAACACATGGTGCTGGG - Intronic
950598431 3:14007762-14007784 CCCATTCAATAAATGGTGCTGGG - Intronic
950841413 3:15971740-15971762 CCCATTCAACAAATGGTGCTGGG + Intergenic
951068766 3:18300485-18300507 CCTTTTCAATAAATGGTGCTGGG + Intronic
951353639 3:21637333-21637355 CCTTTTCAACAAATGGTGCTGGG - Intronic
951444062 3:22756394-22756416 CCTTTTCAACACATGGTGCTGGG + Intergenic
951445018 3:22769087-22769109 CCGTTTGAAAAGATGCAGATGGG - Intergenic
951572033 3:24074308-24074330 CCTTTTCAACAAATGGTGCTGGG - Intergenic
951694642 3:25433585-25433607 CCTCTTAAAAAGTTGGAGCTGGG + Intronic
951763837 3:26174696-26174718 CCTTTTCAACAAATGGTGCTAGG - Intergenic
951852398 3:27156046-27156068 CCTTTTCAACAAATGGTGCTGGG + Intronic
952010228 3:28892284-28892306 CAGTTTCAAAAGCTGGAGTTTGG - Intergenic
952097018 3:29965959-29965981 CCTTTTCAACAAATGGTGCTGGG - Intronic
952205695 3:31180212-31180234 CCTTTTCAATAAGTGGAGCTGGG - Intergenic
952233751 3:31457825-31457847 CCTTTTCAATAAATGGTGCTAGG + Intergenic
952946148 3:38478970-38478992 CCCTTACAAATGCTGAAGCTGGG + Intronic
953004166 3:38962099-38962121 CCTTTTCAACAAATGGTGCTGGG - Intergenic
953188458 3:40660803-40660825 GCCTTTAAAAGGATGGACCTGGG - Intergenic
953255270 3:41284503-41284525 CCCTTTCAACAAATGGTGCTGGG + Intronic
953582236 3:44167589-44167611 CCCTTCCCAAGGGTGGAGCTGGG - Intergenic
955283995 3:57621239-57621261 ACCTTTCAACAAATGGTGCTGGG + Intergenic
955425313 3:58783188-58783210 CCCCTTCAATAAATGGTGCTGGG + Intronic
955477143 3:59349042-59349064 CCTTTTCAACAAATGGTGCTGGG - Intergenic
955859700 3:63314966-63314988 CCTTTTCAACAAATGGTGCTGGG - Intronic
955968804 3:64416115-64416137 CCCTATCAATAGATGGTGTTAGG + Intronic
956111439 3:65873733-65873755 CCTTTTCAACAAATGGTGCTGGG + Intronic
956330244 3:68098914-68098936 CCTATTCAATAGATGGTGCTGGG + Intronic
956610109 3:71113859-71113881 ACCTTTCCAAAGATGGCACTAGG + Intronic
957015831 3:75064050-75064072 CCTTTTCAACAAATGGTGCTGGG - Intergenic
957366483 3:79230978-79231000 CCTTTTCAATAAATGGTGCTGGG + Intronic
957428031 3:80065075-80065097 CCTTTTCAACAAATGGTGCTGGG + Intergenic
957483074 3:80823491-80823513 CCCTTTAAAACGATGCAGGTAGG + Intergenic
957580163 3:82061699-82061721 CCCATTCAATAAATGGTGCTGGG - Intergenic
957716867 3:83939164-83939186 CCCTTCCAAAAGAAAGAGCTAGG - Intergenic
958002913 3:87773816-87773838 CGTTTTCAAAAAATGGTGCTGGG - Intergenic
958014200 3:87919132-87919154 CCTTTTCAAAAAATGATGCTGGG + Intergenic
958114114 3:89192044-89192066 TCCTTTCAAAAGATGAAGACAGG - Intronic
958144818 3:89611215-89611237 TCTTTTCAAAAAATGGTGCTGGG - Intergenic
958480393 3:94638778-94638800 CCTTTTCAACAAATGGTGCTGGG - Intergenic
959131897 3:102366484-102366506 CCTTTTCAACAAATGGTGCTGGG - Intronic
959274921 3:104266511-104266533 CCTTTTCAACAAATGGTGCTGGG - Intergenic
959325264 3:104928996-104929018 CCTTTTCAACAAATGGTGCTGGG - Intergenic
959436571 3:106322145-106322167 CCTTTTCAACAAATGGTGCTGGG + Intergenic
959899514 3:111644228-111644250 CCTTTTCAATAAATGGTGCTGGG + Intronic
960077824 3:113508041-113508063 TCTTTTCAACAGATGGTGCTGGG + Intronic
960524837 3:118697799-118697821 CCTTTTCAACAAATGGTGCTGGG + Intergenic
960757741 3:121035442-121035464 CCTTTTCAATAAATGGTGCTGGG - Intronic
961264319 3:125628609-125628631 CCTTTTCAACAAATGGTGCTGGG - Intergenic
961468372 3:127095811-127095833 CCCTTTCAACAAATGGTGCTGGG - Intergenic
961915296 3:130368108-130368130 CCTTTTGAAAAGATGGAACCAGG + Intronic
962287915 3:134103845-134103867 CACTTTGAAAAGATGGAGCTGGG - Intronic
963113328 3:141704550-141704572 CCTTTTCAACAAATGGTGCTGGG + Intergenic
963699702 3:148609177-148609199 CCTTTTCAACAAATGGTGCTGGG - Intergenic
964127083 3:153245359-153245381 CCTTTTCAATAAATGGTGCTGGG + Intergenic
964137421 3:153360322-153360344 TCCTCTGAAAATATGGAGCTTGG + Intergenic
964166302 3:153709933-153709955 CCTTTTCAACAAATGGTGCTGGG + Intergenic
964430102 3:156596564-156596586 CCTTTTCAACAAATGGTGCTGGG + Intergenic
964537791 3:157743825-157743847 CCTTTTCAAAAAATGGTGCTGGG - Intergenic
964725611 3:159811516-159811538 TCTTTTCAACAGATGGTGCTGGG - Intronic
965052345 3:163667010-163667032 CCTTTTCAACAAATGGTGCTGGG - Intergenic
965200678 3:165654113-165654135 CCTTTTCAACAAATGGTGCTGGG - Intergenic
965377810 3:167947941-167947963 CCTTTTCAATAAATGGTGCTGGG + Intergenic
965982145 3:174706212-174706234 CTTTTTCAAAAAATGGTGCTGGG + Intronic
965989297 3:174797189-174797211 TCTTTTCAATAGATGGTGCTGGG - Intronic
966117298 3:176480727-176480749 CCTTTTCAACAAATGGTGCTGGG - Intergenic
966164430 3:177001242-177001264 CCTTTTCAACAAATGGTGCTGGG - Intergenic
966344114 3:178959500-178959522 CCTTTTCAACAAATGGTGCTGGG - Intergenic
