ID: 1190339611

View in Genome Browser
Species Human (GRCh38)
Location X:49286298-49286320
Sequence GAAGTGGCCTGGCCCTGAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 1, 2: 3, 3: 38, 4: 310}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190339603_1190339611 12 Left 1190339603 X:49286263-49286285 CCCCTGGGCATACTGACGGACCG 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1190339611 X:49286298-49286320 GAAGTGGCCTGGCCCTGAGCGGG 0: 1
1: 1
2: 3
3: 38
4: 310
1190339605_1190339611 10 Left 1190339605 X:49286265-49286287 CCTGGGCATACTGACGGACCGCG 0: 1
1: 0
2: 0
3: 1
4: 12
Right 1190339611 X:49286298-49286320 GAAGTGGCCTGGCCCTGAGCGGG 0: 1
1: 1
2: 3
3: 38
4: 310
1190339598_1190339611 22 Left 1190339598 X:49286253-49286275 CCCCAGCCATCCCCTGGGCATAC 0: 1
1: 0
2: 0
3: 20
4: 233
Right 1190339611 X:49286298-49286320 GAAGTGGCCTGGCCCTGAGCGGG 0: 1
1: 1
2: 3
3: 38
4: 310
1190339599_1190339611 21 Left 1190339599 X:49286254-49286276 CCCAGCCATCCCCTGGGCATACT 0: 1
1: 0
2: 0
3: 13
4: 159
Right 1190339611 X:49286298-49286320 GAAGTGGCCTGGCCCTGAGCGGG 0: 1
1: 1
2: 3
3: 38
4: 310
1190339604_1190339611 11 Left 1190339604 X:49286264-49286286 CCCTGGGCATACTGACGGACCGC 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1190339611 X:49286298-49286320 GAAGTGGCCTGGCCCTGAGCGGG 0: 1
1: 1
2: 3
3: 38
4: 310
1190339597_1190339611 23 Left 1190339597 X:49286252-49286274 CCCCCAGCCATCCCCTGGGCATA 0: 1
1: 0
2: 0
3: 13
4: 226
Right 1190339611 X:49286298-49286320 GAAGTGGCCTGGCCCTGAGCGGG 0: 1
1: 1
2: 3
3: 38
4: 310
1190339607_1190339611 -8 Left 1190339607 X:49286283-49286305 CCGCGACCTGATCTTGAAGTGGC 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1190339611 X:49286298-49286320 GAAGTGGCCTGGCCCTGAGCGGG 0: 1
1: 1
2: 3
3: 38
4: 310
1190339600_1190339611 20 Left 1190339600 X:49286255-49286277 CCAGCCATCCCCTGGGCATACTG 0: 1
1: 0
2: 0
3: 20
4: 211
Right 1190339611 X:49286298-49286320 GAAGTGGCCTGGCCCTGAGCGGG 0: 1
1: 1
2: 3
3: 38
4: 310
1190339601_1190339611 16 Left 1190339601 X:49286259-49286281 CCATCCCCTGGGCATACTGACGG 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1190339611 X:49286298-49286320 GAAGTGGCCTGGCCCTGAGCGGG 0: 1
1: 1
2: 3
3: 38
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190339611 Original CRISPR GAAGTGGCCTGGCCCTGAGC GGG Exonic
900532041 1:3159241-3159263 CAAGTGGCCTGGTGCTGCGCCGG - Intronic
900599278 1:3496195-3496217 GCAGTGGCCTGGCCCCCAGCAGG - Intronic
900676023 1:3886830-3886852 GATGGAGCCTGGCACTGAGCTGG - Intergenic
900719266 1:4164744-4164766 GCCATGGCCTGGTCCTGAGCTGG - Intergenic
901150340 1:7097104-7097126 GAAGAGGGCTCGCCCTGAGTTGG - Intronic
901409099 1:9070526-9070548 ACAGTGGCCTGGCCTTGAGATGG - Intronic
901635802 1:10669650-10669672 GAGGGGGCCTGGCCCTGACCAGG - Intronic
901813830 1:11782579-11782601 GAACTGACCTGGCCAGGAGCTGG - Intronic
902241896 1:15095109-15095131 GGAGGGGGCTGGCCCAGAGCAGG - Intronic
902401705 1:16161409-16161431 GAAGTGGCCTGGCATAGAGCAGG - Intergenic
902545803 1:17189724-17189746 GAATGGGCCAGGCCCTGTGCTGG + Intergenic
902634451 1:17726029-17726051 GGTGTGGCCTGACCCTGAGATGG + Intergenic
902753316 1:18532581-18532603 GAAGAGGCCAGGACCCGAGCTGG - Intergenic
902790189 1:18762506-18762528 GAAGTGGACAGGCACTGAGTAGG + Intergenic
902840392 1:19070518-19070540 GAAGGGGCAGGGCCCGGAGCAGG + Intergenic