966356455 3:179084935-179084957 CCCATTCAATAAATGGTGCTGGG + Intergenic
966379541 3:179330264-179330286 CCCCTTCAAAAAATGGACTTAGG - Intronic
966644086 3:182223714-182223736 CCTATTCAATAGATGGTGCTAGG - Intergenic
967363010 3:188653227-188653249 CCCTTTCAGTAGATGATGCTTGG - Intronic
968540148 4:1164181-1164203 CCCTTTCATAAGATGCAGGGAGG - Intergenic
969546489 4:7832911-7832933 CCTTTTCAACAAATGGTGCTGGG + Intronic
970019536 4:11551874-11551896 ACTTTTCAATAGATGGTGCTAGG - Intergenic
970217058 4:13770449-13770471 CCTTTTCAACAAATGGTGCTGGG - Intergenic
970284044 4:14489472-14489494 CCTATTCAAAAAATGGTGCTGGG + Intergenic
970633695 4:17982997-17983019 CCTTTTCAATAAATGGTGCTGGG - Intronic
970658237 4:18255783-18255805 CCTTTTCAACAAATGGTGCTGGG - Intergenic
970684213 4:18547512-18547534 TCTTTTCAATAGATGGTGCTGGG - Intergenic
970874464 4:20853400-20853422 CCTTTTCAACAAATGGTGCTGGG + Intronic
970875702 4:20867433-20867455 CCTATTCAATAAATGGAGCTGGG + Intronic
971182714 4:24344986-24345008 CCTTTTCAACAAATGGTGCTGGG - Intergenic
971276297 4:25200666-25200688 CCTTTTCAACAAATGGTGCTGGG + Intronic
971565164 4:28129904-28129926 CCTTTTCAACAAATGGTGCTGGG + Intergenic
972269614 4:37498142-37498164 CCCTTTCAACAAATGGTGCTTGG - Intronic
972465162 4:39348716-39348738 CCTCTTCAAAAGATGGAGCTTGG + Intronic
973080573 4:45987151-45987173 GCCTTTCAGAGGATGGAGGTTGG + Intergenic
973179187 4:47247251-47247273 CCTTTTCAACAAATGGTGCTGGG - Intronic
973244128 4:47991899-47991921 CCTTTTCAACAAATGGTGCTTGG - Intronic
973708996 4:53607875-53607897 CCTATTCAAAAAATGGTGCTGGG + Intronic
973782847 4:54305581-54305603 CCTTTTCAATAAATGGTGCTGGG + Intergenic
973787445 4:54346370-54346392 CCTTTTCAACAAATGGTGCTGGG + Intergenic
973792195 4:54388658-54388680 CCTTTTCAACAAATGGTGCTGGG - Intergenic
974032964 4:56792713-56792735 CCTTTTCAATAAATGGTGCTGGG - Intergenic
974327773 4:60437293-60437315 CCTTTTCAACAAATGGTGCTGGG + Intergenic
974458097 4:62154445-62154467 CCTTTTCAACAAATGGTGCTGGG + Intergenic
974704969 4:65502010-65502032 CCCATTCAATAAATGGTGCTGGG + Intronic
974826083 4:67132702-67132724 CCTGTTCAAAAAATGGTGCTGGG + Intergenic
974861197 4:67523685-67523707 CCCTTTCAACTGATAGAGCTGGG - Intronic
974918510 4:68207031-68207053 TCTTTTCAAAAAATGGTGCTGGG + Intergenic
975279017 4:72538922-72538944 TCTTTTCAACAAATGGAGCTTGG + Intronic
976071999 4:81252192-81252214 CCTTTTCAATAAATGGTGCTGGG - Intergenic
976390526 4:84499908-84499930 TCCCTTCAAAAGAAGGAGCCAGG - Intergenic
976433655 4:84992152-84992174 CCCTTTTAATAAATGGTGCTGGG + Intergenic
976455188 4:85238374-85238396 CCCTTTCAACAAATGATGCTGGG - Intergenic
976520795 4:86023173-86023195 CCTTTTCAATATATGGTGCTGGG - Intronic
976644988 4:87377991-87378013 GGCTATTAAAAGATGGAGCTGGG + Intronic
976780721 4:88755817-88755839 CCATTTCAAAAAATGGAGATGGG - Intronic
976804695 4:89033838-89033860 CCCATTCAATAAATGGTGCTGGG + Intronic
977212029 4:94229713-94229735 CCCTTTCAGCAGAAGGACCTAGG + Intronic
977422329 4:96817662-96817684 TCCTATCAAAAGATGTAGATGGG + Intergenic
977481081 4:97576508-97576530 CCTTTTCAATACATGGTGCTAGG + Intronic
977590320 4:98818872-98818894 TCTTTTCAATAGATGGTGCTGGG + Intergenic
977825939 4:101531683-101531705 CCTTTTCAACAAATGGTGCTGGG - Intronic
977906982 4:102488348-102488370 CCTTTTCAACAGATGGTCCTGGG + Intergenic
978027425 4:103895351-103895373 CCTATTCAATAGATGGTGCTGGG + Intergenic
978726221 4:111972831-111972853 CCTTTTCAACAAATGGTGCTGGG - Intergenic
978999043 4:115194984-115195006 CCTTTTCAACAAATGGTGCTGGG - Intergenic
979301214 4:119089611-119089633 CCCATTCAATAAATGGTGCTGGG - Intergenic
979498002 4:121406591-121406613 CCTTTTCAACAAATGGTGCTGGG - Intergenic
979590073 4:122468435-122468457 TCTTTTCAACAGATGGTGCTTGG + Intergenic
979666946 4:123322410-123322432 CCTTTTCAATAAATGGTGCTGGG + Intergenic
979705903 4:123720285-123720307 CCTTTTCAACAAATGGTGCTGGG + Intergenic
979709750 4:123765332-123765354 CCTTTTCAACAAATGGTGCTGGG - Intergenic
979743033 4:124175236-124175258 CCTCTTCAAAAGCTGAAGCTAGG - Intergenic
979794534 4:124830314-124830336 CCTTTTCAACAAATGGTGCTGGG - Intergenic
979995832 4:127429735-127429757 CCTTTTCAACAAATGGTGCTGGG + Intergenic
980863440 4:138526412-138526434 CCTATTCAAAAAATGGTGCTGGG + Intergenic
981347102 4:143688784-143688806 CCTTTTCAACAAATGGTGCTGGG + Intronic
981351543 4:143735537-143735559 CCCATTCAACAAATGGTGCTGGG - Intergenic
981402285 4:144327374-144327396 CCTATTCAATAAATGGAGCTGGG + Intergenic
981522478 4:145677819-145677841 CCCATTCAACAAATGGTGCTGGG - Intergenic
981559808 4:146034646-146034668 CCTTTTCAAAAAATGGTGCTGGG + Intergenic
981626387 4:146760695-146760717 CCTTTTCAACAAATGGTGCTGGG + Intronic
981825241 4:148933073-148933095 CCTTTTCAACAAATGGTGCTGGG + Intergenic
981887037 4:149688860-149688882 CCTTTTCAACAAATGGTGCTGGG + Intergenic
982119201 4:152124571-152124593 CCTTTTCAACAAATGGTGCTGGG - Intergenic
982189353 4:152838009-152838031 CCTTTTCAACAAATGGTGCTGGG - Intronic
982631041 4:157829456-157829478 CCTTTTCAACAAATGGTGCTGGG + Intergenic
982640758 4:157956953-157956975 CCTATTCAACAGATGGTGCTGGG + Intergenic
982679706 4:158414375-158414397 CCTTTTCAACAAATGGTGCTGGG - Intronic
983010784 4:162544250-162544272 CCTGTTCAAAACATGGTGCTGGG - Intergenic
983175303 4:164581213-164581235 CCTTTTCAACAAATGGTGCTGGG - Intergenic
983504969 4:168543139-168543161 AGCTTGCAAATGATGGAGCTAGG - Intronic
983544477 4:168948598-168948620 CCTTTTCAACAAATGGTGCTGGG - Intronic
983610683 4:169641653-169641675 ACGTTTCAAAAGAAGAAGCTTGG + Intronic
984021509 4:174489241-174489263 CACTTTGAAAACATGGATCTAGG + Intergenic
984527144 4:180871039-180871061 CCTTTTCAACAAATGGTGCTGGG - Intergenic
984722128 4:182983128-182983150 CCTTTTCAATAAATGGTGCTGGG + Intergenic
985305052 4:188530311-188530333 CCTTTTCAATAAATGGTGCTGGG + Intergenic
985514979 5:337749-337771 CCCTTCCCAAAGCTGGGGCTCGG + Intronic
985581655 5:699377-699399 CCTTTTCAATAAATGGTGCTGGG + Intergenic
985596278 5:790692-790714 CCTTTTCAATAAATGGTGCTGGG + Intergenic
986267193 5:6200986-6201008 CCCTTGCCAAAGATGGGACTGGG + Intergenic
986267708 5:6204614-6204636 CCCTTGCCAAAGATGGGACTGGG + Intergenic
986356232 5:6929852-6929874 CCCATTCAATAAATGGTGCTGGG - Intergenic
986475521 5:8126960-8126982 CCCATTCAACAAATGGTGCTGGG - Intergenic
986998134 5:13630676-13630698 CCCATTCAACAAATGGTGCTGGG + Intergenic
987006211 5:13712228-13712250 CCTTTTCAAAAAATGGTGATGGG + Intronic
987185533 5:15413862-15413884 CCTTTTCAACAGATAGTGCTGGG + Intergenic
987527785 5:19075873-19075895 CCTATTCAAAAAATGGTGCTGGG + Intergenic
987890437 5:23869407-23869429 CCCGTTCAATAAATGGTGCTGGG - Intergenic
988186846 5:27875118-27875140 CACTTACAATAAATGGAGCTTGG - Intergenic
988607892 5:32696230-32696252 CCTTTTCAATAAATGGTGCTGGG - Intronic
988652054 5:33163397-33163419 CCTTTTCAACAAATGGTGCTAGG - Intergenic
989028873 5:37096313-37096335 CCTTTTCAACAAATGGTGCTGGG + Intergenic
989127025 5:38064969-38064991 CCTATTCAAAAAATGGTGCTGGG - Intergenic
989390203 5:40892418-40892440 TCTTTTCAACAGATGGTGCTGGG + Intergenic
989533397 5:42535390-42535412 CCTTTTCAACAAATGGTGCTTGG - Intronic
989656962 5:43754947-43754969 CCCATTCAACAAATGGTGCTGGG - Intergenic
990186005 5:53210048-53210070 CCTTTTCAAAAGAGAAAGCTTGG + Intergenic
990275311 5:54189552-54189574 TCTTTTCAACAGATGGTGCTAGG + Intronic
990317730 5:54599744-54599766 CCTATTCAAAAAATGGTGCTAGG + Intergenic
990360255 5:55011930-55011952 CCTTTTCAATAAATGGTGCTGGG + Intronic
990673058 5:58154075-58154097 CCTTTTCAACAAATGGTGCTGGG + Intergenic
990903210 5:60775737-60775759 CCTATTCAATAGATGGTGCTAGG + Intronic
990969432 5:61487124-61487146 CCTTTTCAATAAATGGTGCTGGG - Intronic
991418872 5:66420213-66420235 CCCATTCAACAAATGGTGCTGGG - Intergenic
991579833 5:68143191-68143213 CCCATTCAATAAATGGTGCTAGG + Intergenic
992082884 5:73251821-73251843 CCCTTTCACAGGAAGGAGCTTGG + Intergenic
992257851 5:74939500-74939522 CCTTTTCAAAAAATGGTGTTGGG + Intergenic
992535708 5:77700830-77700852 CCTTTTCAACAAATGGGGCTGGG + Intronic
992714571 5:79497352-79497374 CCCTTATAAAAAATAGAGCTGGG + Intronic
992734846 5:79708642-79708664 ACATTTTAAAAAATGGAGCTGGG + Intronic
992892680 5:81218430-81218452 CCTTTTCAACAAATGGTGCTCGG - Intronic
993216062 5:85023642-85023664 CCTATTCAAAAAATGGTGCTTGG - Intergenic
993826043 5:92688160-92688182 CCCTATCGAAGGACGGAGCTTGG - Intergenic
993917456 5:93760660-93760682 CCTTTTCAACAAATGGTGCTGGG + Intronic
993965209 5:94351834-94351856 CCTTTTCAATAAATGGTGCTGGG + Intronic
994555325 5:101292358-101292380 CCTATTCAACAGATGGTGCTGGG + Intergenic
994860334 5:105184765-105184787 CCCTATGTAAAGATGGTGCTGGG - Intergenic
994875699 5:105418287-105418309 CCTTTTCAACAAATGGTGCTGGG + Intergenic
994883334 5:105526667-105526689 CCTTTTCAACAAATGGTGCTGGG - Intergenic
995102057 5:108323844-108323866 CCTTTTCAACAAATGGTGCTGGG + Intronic
995134608 5:108667358-108667380 CCTTTTCAACAAATGGTGCTGGG - Intergenic
995293351 5:110486549-110486571 CCTTTTCAACAAATGGTGCTGGG - Intronic
995472608 5:112518861-112518883 CCTTTTCAACAAATGGTGCTGGG - Intergenic
995666848 5:114552364-114552386 CCCATTCAATAAATGGTGCTGGG + Intergenic
995693400 5:114852850-114852872 CCTTTTCAATAAATGGTGCTGGG - Intergenic
995723033 5:115156575-115156597 CCTTTTCAAGAAATGGTGCTGGG + Intronic
996025714 5:118643421-118643443 CCTTTTCAACAAATGGTGCTGGG + Intergenic