902990512 1:20184498-20184520 GAAGAGGCCTGGCCCAGACCAGG + Intergenic
903377274 1:22874669-22874691 GAAGGGGCCTGGCACTGGGCAGG + Intronic
903661424 1:24981151-24981173 GAAGGGCCCAGGCCCTGAGGAGG + Intergenic
903666781 1:25012888-25012910 CAAGTAGCCCGGCCCAGAGCAGG - Intergenic
904295602 1:29517890-29517912 GAACTGGCCTTGCCCTGGGCTGG + Intergenic
904528825 1:31155060-31155082 GGAGCGGCCGGGCCCTGGGCGGG + Intergenic
905182942 1:36177938-36177960 AGTGTGGCCTGGCCCTGGGCTGG - Exonic
906698017 1:47837785-47837807 GAAAAGGCCTGGCCCATAGCAGG - Intronic
907258334 1:53197023-53197045 GTACTGGCCGGGCCCGGAGCCGG - Exonic
907311488 1:53541424-53541446 AAGGTGGGCTGGCCCTGTGCTGG + Intronic
908312793 1:62902248-62902270 GAAGTGGCCATGCCCAGACCTGG + Intergenic
909376434 1:74947488-74947510 GAAGTTGTCTGGCTCTGTGCAGG - Intergenic
909485024 1:76162887-76162909 GAGGTGACCAGGCCCAGAGCTGG + Intronic
912491695 1:110066032-110066054 GTGGAGGCCTGGCCCTGAGGAGG + Intronic
913059856 1:115194843-115194865 GAACTGGTCTGGCTCTTAGCAGG - Intergenic
913958538 1:143322901-143322923 GACTTTCCCTGGCCCTGAGCTGG - Intergenic
913960437 1:143334669-143334691 GCAGCGGCCTGGGCCTGAGAGGG - Intergenic
914052855 1:144148281-144148303 GACTTTCCCTGGCCCTGAGCTGG - Intergenic
914054793 1:144160242-144160264 GCAGCGGCCTGGGCCTGAGAGGG - Intergenic
914124353 1:144806119-144806141 GCAGCGGCCTGGGCCTGAGAGGG + Intergenic
914126342 1:144818260-144818282 GACTTTCCCTGGCCCTGAGCTGG + Intergenic
914349961 1:146832224-146832246 GGAGTGGCCTGGCCATGAGCGGG - Intergenic
914384862 1:147158832-147158854 AAAGTGGCCTGGGCCTGTGCTGG + Exonic
914674680 1:149899622-149899644 CCAGAGTCCTGGCCCTGAGCGGG + Exonic
914952807 1:152132124-152132146 GCAGTGACCTGGCACTGGGCAGG - Intergenic
916653183 1:166849610-166849632 GCAGTGTCCTGGCTCTGCGCAGG + Exonic
917121225 1:171646173-171646195 AAAGGGGCCTGGACCTAAGCCGG + Intronic
918465031 1:184812380-184812402 GACGTGGCTTGGCCCCCAGCAGG + Intronic
919752796 1:201048699-201048721 GCAGTGGCCTGCCGCTGAGCTGG + Intronic
920227838 1:204450906-204450928 GAAGTTGCTGGGCCCTGGGCTGG - Intronic
920264222 1:204709890-204709912 GAAGTGGCATAGCCATGAGCAGG - Intergenic
922748460 1:228060023-228060045 GAAGGGGCCTTGCCCTGGTCAGG - Exonic
923125145 1:231028110-231028132 GAAGTGGCCTGGCAGTGGGGTGG + Intronic
923794011 1:237135950-237135972 GGAGTGGCCCTGGCCTGAGCAGG + Intronic
924805907 1:247361488-247361510 GGAGTGGTCTGGATCTGAGCAGG - Intergenic
1063420981 10:5912413-5912435 GAAGGGCCTTGTCCCTGAGCTGG + Intronic
1065244336 10:23742272-23742294 GGAGGGGCCTGCCACTGAGCAGG + Intronic
1067080176 10:43208346-43208368 GGAGTGGCCTTGCCCTGTGGGGG - Intronic
1070171797 10:73938542-73938564 GGAGTGGCCTGGCCAAGAGGAGG - Intergenic
1071802465 10:89078880-89078902 GGCAAGGCCTGGCCCTGAGCTGG - Intergenic
1072878761 10:99203495-99203517 GGATTGGCCTGGCACTGGGCGGG - Intronic
1074807563 10:117068505-117068527 CAAGTGGCCTGGCTCTGAAGGGG + Intronic
1074807636 10:117069381-117069403 CAAGTGGCCTGGCTCTGAAGGGG + Intronic
1075809637 10:125215599-125215621 GGAAGGGCCTGTCCCTGAGCTGG - Intergenic
1076633927 10:131870500-131870522 GAAGGGACCTGGTCCTGGGCAGG - Intergenic
1076798988 10:132812014-132812036 CAAGTGGGCTGGCCCTGCACAGG + Intronic
1076825192 10:132963651-132963673 GGAGCGGCCTGGGGCTGAGCAGG - Intergenic
1076902579 10:133347314-133347336 CAATTGGCCTGGGCCTGGGCAGG + Exonic
1077800427 11:5530711-5530733 GCACTGGCCTGGCTCTGGGCTGG + Intronic
1079076638 11:17388867-17388889 GGGGTGGCCAGGACCTGAGCTGG - Intronic
1079416094 11:20237961-20237983 GAAGTGCCCTGGGCCAGAGGGGG - Intergenic
1080708178 11:34719242-34719264 GAAGTTGCCAGTACCTGAGCTGG + Intergenic
1080847118 11:36036251-36036273 TGAGTGGCCTGGCCCTTTGCTGG + Intronic
1081719993 11:45281699-45281721 GAAATTGCTTGGCCCTCAGCAGG - Intronic
1083681502 11:64353890-64353912 CATGGGGCCTGGACCTGAGCTGG - Intronic
1084582914 11:70035332-70035354 GAAGGGGCCAAGCCCTGCGCTGG + Intergenic
1084793793 11:71491086-71491108 GAATGGTCCTGCCCCTGAGCTGG + Intronic
1084814673 11:71639271-71639293 GAGCTGGCCTGGCCAAGAGCAGG + Intergenic
1085199337 11:74692187-74692209 GAAGGGGCCGGGTCCTGAGCAGG - Intergenic
1085508710 11:77074519-77074541 GATTTGGGCTGGCGCTGAGCTGG - Intronic
1085706928 11:78794759-78794781 GAAGTGGCCTGGTTCTGGCCAGG + Intronic
1089315815 11:117590583-117590605 GCAGGGACCTGGCTCTGAGCAGG - Intronic
1089580229 11:119476992-119477014 GTAGTGGTCTGACCCAGAGCAGG + Intergenic
1089752384 11:120660882-120660904 GCTGTGGCCTGGCTCTGAGAGGG + Intronic
1091795705 12:3296466-3296488 GACCTGGGCTGGCCCTGAGGAGG - Intergenic
1092395568 12:8122478-8122500 GGAGTGGGCTGGCCCTTTGCCGG + Intergenic
1095788380 12:46136456-46136478 GAAGTGGCCTTCCCCTGGGAGGG - Intergenic
1096349323 12:50881939-50881961 GAAGTGGTCTCGCCCTGGGCTGG - Intronic
1097022364 12:56029374-56029396 GAAGAGGCCAGGAGCTGAGCTGG + Intronic
1097042521 12:56164306-56164328 GCAGTGGGCTGGCACTGGGCAGG + Exonic
1104964542 12:132503021-132503043 GCTGTGGCCTGGCCCTGTGCGGG - Intronic
1105203143 13:18195618-18195640 GGAGCGCCCTGGCCCAGAGCCGG + Intergenic
1105443751 13:20435695-20435717 GCAGGGGCCTGGGCCTGCGCAGG + Intronic
1106044861 13:26129524-26129546 GAAGTGATGTGGTCCTGAGCTGG + Intergenic
1106311347 13:28557173-28557195 GAAGTGGTCTGGGCCTGGGAAGG - Intergenic
1107276534 13:38686660-38686682 GAAATGGCCATGCCCTGCGCGGG + Intergenic
1114066421 14:19062666-19062688 GGAGCGCCCTGGCCCAGAGCTGG + Intergenic
1114095847 14:19337358-19337380 GGAGCGCCCTGGCCCAGAGCTGG - Intergenic
1114531374 14:23398691-23398713 GAAGTCCCCTGGCCCAGTGCAGG + Intronic
1115740444 14:36382029-36382051 GATGTGGACTGGCCCTGGGGAGG + Intergenic
1116419730 14:44719134-44719156 AAACTGGCCTGGCCCTGAGAAGG + Intergenic
1118329810 14:64806411-64806433 GGAGTGGCCTAGCCAGGAGCGGG + Intronic
1119754630 14:77106862-77106884 GGACTGTCCTGGCCCTGGGCAGG - Intronic
1121328869 14:93037105-93037127 GGACTGGCCTGGCTCAGAGCAGG - Intronic
1121774579 14:96582401-96582423 GACTTGGCCAGGCCCTGGGCTGG + Intergenic
1122602367 14:102928180-102928202 CCAGTGTCCTGTCCCTGAGCTGG - Intronic
1202930337 14_KI270725v1_random:28955-28977 GAACTGGCCCTGCCCTGACCTGG + Intergenic
1123422034 15:20142530-20142552 GAACTGGCCCTGCCCTGACCTGG - Intergenic
1123531262 15:21149070-21149092 GAACTGGCCCTGCCCTGACCTGG - Intergenic
1123707391 15:22959976-22959998 GATGTGGCCTGGCCCTGCCAGGG + Intronic
1124249931 15:28100564-28100586 GCAGTGGCCAGGCCCTGCACAGG + Intergenic
1124923498 15:34048427-34048449 GAAGCAGCCTGGCCATGATCTGG - Intronic
1126911606 15:53422809-53422831 TAAGTGCCGAGGCCCTGAGCTGG - Intergenic
1127099819 15:55553121-55553143 GAAGTAGTCTGGCCATGATCTGG - Intronic
1129101675 15:73270736-73270758 GAAGTGACCTGCCCTTGACCAGG + Intronic
1129606852 15:77029188-77029210 GAAGTGGCCTGAGGGTGAGCTGG + Intronic