996224811 5:120978999-120979021 TCCCTTCAAATGATGGTGCTGGG - Intergenic
996456259 5:123686281-123686303 CCTATTCAAAAAATGGTGCTGGG + Intergenic
996697227 5:126411335-126411357 CCTTTTCAATAAATGGTGCTGGG - Intronic
997097876 5:130933960-130933982 CCTATTCAAAAAATGGTGCTGGG + Intergenic
997636025 5:135407080-135407102 CCCTTTCAGCAGACAGAGCTAGG - Intergenic
997761256 5:136450245-136450267 CCCTTTCAACAAATGATGCTGGG + Intergenic
997797951 5:136829727-136829749 CCTTTTCAACAAATGGTGCTGGG - Intergenic
998758849 5:145410069-145410091 CCTATTCAAAAAATGGTGCTGGG + Intergenic
998776926 5:145614051-145614073 CCTTTTCAACAAATGGTGCTGGG - Intronic
998941273 5:147285211-147285233 CCTTTTCAACAAATGGTGCTGGG + Intronic
999343402 5:150793580-150793602 CCTTTTCAACAAATGGTGCTGGG + Intronic
999484290 5:151979385-151979407 CCTTTTCAACAAATGGTGCTGGG - Intergenic
999526199 5:152408840-152408862 CCTTTTCAACAAATGGTGCTGGG - Intronic
999707785 5:154289798-154289820 CTCTTTCAAAAGGTGGTTCTTGG - Intronic
1000024929 5:157350355-157350377 CCTTTTCAACAAATGGTGCTGGG - Intronic
1000713337 5:164607780-164607802 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1000757421 5:165179047-165179069 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1001790327 5:174451410-174451432 TCTTTTCAAAAAATGGTGCTGGG + Intergenic
1001830334 5:174781550-174781572 TCTTTTCAAAAGATGGTGCTGGG - Intergenic
1002554585 5:180025752-180025774 ACCTCAGAAAAGATGGAGCTTGG - Intronic
1002965628 6:1963613-1963635 CCTTTTCAACAAATGGTGCTGGG - Intronic
1003029020 6:2584781-2584803 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1003063576 6:2882402-2882424 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1003428237 6:6012846-6012868 CCCTCTCAGAAGATAGAGGTAGG + Intergenic
1003582425 6:7352803-7352825 CCTTTTCAACAAATGGTGCTGGG + Intronic
1003929907 6:10914255-10914277 CCTTTTCAACAAATGGTGCTGGG - Intronic
1004504231 6:16234730-16234752 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1004574210 6:16877944-16877966 CCTTTTCAATAAATGGTGCTGGG - Intergenic
1004872228 6:19918149-19918171 CCTGTTCAAAAAATGGTGCTGGG + Intergenic
1005323219 6:24675957-24675979 CCCTTTTAATAAATGGTGCTGGG - Intronic
1005880299 6:30052850-30052872 CCTTTTCAATAAATGGTGCTGGG - Intergenic
1006287803 6:33111180-33111202 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1006722480 6:36166027-36166049 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1007850359 6:44796936-44796958 CCTTTTCAATGGATAGAGCTAGG + Intergenic
1008121295 6:47620293-47620315 CCCTTTCAACAAATGGTGCTGGG - Intronic
1008147207 6:47906439-47906461 CGCATTCAAGAGATGGAGCCTGG + Intronic
1008226259 6:48920427-48920449 CCGTTTCAAAAGAGGGAAATTGG - Intergenic
1008313172 6:50003840-50003862 CCTTTTCAACAAATGGTGCTAGG + Intergenic
1008449125 6:51628972-51628994 CCTTTTCAATAAATGGTGCTGGG + Intronic
1008640346 6:53456017-53456039 CCCCTTCAAAAGATGCGGGTTGG + Intergenic
1008876207 6:56331510-56331532 CCTTTTCAATAAATGGTGCTGGG - Intronic
1008941006 6:57045962-57045984 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1009316445 6:62226756-62226778 CCTATTCAATAGATGGTGCTGGG - Intronic
1010008593 6:71024442-71024464 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1010023199 6:71185422-71185444 CCTTTTCAATAAATGGTGCTGGG + Intergenic
1010181399 6:73090643-73090665 CCTTTTCAACAAATGGTGCTGGG - Intronic
1010498395 6:76564691-76564713 CCTTTTCAATAAATGGTGCTGGG - Intergenic
1010576615 6:77539745-77539767 CCCATTCAATAAATGGTGCTGGG + Intergenic
1011093100 6:83629096-83629118 CCTTTTCAATAAATGGTGCTGGG - Intronic
1011324812 6:86138648-86138670 CCTTTTCAATAAATGGTGCTGGG + Intergenic
1011582468 6:88885146-88885168 CCCTCTCAGAAGATAGAGCTAGG - Intronic
1011892912 6:92189633-92189655 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1012148182 6:95712404-95712426 TCTTTTCAAAAAATGGTGCTGGG + Intergenic
1012332178 6:98006158-98006180 TCTTTTCAACAAATGGAGCTGGG - Intergenic
1012382913 6:98641494-98641516 CCTTTTCAAAAGATAGAAATGGG - Intergenic
1012923149 6:105240488-105240510 CCTTTTCAACAGATGGTGCTGGG + Intergenic
1013852249 6:114530241-114530263 CCCTTTCAACAAATGCTGCTGGG - Intergenic
1014060952 6:117071263-117071285 CCTATTCAAAAAATGGTGCTGGG - Intergenic
1014081921 6:117297130-117297152 CCCTTTCAATAAATGGTGCTGGG + Intronic
1014337238 6:120151924-120151946 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1014419943 6:121231183-121231205 CCTATTCAAAAAATGGTGCTGGG - Intronic
1014604294 6:123453010-123453032 CCTTTTCAACAAATGGTGCTGGG + Intronic
1014852324 6:126357166-126357188 CCCATTCAATAAATGGTGCTGGG - Intergenic
1014860155 6:126456462-126456484 CCTTTTCAATAAATGGTGCTAGG + Intergenic