1131067732 15:89444681-89444703 GAAGGGGCCTGGGCAGGAGCAGG - Intergenic
1132666276 16:1082710-1082732 GCAGCGGCCTGGCCCGGGGCCGG + Intergenic
1132972876 16:2697476-2697498 CCAGTGGCGTGGCCATGAGCAGG + Intronic
1133915576 16:10106598-10106620 GAAGTGGCCTGACCCCCAGAAGG + Intronic
1134139258 16:11703009-11703031 GAGGAGGCCTGGCACTGAGTAGG + Intronic
1135235300 16:20749730-20749752 GAAGTTGCCTGGGCTTGACCAGG + Intronic
1137714803 16:50592161-50592183 AATGTGGACTGGACCTGAGCCGG - Intronic
1138265358 16:55656299-55656321 GAAGTGTCGCGGACCTGAGCTGG + Intronic
1138342699 16:56301050-56301072 AATGTGGCCTTGCCCTGGGCTGG - Intronic
1139486314 16:67258521-67258543 CAAGCAGGCTGGCCCTGAGCAGG + Intronic
1139984077 16:70883307-70883329 GGAGTGGCCTGGCCATGAGCGGG + Intronic
1141360462 16:83390926-83390948 GCAGAGGCCTGGCTCTTAGCAGG + Intronic
1141426525 16:83947807-83947829 GAAGGGGCCTGGCACTGGGGAGG - Intronic
1141551923 16:84812029-84812051 GAAGGGACCTGGCCCTGAGATGG + Intergenic
1141715941 16:85726915-85726937 GAGCTGGCCTGGCACAGAGCGGG - Intronic
1142105409 16:88299800-88299822 GGAGTTGCCTGACCCTGAGCAGG + Intergenic
1142141321 16:88473998-88474020 GGAGTGGCCGGGCCCAGAGATGG + Intronic
1142260387 16:89040014-89040036 CGAGGGGCCTGGCCCTGGGCTGG + Intergenic
1142308543 16:89299267-89299289 GGAGGGGCCTGGCCTTGGGCTGG + Intronic
1142591625 17:1008698-1008720 CGGGGGGCCTGGCCCTGAGCTGG + Intronic
1143012182 17:3872198-3872220 GAAGTTCCCTGACCCTGAGTGGG + Intronic
1143301101 17:5911216-5911238 GAAGGGGACTGGCCTTGAGCTGG + Intronic
1143372429 17:6448684-6448706 AAAGTGGCCTGGCTCAGGGCAGG + Intronic
1144645689 17:16972052-16972074 TGAGTGGCCTGGGCCGGAGCAGG - Exonic
1145305195 17:21670239-21670261 GAGGTGGCCTTGCCCTGAACTGG + Intergenic
1146651885 17:34612193-34612215 CATGTGACCTGGCCCTGAGTTGG + Intronic
1146946315 17:36876107-36876129 GAAGCTGCCTGGGCCAGAGCAGG + Intergenic
1147773625 17:42884934-42884956 GACGTGTCCTGGCCCTGGCCAGG - Intergenic
1148860321 17:50601188-50601210 GGAGAGGCCTTGCCCTGAGCGGG - Intronic
1149640973 17:58202301-58202323 GATGTGGCTTGGCCCTGCGTGGG + Intronic
1150008812 17:61486607-61486629 CCAGGGGCCTGGCCCTGGGCTGG - Intergenic
1150769823 17:68031529-68031551 AAAGGGGCCTGGAGCTGAGCTGG - Intergenic
1151149450 17:72071722-72071744 GAGCTGGCTTGACCCTGAGCAGG + Intergenic
1151451810 17:74202767-74202789 GAAGTGGCCGGAGCCTGGGCTGG + Intergenic
1151893416 17:76964364-76964386 GAGGTGGCCTGGCACTGGGTAGG + Intergenic
1152668056 17:81582952-81582974 GAGGAGGCCTGGCCCTGGCCGGG - Intronic
1152755190 17:82084279-82084301 GAGGTGGCCAGGCCCTTGGCAGG + Exonic
1153453912 18:5259866-5259888 GAAGTCCCCAGGCCCTGAGTGGG - Intergenic
1154175922 18:12087243-12087265 GAAATGTCCTGGTCCTGAGCTGG + Intergenic
1154175992 18:12087527-12087549 GAAGTGACCTGGCCCTGCCTTGG + Intergenic
1154201172 18:12301807-12301829 GGAGTGGCCTGGCCCTGCAAGGG + Intergenic
1156478612 18:37422154-37422176 GAAGAGGCCAGGGCCTGAGTGGG + Intronic
1157818262 18:50746801-50746823 TAAGAGGTCTAGCCCTGAGCTGG - Intergenic
1160397202 18:78581148-78581170 GATTTGGCCTGTCCCTGGGCAGG - Intergenic
1160658827 19:288844-288866 GCCCTGGCCAGGCCCTGAGCAGG - Intronic
1160745699 19:709852-709874 GGAGTGGGCTGGCCCTGGGCTGG + Intronic
1161086491 19:2337958-2337980 CAGGTGGCCTGGCCCTGAGCTGG + Intronic
1161125636 19:2555854-2555876 TACGGGGCCTGGCCCTGTGCAGG - Intronic
1161252782 19:3290074-3290096 GAAGGGGCCTGGCCACGGGCTGG - Intronic