1015375575 6:132506002-132506024 CCTTTTCAATACATGGTGCTGGG + Intronic
1015654419 6:135500510-135500532 CCCTTTCAGCAGATAGAGCTAGG - Intergenic
1015658158 6:135543243-135543265 CCTTTTCAATAAATGGTGCTGGG + Intergenic
1015662852 6:135595612-135595634 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1015889403 6:137954757-137954779 CCCTTCCAGATGATGGGGCTTGG - Intergenic
1015914347 6:138200583-138200605 CCTTTTCAACAAATGGTGCTGGG + Intronic
1016275848 6:142351462-142351484 CCCATTCAATAAATGGTGCTGGG + Intronic
1017220591 6:151961498-151961520 CTCTTTCAAAGGAGGGAGATGGG + Intronic
1017374523 6:153752803-153752825 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1017944777 6:159086672-159086694 CCTTTTCAATAAATGGTGCTGGG + Intergenic
1018010056 6:159661341-159661363 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1018407601 6:163504111-163504133 CCCATTCAATAAATGGTGCTGGG - Intronic
1018562149 6:165111618-165111640 CCTCTTCAAAAAATGGTGCTGGG - Intergenic
1018577913 6:165278701-165278723 ACCTTGTAAACGATGGAGCTGGG - Intergenic
1019544893 7:1569470-1569492 CCCATTCAAAAGAAGGGGCCAGG + Exonic
1020214020 7:6175367-6175389 CCTTTTCAACAAATGGTGCTGGG - Intronic
1020540333 7:9454629-9454651 CCCTGTCAATAAATGGTGCTGGG - Intergenic
1020726647 7:11823185-11823207 TCCTTTCAATAAATGGTGCTGGG - Intronic
1021135395 7:16959131-16959153 CCTTTTCAATACATGGAGCTAGG - Intergenic
1021183699 7:17537953-17537975 CCTTTTCAACACATGGTGCTGGG + Intergenic
1021204697 7:17766284-17766306 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1021812246 7:24414470-24414492 CCCTTTCAAAGGAGGGAACCAGG - Intergenic
1022013968 7:26332803-26332825 TCCTTTCAACAAATGGTGCTGGG - Intronic
1022295759 7:29051010-29051032 CCTTTTCAACAAATGGTGCTGGG + Intronic
1022550139 7:31230468-31230490 CCCTTTCAACAAATGGTGCTGGG - Intergenic
1022759472 7:33332209-33332231 CCTATTCAATAAATGGAGCTGGG + Intronic
1022960125 7:35418573-35418595 CCCTTTTAAAAGATGGATAATGG - Intergenic
1023241705 7:38155173-38155195 CCTATTCAATAAATGGAGCTGGG + Intergenic
1023284094 7:38601435-38601457 CCCCTTCACAAAATGGAACTTGG - Intronic
1023748519 7:43346724-43346746 CCTTTTCAACAAATGGTGCTGGG - Intronic
1024126826 7:46307129-46307151 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1024179276 7:46873496-46873518 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1024668890 7:51573040-51573062 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1024681247 7:51691263-51691285 CCCATTCAATAAATGGTGCTGGG - Intergenic
1024725630 7:52190477-52190499 CCCTTTCAATAGGTGGTACTGGG + Intergenic
1024744953 7:52395405-52395427 CCTTTTCAATAAATGGTGCTGGG - Intergenic
1024753149 7:52493721-52493743 CCTTTTCAATAAATGGTGCTGGG - Intergenic
1024895936 7:54262245-54262267 CTTTTTCAATAAATGGAGCTGGG - Intergenic
1026627082 7:72004291-72004313 CCCTTTCAACAAATGATGCTGGG + Intronic
1027267532 7:76502559-76502581 CCTCTGCAAAAGATGGTGCTGGG + Intronic
1027295828 7:76768968-76768990 CCTTTTCAATAAATGGTGCTGGG + Intergenic
1027319347 7:77002424-77002446 CCTCTGCAAAAGATGGTGCTGGG + Intergenic
1027349954 7:77301418-77301440 CCTTTTCAACAAATGGTGCTGGG - Intronic
1027650575 7:80862851-80862873 CCTTTTCAACAAATGGTGCTGGG + Intronic
1027693273 7:81374898-81374920 CCCATTCAACATATGGTGCTGGG - Intergenic
1028049329 7:86162284-86162306 CCTTTTCAATAAATGGTGCTGGG + Intergenic
1028283440 7:88963425-88963447 TACTTTCAACAGATGGTGCTAGG + Intronic
1028499303 7:91500825-91500847 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1028506423 7:91575890-91575912 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1028516004 7:91679012-91679034 CCCCTGCAAAAAAAGGAGCTGGG - Intergenic
1028532830 7:91857221-91857243 CCCGTTCAATAAATGGTGCTGGG + Intronic
1028703243 7:93808154-93808176 CCTTTTCAACAAATGGAACTGGG + Intronic
1030153487 7:106428509-106428531 CCCTTTGAAAGGAGAGAGCTAGG - Intergenic
1030440829 7:109587146-109587168 CCTATTCAATAGATGGTGCTAGG + Intergenic
1030691070 7:112534339-112534361 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1030815777 7:114035183-114035205 CCCTCACAAATGCTGGAGCTGGG + Intronic
1031234752 7:119160420-119160442 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1031459051 7:122022977-122022999 TCCTTCCAACAGATGGTGCTAGG + Intronic
1031623846 7:123969520-123969542 CCTTTTCAATAAATGGTGCTGGG - Intronic
1031760706 7:125710070-125710092 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1031969295 7:128052489-128052511 CCCTTTCAGCAGATGCTGCTAGG - Intronic
1033057766 7:138075301-138075323 CCATTTCCAAATTTGGAGCTGGG - Intronic
1033354796 7:140590994-140591016 CCCTTTAAAAAAATGAAGATGGG + Intronic
1033623720 7:143087678-143087700 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1033721761 7:144067244-144067266 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1033819056 7:145111344-145111366 CCTATTCAAAAAATGGTGCTGGG - Intergenic
1034058545 7:148063962-148063984 CCTTTTCAACAAATGGTGCTGGG - Intronic
1034229740 7:149513210-149513232 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1035481121 7:159185991-159186013 CCCATTCAATAAATGGTGCTGGG - Intergenic
1035745800 8:1961483-1961505 CCCGTTTGAAAAATGGAGCTTGG + Intergenic
1035980668 8:4367291-4367313 CCTATTTAAAAAATGGAGCTGGG - Intronic
1036207034 8:6813212-6813234 CCCTTTCCAAGGTTGGAGCCTGG - Intronic
1036617627 8:10400767-10400789 ACTTTTCAACAGATGGTGCTGGG + Intronic
1036743221 8:11385205-11385227 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1037045066 8:14289720-14289742 CCCCTTCAATAAATGGTGCTAGG + Intronic
1037135955 8:15460761-15460783 CCTTTTCAACAAATGGTGCTGGG - Intronic
1037191507 8:16131714-16131736 CCTTTTCAATAAATGGTGCTGGG - Intronic
1037358505 8:18048275-18048297 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1038237469 8:25773942-25773964 CCGTTTCAACAAATGGTGCTGGG + Intergenic
1038366839 8:26944867-26944889 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1038591509 8:28842633-28842655 ACGTTTCAAGATATGGAGCTTGG - Intronic
1039128851 8:34237157-34237179 CACATTCAAAAGATGGTGCTGGG - Intergenic
1039204128 8:35130790-35130812 CTTTTTCAAAAAATGGAGCTGGG - Intergenic
1039710063 8:40046883-40046905 CCTTTTCAATAAATGGTGCTGGG + Intergenic
1039735253 8:40324692-40324714 TCCTTCCAAATTATGGAGCTTGG + Intergenic
1040635272 8:49266051-49266073 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1040653086 8:49472224-49472246 CCTATTCAAGAGATGGTGCTGGG - Intergenic
1040670721 8:49686940-49686962 CCCTTTCTACAAATGGTGCTGGG - Intergenic
1040933324 8:52757666-52757688 GCTTTTCAATAAATGGAGCTGGG + Intergenic
1040966874 8:53091330-53091352 CCTATTCAACAAATGGAGCTGGG - Intergenic
1041112354 8:54495782-54495804 CCCATTCAACAAATGGTGCTGGG - Intergenic
1041228163 8:55721260-55721282 CCTTTTCAACAAATGGTGCTGGG + Intronic
1041589893 8:59565955-59565977 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1041638181 8:60167162-60167184 CCCTTTTCAAAAATGGTGCTGGG + Intergenic
1041877561 8:62707957-62707979 CCTTTTCAACAAATGGTGCTCGG - Intronic
1042115316 8:65425405-65425427 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1042631034 8:70816253-70816275 CCTTTTCAATAAATGGTGCTGGG + Intergenic
1042662273 8:71167977-71167999 CCTATTCAAAAAATGGTGCTGGG - Intergenic
1043209423 8:77492181-77492203 CCCATTCAAAACAAGAAGCTAGG + Intergenic
1043237496 8:77886833-77886855 CCCATTCAACAAATGGTGCTGGG + Intergenic
1043261314 8:78202182-78202204 CCCTTTCAACAAATGGTGCTGGG + Intergenic
1043568426 8:81573181-81573203 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1043988277 8:86719905-86719927 CCTTTTCAACAAATGGTGCTGGG + Intronic
1044315399 8:90744814-90744836 CCCTATTAATAAATGGAGCTGGG - Intronic
1045091708 8:98752361-98752383 CCCATTCAATAAATGGTGCTGGG + Intronic
1045207814 8:100061074-100061096 CCTATTCAATAAATGGAGCTAGG + Intronic
1046075797 8:109310378-109310400 CCTTTTCAACAAATGGTGCTGGG + Intronic
1046225524 8:111273905-111273927 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1046417425 8:113936092-113936114 CCGTTTCAACAAATGGTGCTGGG + Intergenic
1046760950 8:118019857-118019879 GCCTTTCAATAAATGGTGCTTGG + Intronic
1047032762 8:120900852-120900874 CCTTTTCAATAAATGGTGCTGGG + Intergenic
1047087875 8:121539401-121539423 TCCTTTCAATAAATGGTGCTGGG - Intergenic
1047467394 8:125130642-125130664 CCCTTTCAGCAGACAGAGCTAGG + Intronic
1047530714 8:125672086-125672108 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1048408589 8:134148695-134148717 CCCTTTCAATAGGTGGAACAGGG - Intergenic
1048588051 8:135793702-135793724 CCCTGCAAAAAAATGGAGCTGGG - Intergenic
1048771029 8:137895513-137895535 CCCTTTCAGAAGTTGCAGATAGG - Intergenic
1049897744 9:125779-125801 CCTTTTCAACAAATGGTGCTGGG - Intronic
1050349902 9:4731269-4731291 GCCTTTCAGAGGATGGAGGTGGG - Intronic
1050635852 9:7611920-7611942 CCTTTTCAACAAATGGTGCTAGG - Intergenic
1051363094 9:16299370-16299392 CCCTTTCAACAAGTGGTGCTGGG + Intergenic
1051472993 9:17470744-17470766 TCCACTGAAAAGATGGAGCTTGG - Intronic
1051688683 9:19685680-19685702 CCTATTCAAAAAATGGTGCTTGG + Intronic
1051700617 9:19819107-19819129 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1051957098 9:22709511-22709533 CACTTTCAACAAATGGTGCTGGG - Intergenic
1052346968 9:27419563-27419585 CCTTTTCAACAAATGGTGCTGGG + Intronic