1161321795 19:3644788-3644810 GGACAGGCCTGGCCCTGTGCGGG - Intronic
1162086833 19:8254501-8254523 TCATTGGCCTGCCCCTGAGCCGG + Exonic
1162127557 19:8507488-8507510 GAGGTGACATGGCACTGAGCAGG + Intergenic
1162128829 19:8513197-8513219 GGAGGAGCCAGGCCCTGAGCAGG - Exonic
1162790732 19:13061395-13061417 CCAGTGGCCTGGGCCTGAGTGGG + Intronic
1163611682 19:18305006-18305028 GAAGTTGGCTGCCCCTAAGCAGG + Intergenic
1164452814 19:28381338-28381360 TAGGAGGCCTGGGCCTGAGCTGG + Intergenic
1164453053 19:28383107-28383129 CAGGTGGCATGGCACTGAGCTGG + Intergenic
1164710929 19:30356854-30356876 GAAGTGGCCTGCCCCAAACCTGG + Intronic
1165108171 19:33486641-33486663 CAGGCGGCCTGGCCCTGATCTGG + Intronic
1166253338 19:41585992-41586014 GACCTGCCCTGGCCATGAGCTGG + Intronic
1166667457 19:44689576-44689598 GAAGCTGCCTGGCCCAGGGCTGG - Intergenic
1166938760 19:46350497-46350519 AGAGGGGCCTGGCACTGAGCTGG + Intronic
1166965646 19:46528206-46528228 AGAGGGGCCTGGCACTGAGCTGG - Intronic
1202692251 1_KI270712v1_random:100705-100727 GACTTTCCCTGGCCCTGAGCTGG - Intergenic
1202694273 1_KI270712v1_random:112920-112942 GCAGCGGCCTGGGCCTGAGAGGG - Intergenic
925655584 2:6144743-6144765 GAAGTAGCCTGGCGCTGGACAGG - Intergenic
928683837 2:33728165-33728187 GAAGAGACCTGGCCTTGACCCGG + Intergenic
928999104 2:37328230-37328252 GAATGTGCCTGGCCCAGAGCTGG - Intergenic
929573572 2:43038774-43038796 GGAGTGGAGTGGGCCTGAGCTGG - Intergenic
930172161 2:48262957-48262979 AAATTAGCCTGGCCCTGGGCAGG + Intergenic
932167183 2:69519069-69519091 GGTGTGGCCTGGGCCTGAGCGGG + Exonic
932435644 2:71701239-71701261 GAAGAGGCCTGGAGGTGAGCAGG - Intergenic
933952286 2:87341648-87341670 GCAGCGGCCTGGGCCTGAGAGGG + Intergenic
933954147 2:87353267-87353289 GACTTTCCCTGGCCCTGAGCTGG + Intergenic
934236527 2:90237987-90238009 GCAGCGGCCTGGGCCTGAGAGGG + Intergenic
934238342 2:90249487-90249509 GACTTTCCCTGGCCCTGAGCTGG + Intergenic
934274847 2:91567223-91567245 GACTTTCCCTGGCCCTGAGCTGG - Intergenic
938143146 2:128812663-128812685 GAAGTGGCCTGGTCAGGAGACGG + Intergenic
940342193 2:152592994-152593016 GAAGTGGGTAGGTCCTGAGCAGG + Intronic
944691196 2:202159983-202160005 TGAGGGGCCTGGCCCTTAGCAGG - Intronic
947933949 2:233987489-233987511 CCAGTGGCCTCCCCCTGAGCAGG + Intronic
948336438 2:237211068-237211090 GAAGGGGCGTTGCCCAGAGCTGG - Intergenic
948542407 2:238700004-238700026 GAAGTGGCTTGGCCCTGAGCAGG + Intergenic
948846956 2:240687777-240687799 GGAGTGGCCTGGCCCTGCCGTGG + Intergenic
948858093 2:240739987-240740009 GAAGAGTACAGGCCCTGAGCTGG - Intronic
948889580 2:240900436-240900458 CCTGTGGTCTGGCCCTGAGCTGG - Intergenic
1169192517 20:3667239-3667261 GTAGGTGCCTGGCCCTGAGCTGG - Intergenic
1169672459 20:8117776-8117798 GGAGTGGGCTGGCCTTAAGCAGG + Intergenic
1171522710 20:25787712-25787734 GAGGTGGCCTTGCCCTGAACTGG + Intronic
1171530455 20:25849681-25849703 GAGGTGGCCTTGCCCTGAACTGG + Intronic
1171554117 20:26068171-26068193 GAGGTGGCCTTGCCCTGAACTGG - Intergenic
1172242574 20:33423251-33423273 CAAGTGGCCTGTCCCAGAGTGGG + Intronic
1173189036 20:40862295-40862317 CACGGGGCCTGACCCTGAGCAGG - Intergenic
1173329405 20:42062021-42062043 GAGGTGCCCTGGCCCAGCGCAGG + Intergenic
1174763413 20:53229119-53229141 GAAGGGGCTTGACCCTGAGCTGG + Intronic
1175379411 20:58552556-58552578 GAGCTTGGCTGGCCCTGAGCAGG + Intergenic
1175606906 20:60318526-60318548 ACAGTGGCCTATCCCTGAGCAGG - Intergenic
1175897697 20:62346638-62346660 GGAATGGGCTGGCCCTGAGGTGG - Intronic
1176592353 21:8657551-8657573 GAACTGGCCCTGCCCTGACCTGG + Intergenic
1176714816 21:10342387-10342409 GGAGCGCCCTGGCCCAGAGCCGG - Intergenic
1177117621 21:17105056-17105078 GAAGTAGTCTGGCCATGATCTGG - Intergenic
1180275212 22:10634698-10634720 GAACTGGCCCTGCCCTGACCTGG + Intergenic
1180484899 22:15785257-15785279 GGAGCGCCCTGGCCCAGAGCTGG + Intergenic
1180858605 22:19063983-19064005 GAGGTGGGCTGGCTCTGAGTGGG - Intronic
1181050894 22:20237754-20237776 GGAGCGGCCTAGCCCAGAGCAGG + Intergenic
1181107486 22:20583675-20583697 GCAGTGGCCTGACCATCAGCTGG + Intronic
1181390384 22:22576419-22576441 CAGGAGGCCTGGTCCTGAGCTGG + Intergenic
1182015997 22:27040125-27040147 CAGGTGGCCTGGTCCTAAGCAGG - Intergenic
1183060621 22:35334450-35334472 TGAGTGGCCTGGCCCTGCCCTGG + Intronic
1183288860 22:36985421-36985443 GAAGTGGCCAGGCCTTTGGCAGG + Intergenic
1183615052 22:38938980-38939002 GGAGAGGCCGAGCCCTGAGCAGG + Intergenic
1183663237 22:39233663-39233685 CACGGGTCCTGGCCCTGAGCAGG + Intronic
1184039770 22:41935839-41935861 CCACTGGCCAGGCCCTGAGCTGG - Intergenic
1184262738 22:43328693-43328715 GCAGTGGGCAGGGCCTGAGCTGG + Intronic
1184386812 22:44181401-44181423 GAAGGGGCCTGGCCCGGGGCGGG + Intronic
1184720042 22:46306887-46306909 TAAGTGTCCAGGCCCTTAGCTGG + Intronic
1185100115 22:48835864-48835886 GTGCTGGCCTGGCCCTGACCTGG - Intronic
950008508 3:9705892-9705914 GAACTGCCCTGGTCCTGTGCAGG + Intronic
950181327 3:10915513-10915535 GAAGTCGGCAGGCACTGAGCTGG - Intronic
950295733 3:11828609-11828631 AGAGTGGCGTGGCCCTGTGCTGG - Intronic
953605267 3:44409676-44409698 GGACAGGCCTAGCCCTGAGCTGG - Intergenic
953880042 3:46686781-46686803 GACGTGGCCCAGCCCTGAGGAGG - Intronic
953982958 3:47421861-47421883 GAGGTGGCCCTGCACTGAGCTGG - Intronic
954370415 3:50167091-50167113 CAAGAGACCTGGTCCTGAGCAGG - Intronic
954705736 3:52479587-52479609 CACGTGGCCTGGCCCACAGCAGG + Intronic
955953977 3:64269158-64269180 CATGGGGCCTGGCACTGAGCTGG - Intronic
955994054 3:64659788-64659810 GAAGAGGCCTAGGCATGAGCTGG - Intronic
957305222 3:78449239-78449261 GAAGTGCCCTGGCCAAGAGGAGG - Intergenic
961682923 3:128611004-128611026 GAATTGGCCGGGCCCTATGCGGG - Intergenic
961865911 3:129953328-129953350 GACAAGGCCTGGCCCTGAGCAGG + Intergenic
962276336 3:134017555-134017577 AAACTAGCCTGGCCCTGTGCAGG + Intronic
964128156 3:153258395-153258417 GAAGGGGCCATGCCCAGAGCAGG + Intergenic
965789091 3:172368414-172368436 TTAAGGGCCTGGCCCTGAGCTGG - Intronic
967864508 3:194179349-194179371 GAGGTTGCCTGGCCTGGAGCAGG + Intergenic
968142831 3:196273027-196273049 GCAGTGGCCGGACCCTGTGCTGG - Intronic
968882404 4:3308141-3308163 CTAGGGCCCTGGCCCTGAGCTGG + Intronic
969374384 4:6753488-6753510 GAATAGGCCTAGCTCTGAGCCGG - Intergenic
969532244 4:7736522-7736544 GAAGGAGCCTGGCCCAGGGCGGG + Intronic
969585418 4:8088549-8088571 GCACTGGGCTGGCCCTCAGCTGG - Intronic
969672384 4:8596973-8596995 AGCGTGGCCTGGCCCTGAGCTGG - Intronic
975557164 4:75676128-75676150 GAAGGGGCCTGAACCTGGGCAGG - Intronic
981937182 4:150250536-150250558 GGAGTGGCCTTTCCCAGAGCTGG + Intronic
982046789 4:151455608-151455630 GAAGTGGCATCTCCCTGAACCGG - Intronic
982449310 4:155533158-155533180 GAAGTGCCCTGGCTCAGAGGAGG - Intergenic
985504224 5:269767-269789 GGAGTGCCCTGGCCCAGAGAAGG + Intergenic