1052514232 9:29459647-29459669 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1052624203 9:30953787-30953809 TCCTTTCAAATGATGAACCTCGG - Intergenic
1052634723 9:31087441-31087463 CCCATTCAATAAATGGTGCTGGG - Intergenic
1053400932 9:37821540-37821562 CCTTTTCAACAAATGGTGCTAGG + Intronic
1053740833 9:41136069-41136091 CCTTTTCAACAAATGGTGCTGGG - Intronic
1054443821 9:65292214-65292236 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1054486452 9:65729289-65729311 CCTTTTCAACAAATGGTGCTGGG + Intronic
1054687518 9:68295230-68295252 CCTTTTCAACAAATGGTGCTGGG + Intronic
1055141180 9:72878822-72878844 CCTTTTCAACACATGGTGCTGGG + Intergenic
1055281046 9:74675112-74675134 CCATTTCAAAAGATGGAAGTTGG + Intronic
1055345925 9:75338800-75338822 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1055656789 9:78458480-78458502 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1055720467 9:79167581-79167603 GGCTTTTAAATGATGGAGCTGGG + Intergenic
1056322325 9:85447560-85447582 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1056394680 9:86170879-86170901 TCTTTTCAACAAATGGAGCTGGG - Intergenic
1056394785 9:86172016-86172038 TCTTTTCAACAAATGGAGCTGGG - Intergenic
1056651773 9:88471327-88471349 TCTTTTCAAAATATGGTGCTTGG - Intronic
1056671453 9:88631580-88631602 CCCATTCAATAAATGGTGCTGGG - Intergenic
1056698633 9:88882478-88882500 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1056837316 9:89967175-89967197 TCTCTTCAAAAGATGGTGCTGGG - Intergenic
1056910796 9:90698403-90698425 GCCTTTCAAAAGGTGGAGGCTGG + Intergenic
1057756133 9:97837785-97837807 CCTTTTCAATAAATGGTGCTGGG - Intergenic
1057980264 9:99653838-99653860 CCCATTCAATATATGGTGCTGGG + Intergenic
1058084632 9:100735320-100735342 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1058308012 9:103466999-103467021 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1058631119 9:106987895-106987917 CCTTTTCAACAAATGGTGCTGGG - Intronic
1058721059 9:107764549-107764571 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1059062368 9:111046595-111046617 CCTTTTCAATAAATGGTGCTGGG + Intergenic
1059180133 9:112204210-112204232 CCTATTCAATAGATGGTGCTAGG - Intergenic
1059594967 9:115709928-115709950 CCCATTCAACAAATGGTGCTGGG - Intergenic
1059607730 9:115853365-115853387 CCCATTCAATAAATGGTGCTGGG + Intergenic
1059815609 9:117909769-117909791 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1060207979 9:121693720-121693742 CCCTTTCAACAGACTGACCTGGG - Intronic
1062438317 9:136556910-136556932 CCCTTTGAGGAGATGGACCTGGG - Intergenic
1203436813 Un_GL000195v1:145222-145244 CCTATTCAAAAAATGGTGCTAGG - Intergenic
1185877206 X:3711506-3711528 CCCTTGGGAAAGGTGGAGCTGGG - Intronic
1186046969 X:5547133-5547155 CCTATTCAAAAAATGGTGCTAGG - Intergenic
1186788746 X:12976373-12976395 GCCTTTCTAAAGATGGGGGTGGG - Intronic
1187218753 X:17303041-17303063 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1187586871 X:20672823-20672845 CCTTTTCAATAAATGGTGCTGGG - Intergenic
1187632587 X:21191270-21191292 CCTTTTCAATAAATGGTGCTGGG + Intergenic
1187636423 X:21234063-21234085 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1187639207 X:21269303-21269325 CCATTTCAATAAATGGTGCTGGG - Intergenic
1188040057 X:25361469-25361491 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1188363801 X:29289312-29289334 CCTTTTCAACAAATGGTGCTGGG - Intronic
1188376883 X:29442318-29442340 CCTTTTCAACAAATGGTGCTGGG + Intronic
1188697659 X:33215755-33215777 CCTATTCAATAGATGGTGCTGGG - Intronic
1188794007 X:34440447-34440469 CCTTTTCAATAAATGGTGCTGGG + Intergenic
1188958172 X:36459255-36459277 CCTTTTCAAAAAATGGTGCCGGG + Intergenic
1189067639 X:37827940-37827962 CCCAATCAATAGAGGGAGCTGGG + Intronic
1189218567 X:39349536-39349558 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1189414121 X:40799636-40799658 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1189674574 X:43448368-43448390 CCCTCTCAGAAGAAAGAGCTAGG - Intergenic
1189779085 X:44496865-44496887 CCTTTTCAATAAATGGTGCTGGG - Intergenic
1189963510 X:46348608-46348630 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1190339388 X:49284929-49284951 CCCTTTCAAAAGATGGAGCTAGG + Intronic
1190464668 X:50714048-50714070 CCTTTTCAATAAATGGTGCTGGG - Intronic
1190631781 X:52394330-52394352 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1191012951 X:55779735-55779757 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1191905853 X:66089223-66089245 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1192050920 X:67723157-67723179 CCCTTTCACAATATCCAGCTGGG - Intronic
1192261236 X:69506758-69506780 CCCTGACAAAGGAAGGAGCTGGG + Intronic