987085036 5:14460325-14460347 GCCGTGGCCTGGCCGTGAACAGG + Intronic
988583587 5:32489914-32489936 GAAGTGACTTGGGCCTGGGCAGG + Intergenic
988872447 5:35406062-35406084 GAAGCGGACTAGCCATGAGCTGG - Intergenic
990977033 5:61569396-61569418 GAAGGCGCCTGGCTCTGGGCAGG - Intergenic
995237149 5:109841980-109842002 GAAGTGGACTGGCCTGTAGCTGG + Intronic
995329746 5:110933710-110933732 GAAGTAGTCTGGCCATGATCTGG + Intergenic
996271435 5:121609297-121609319 GAAGTTGCCTGGGACTGAGTTGG + Intergenic
997210870 5:132075965-132075987 GGAGTGGCCTGGACCTGCCCTGG + Exonic
997465391 5:134084569-134084591 GAGGTAGCCAGGACCTGAGCAGG - Intergenic
998092711 5:139380521-139380543 GAAGAGGCCGGGTCCTGAGGAGG - Intronic
998315631 5:141180069-141180091 GAGTCGGCCTGGCCCTGGGCTGG - Exonic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
999693394 5:154167986-154168008 GAAGAGGCCTGGACCTTAGGAGG - Intronic
1000240595 5:159404845-159404867 GAGGTGGCTTGTTCCTGAGCTGG + Intergenic
1000373166 5:160556408-160556430 AAAATGGCCTGGCCCTGGCCTGG - Intergenic
1002096040 5:176831540-176831562 GAAGGGGCCTAGCCGTGGGCTGG + Intronic
1002518263 5:179775007-179775029 GGTGAGGCCTGGCCCTGGGCAGG + Exonic
1002570808 5:180138312-180138334 GAAGAGGCCTGCCCCTGAGTGGG - Exonic
1003115518 6:3281290-3281312 CACCTGGCCTGGGCCTGAGCGGG + Intronic
1003270247 6:4602032-4602054 GAAGTACCTGGGCCCTGAGCCGG + Intergenic
1006079729 6:31558360-31558382 GATGTGCCCTGGCCCTGCCCTGG + Exonic
1006175454 6:32118689-32118711 GAAATGGCCTGGGCCAAAGCAGG + Intronic
1006360376 6:33584129-33584151 GAAGAGGCCTGGACATGAGATGG + Intergenic
1006424325 6:33954735-33954757 GAAGGGGCCAGTCCCTGAACAGG - Intergenic
1006828422 6:36954081-36954103 CATGTGGCCTGGGCCTTAGCAGG - Intronic
1008045781 6:46849864-46849886 GAACTGGTCTGGCACAGAGCGGG + Intergenic
1011492783 6:87909940-87909962 GAAGTGTCTTGGCTCTGAGCAGG + Intergenic
1019178611 6:170173807-170173829 GAAGGGGCAGGGCCCTGACCAGG + Intergenic
1019342881 7:516927-516949 GAGGGGGCCGGGCCCTGACCCGG + Intronic
1019491054 7:1313832-1313854 GGAGGGGCCTGACCCTGGGCTGG + Intergenic
1019498455 7:1352411-1352433 GAAGAGGCCATTCCCTGAGCAGG + Intergenic
1019658328 7:2209758-2209780 GGAGTGCCCTGGGCCTGTGCCGG - Intronic
1019932949 7:4235755-4235777 GAGCTGGCCTTGCCATGAGCTGG + Intronic
1019933487 7:4239060-4239082 GTAGTGACCTGGCCCTCAGACGG - Intronic
1021984927 7:26089203-26089225 CAACTGGCCTGGCCCAGAGGAGG - Intergenic
1022643115 7:32206576-32206598 GTTGAGGCCTGGACCTGAGCAGG + Intronic
1024262821 7:47584403-47584425 GAAGTGGGGAGGCCCTGGGCTGG - Intergenic
1024602107 7:50992785-50992807 GAAGAGGTCAGGCCCTCAGCTGG - Intergenic
1024623659 7:51185934-51185956 CAAGTGTCCTGGCCCTGCCCTGG - Intronic
1025283189 7:57642913-57642935 GAGGCGGCCTTGCCCTGAACTGG + Intergenic
1025742301 7:64207454-64207476 GCAGTGGCTTTGCCCTGGGCTGG + Intronic
1026963550 7:74424998-74425020 TATGTGGCCTGGCACAGAGCTGG - Intergenic
1027267932 7:76504293-76504315 GCAGGGGCCTGTCCCTGTGCGGG + Intronic
1027319743 7:77004155-77004177 GCAGGGGCCTGTCCCTGTGCGGG + Intergenic
1027624313 7:80528436-80528458 GAGCTGGCCTGGCACTGGGCAGG - Intronic
1030505800 7:110420551-110420573 GACGTGGCCTGGCACTGTGAGGG + Intergenic
1036087702 8:5631405-5631427 AAGGTTGCCTGGCCATGAGCTGG - Intergenic
1038692993 8:29780215-29780237 GACGGGGCCTGGCTGTGAGCAGG + Intergenic
1041696502 8:60742115-60742137 CAAGTGGCCAGGTCCTGAGGTGG - Exonic
1041758570 8:61339466-61339488 CAAGTGGCCCAGCCCAGAGCTGG + Intronic
1041809035 8:61887213-61887235 GGACTGGCCTGGCACTGGGCAGG + Intergenic
1047204874 8:122795057-122795079 GAAGTGGGCCAGCCCTGTGCTGG - Intronic
1048572844 8:135669404-135669426 TAAGTGACCTGGCCCAGAGGTGG - Intergenic
1049117764 8:140704597-140704619 AAAGTGAACTGGCCCTGAGTGGG - Intronic
1049607999 8:143538632-143538654 GCACTGGCGTGGCCCTGGGCCGG - Exonic
1049659087 8:143811718-143811740 GGAAGGGGCTGGCCCTGAGCAGG - Intronic
1050398147 9:5222259-5222281 GAAGTAGTCTGGCCATGATCTGG - Intergenic
1051170557 9:14315318-14315340 CACGTGGCCTCGCTCTGAGCGGG + Intronic
1052471270 9:28899799-28899821 GGAACAGCCTGGCCCTGAGCAGG - Intergenic
1052999732 9:34571361-34571383 GCAGTGGCCTGGCACTGAGGCGG - Intronic
1053003955 9:34592218-34592240 GAAGGGGGCTGGCGCAGAGCTGG - Intergenic
1054401563 9:64717031-64717053 GCACTGGCCTGGCCCTGCCCTGG + Intergenic
1056654152 9:88495562-88495584 GAAGTACCTTGGCCCTGGGCAGG + Intergenic
1056846024 9:90039030-90039052 GGAGGGGCATGGCTCTGAGCTGG + Intergenic
1057576530 9:96246946-96246968 AAAGTGGACTGGCCATGAGTTGG + Intronic
1057698914 9:97348916-97348938 GAGGAGGCCTGGCCATGAGCAGG - Intronic
1057857023 9:98609710-98609732 GGAGTGGCCTGGGGCAGAGCTGG + Intronic
1060156211 9:121321437-121321459 GTACTGGCTGGGCCCTGAGCAGG + Intronic
1060209275 9:121700028-121700050 GCAGTGCCCAGGCCCTGAGCTGG + Intronic
1060230993 9:121825160-121825182 TGAGAGGCCTGGCCCAGAGCTGG - Intronic
1060359358 9:122940798-122940820 GAAGTGCACTGGCTGTGAGCTGG - Intergenic
1060892837 9:127199385-127199407 GAAGTGGCCTGTTCTTGAGATGG + Intronic
1061068506 9:128294265-128294287 GAAGTGGCCAGGCTCTGAGTGGG + Intergenic
1061087744 9:128409197-128409219 GATGGGGCCTCGCCCCGAGCTGG + Intergenic
1061724487 9:132574478-132574500 TGAGTGGGCTGGCCCTGAGCAGG + Intergenic
1061939289 9:133875411-133875433 GCAGAGGGCAGGCCCTGAGCAGG + Intronic
1203745446 Un_GL000218v1:38540-38562 TGGGTGGCCTGGCTCTGAGCGGG + Intergenic
1203564664 Un_KI270744v1:80944-80966 TGGGTGGCCTGGCTCTGAGCGGG - Intergenic
1203622403 Un_KI270749v1:136384-136406 GAACTGGCCCTGCCCTGACCTGG + Intergenic
1185771751 X:2770120-2770142 AAAGTTTCCTGGCCATGAGCAGG + Intronic
1185774950 X:2794572-2794594 GCCGTGGCCTGGGCCTGGGCGGG - Exonic
1190339611 X:49286298-49286320 GAAGTGGCCTGGCCCTGAGCGGG + Exonic
1191735870 X:64387335-64387357 GTAGTGCCCTGGGCCTTAGCAGG - Intronic
1192277480 X:69648457-69648479 GAAGTAGTCTGGCACTGATCTGG + Intronic
1194435857 X:93868097-93868119 GAAGCAGCCTGGCCATGATCTGG - Intergenic
1194742931 X:97596727-97596749 GCAGTGGCCTGGCCCTTATAAGG - Intronic
1197846630 X:130810666-130810688 GACTTGGCCTGGCACTGGGCAGG - Intronic
1199531736 X:148855696-148855718 GAAGTGGACAGGCTCTGTGCTGG + Intronic
1199601220 X:149542263-149542285 GAAGTGGCCAGGCCCTGTGGGGG + Intronic
1199649157 X:149937221-149937243 GAAGTGGCCAGGCCCTGTGGGGG - Intronic
1200372190 X:155739179-155739201 GAAGTAGTCTGGCCATGATCCGG - Intergenic
1200418139 Y:2935004-2935026 GGGGTGGCCTGGCCCGGTGCGGG + Intergenic
1202036768 Y:20644346-20644368 GAAGTGGCTTGGCCAAGAGAAGG + Intergenic
1202173797 Y:22079187-22079209 GAAGTGCCTGGGGCCTGAGCAGG + Intronic
1202217564 Y:22507195-22507217 GAAGTGCCTGGGGCCTGAGCAGG - Intronic
1202325621 Y:23688864-23688886 GAAGTGCCTGGGGCCTGAGCAGG + Intergenic
1202545150 Y:25981190-25981212 GAAGTGCCTGGGGCCTGAGCAGG - Intergenic