1192858755 X:75042663-75042685 CCCATTCAATAAATGGTGCTGGG + Intergenic
1192985052 X:76389453-76389475 CCCTTTCAACAAATGATGCTAGG - Intergenic
1193102049 X:77625152-77625174 CCTTTTCAACAAATGGTGCTGGG + Intronic
1193178813 X:78429255-78429277 CCTTTTCAATAAATGGTGCTGGG - Intergenic
1193423378 X:81311629-81311651 CCCTTTCAACAAATGGTGCTGGG - Intergenic
1193428842 X:81375017-81375039 CCCATTCAATAAATGGTGCTGGG - Intergenic
1193503197 X:82305977-82305999 CCCTAGGAAAAGATGGAGCAGGG - Intergenic
1193578901 X:83237334-83237356 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1193589940 X:83376753-83376775 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1193676595 X:84461430-84461452 CCTTTTCAACAAATGGTGCTAGG + Intronic
1193696698 X:84716069-84716091 CCCATTCAATAAATGGTGCTGGG - Intergenic
1193748890 X:85318602-85318624 CCTATTCAATAGATGGTGCTGGG - Intronic
1193752338 X:85361442-85361464 CCTATTCAATAAATGGAGCTGGG - Intronic
1193779518 X:85685318-85685340 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1193782893 X:85724427-85724449 CCTCTTCAATAGATGGTGCTGGG - Intergenic
1193826092 X:86229199-86229221 CCTTTTCAACAAATGGTGCTGGG - Intronic
1193864804 X:86718710-86718732 CCTTTTCAACAAATGGTGCTGGG - Intronic
1194096359 X:89644372-89644394 CCTATTCAAAACATGGTGCTGGG + Intergenic
1194184140 X:90751516-90751538 CCCATTCAATAAATGGTGCTGGG + Intergenic
1194543078 X:95199024-95199046 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1194562002 X:95433104-95433126 CCTTTTCAATAAATGGTGCTGGG + Intergenic
1194601728 X:95929475-95929497 CCTATTCAACAGATGGTGCTGGG + Intergenic
1194636105 X:96346597-96346619 CCCTTTTAATAAATGGTGCTGGG - Intergenic
1194637847 X:96367374-96367396 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1194956029 X:100181584-100181606 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1194969032 X:100322300-100322322 CCTTTTCAAAAAATGGTGCTGGG - Intronic
1195556897 X:106237001-106237023 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1195913003 X:109907672-109907694 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1195917457 X:109949655-109949677 TCTTTTCAATAGATGGTGCTGGG + Intergenic
1196006859 X:110845747-110845769 CCTTTTCAATAAATGGTGCTGGG + Intergenic
1196111214 X:111949096-111949118 CCTTTTCAACAAATGGTGCTGGG + Intronic
1196219287 X:113092798-113092820 CCTATTCAAAAAATGGTGCTGGG + Intergenic
1196242674 X:113361601-113361623 CCTTTTCAATAAATGGTGCTGGG - Intergenic
1196336628 X:114543735-114543757 CCTATTCAAAAAATGGTGCTGGG + Intergenic
1196392482 X:115223094-115223116 CCTTTTCAAAAAATGGTGCTAGG + Intronic
1196566697 X:117214548-117214570 CCTTTTCAATAAATGGTGCTTGG + Intergenic
1196590140 X:117477673-117477695 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1196737989 X:118997380-118997402 CCTTTTCAACAAATGGTGCTGGG + Intronic
1197065783 X:122232578-122232600 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1197145101 X:123163294-123163316 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1197319603 X:125011091-125011113 CCCATTCAATAAATGGTGCTAGG + Intergenic
1197525560 X:127557942-127557964 CCATTTCAACAAATGGTGCTGGG - Intergenic
1197861213 X:130972707-130972729 TCCTTTCAACAAATGGTGCTGGG - Intergenic
1198570468 X:137949826-137949848 GCCTTTCAAAGGGTGGAGGTTGG - Intergenic
1198616900 X:138468108-138468130 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1198668692 X:139053987-139054009 CCTTTTCAACAAATGGTGCTGGG - Intronic
1198796437 X:140401420-140401442 CCCATTCAATAAATGGTGCTGGG + Intergenic
1199007985 X:142724660-142724682 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1199088485 X:143662222-143662244 TCATTTCAAAACATGGTGCTGGG + Intergenic
1199107761 X:143890960-143890982 CCTTTTCAATAAATGGTGCTGGG - Intergenic
1199158681 X:144581408-144581430 CCTTTTCAATAAATGGTGCTGGG - Intergenic
1199421072 X:147644987-147645009 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1199521098 X:148736847-148736869 CCTTTTCAACAAATGGTGCTGGG - Intronic
1199641156 X:149863393-149863415 CCCATTCAACAAATGGTGCTGGG + Intergenic
1199668953 X:150125756-150125778 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1199821312 X:151451123-151451145 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1200317704 X:155151054-155151076 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1200530731 Y:4333440-4333462 CCCATTCAACAAATGGTGCTGGG + Intergenic
1201269147 Y:12237476-12237498 GCCTTTCAGAAGGTGGAGCGTGG - Intergenic
1202348847 Y:23965227-23965249 CCCATTCAATAAATGGTGCTGGG + Intergenic
1202521928 Y:25704877-25704899 CCCATTCAATAAATGGTGCTGGG - Intergenic