ID: 1190341890

View in Genome Browser
Species Human (GRCh38)
Location X:49303618-49303640
Sequence GTGGACATGCGCACTGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 12, 2: 6, 3: 14, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190341890_1190341899 24 Left 1190341890 X:49303618-49303640 CCCGCCTCAGTGCGCATGTCCAC 0: 1
1: 12
2: 6
3: 14
4: 153
Right 1190341899 X:49303665-49303687 TACCCACGTGGAGAACGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 53
1190341890_1190341896 12 Left 1190341890 X:49303618-49303640 CCCGCCTCAGTGCGCATGTCCAC 0: 1
1: 12
2: 6
3: 14
4: 153
Right 1190341896 X:49303653-49303675 GCTCAGCCGCTTTACCCACGTGG 0: 1
1: 0
2: 0
3: 5
4: 48
1190341890_1190341898 23 Left 1190341890 X:49303618-49303640 CCCGCCTCAGTGCGCATGTCCAC 0: 1
1: 12
2: 6
3: 14
4: 153
Right 1190341898 X:49303664-49303686 TTACCCACGTGGAGAACGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190341890 Original CRISPR GTGGACATGCGCACTGAGGC GGG (reversed) Intergenic
900482072 1:2904267-2904289 GTGGAGATGCAGACAGAGGCAGG + Intergenic
900600430 1:3500438-3500460 ACGCACATGCGCACTGCGGCTGG - Intronic
901207602 1:7505808-7505830 GTGACCATGAGCACTGGGGCCGG - Intronic
901731545 1:11283893-11283915 GTGGAGCTGCCCACTGAGGGAGG - Intronic
901876592 1:12170151-12170173 GTGGCCAGGCACCCTGAGGCAGG + Intronic
903169309 1:21542241-21542263 GTGGGCATGAGGAATGAGGCAGG - Intronic
904810664 1:33161547-33161569 GTGGGCATGCGCAGCGAGGCTGG - Intronic
905311352 1:37051330-37051352 CTGCACATGCCCACAGAGGCAGG - Intergenic
905650952 1:39656692-39656714 GTGGACCTGTGCACTGGGGACGG - Intergenic
905878979 1:41451223-41451245 GTGGAAATGTGGAGTGAGGCTGG - Intergenic
915053591 1:153103608-153103630 GTGAACATCCCCACAGAGGCAGG + Intronic
923033080 1:230265196-230265218 GTGGTCATGTGCAGTGAAGCAGG + Intronic
1067787699 10:49262653-49262675 TTGGACATTCACACTGAGGATGG + Intergenic
1069713101 10:70502768-70502790 GTGGGCATGGGCACTGGGGACGG - Intronic
1071832890 10:89389927-89389949 GTAGACCTGCGCCCTGAGCCGGG - Intronic
1074211040 10:111335324-111335346 GTGGAAATGAGAACGGAGGCTGG + Intergenic
1077333890 11:1994867-1994889 GGGGGCCTGCGCTCTGAGGCAGG - Intergenic
1077416270 11:2425723-2425745 GTGGACATGTGCCCTGCAGCTGG + Intergenic
1078066888 11:8084562-8084584 GAGGACAAGGGCACTGAGGACGG - Intronic
1082817681 11:57520386-57520408 ATGGACAAGAGCACTGAGACAGG + Intergenic
1083300786 11:61738755-61738777 GTGGCCAGGCACACTGAGGCAGG + Intronic
1083670446 11:64297130-64297152 GTGGCCCTGCGCACAGATGCCGG + Exonic
1084191503 11:67501351-67501373 GATGACCTGGGCACTGAGGCAGG + Intronic
1084731342 11:71075611-71075633 GTGGAGCTGGGCACTGAGGATGG - Intronic
1085384296 11:76148230-76148252 GTGGAAATACACAGTGAGGCTGG - Intergenic
1087006942 11:93480313-93480335 CTGGACATGGGCACTGGAGCAGG + Intronic
1089496724 11:118911824-118911846 GGGGACCTGGGCACTGTGGCTGG - Intronic
1089860715 11:121587973-121587995 GAGGCCATGAGCACTGCGGCTGG - Intronic
1202816873 11_KI270721v1_random:50049-50071 GGGGGCCTGCGCTCTGAGGCAGG - Intergenic
1091409975 12:232963-232985 GGCGACAGGCACACTGAGGCTGG - Intronic
1099163574 12:79274822-79274844 GTGAACATGCTCACTGTAGCTGG + Intronic
1103669711 12:122603386-122603408 GTGGGCATGGGCAGGGAGGCAGG + Intronic
1103790656 12:123468389-123468411 GAAAACATGCACACTGAGGCTGG + Intronic
1103960137 12:124604213-124604235 GGGGCCATGGGCCCTGAGGCAGG + Intergenic
1107805538 13:44150423-44150445 GTAGACATGAGCACTGTGGATGG - Intronic
1119030652 14:71189529-71189551 GTGGACATGGGCTCAGGGGCTGG + Intergenic
1119577084 14:75734496-75734518 GTGGAGATGCGCAGTCAGGTGGG + Intronic
1121682264 14:95803489-95803511 CTGGAAATGCTCAGTGAGGCTGG + Intergenic
1122784086 14:104155921-104155943 CTGGACAGGGGCACCGAGGCTGG - Intronic
1122817001 14:104318873-104318895 GTGGGGAGGCGCCCTGAGGCCGG - Intergenic
1122952140 14:105050897-105050919 GGGGACATGGGCACTGTGGCTGG + Exonic
1128356433 15:66930733-66930755 GTGGACTTGACCACTGCGGCTGG - Intergenic
1129221443 15:74133931-74133953 GTGGACTTGCGCTCAGAGGTCGG - Exonic
1129399170 15:75269775-75269797 GTGGGCATGGGCACTGGTGCAGG + Intronic
1129402777 15:75294051-75294073 GTGGGCATGGGCACTGGTGCAGG + Intronic
1130102822 15:80906704-80906726 GTGGACATGCGGGCGGAGGTTGG + Exonic
1132255583 15:100373536-100373558 GCGGAGAGGCGCCCTGAGGCCGG - Intergenic
1133346753 16:5076213-5076235 CTGGACATGCACACGGAGGCTGG - Intronic
1136291122 16:29272034-29272056 CTGGAGATGAGCCCTGAGGCTGG + Intergenic
1137066640 16:35853115-35853137 GTAGCCATCAGCACTGAGGCAGG - Intergenic
1139393542 16:66621820-66621842 GTGGACCTGGGCAGTGACGCCGG + Intronic
1139481718 16:67234368-67234390 GGGGCCATGCCCAATGAGGCGGG - Exonic
1141463892 16:84194619-84194641 GGGGACAAGAGGACTGAGGCTGG + Intronic
1142096986 16:88245495-88245517 CTGGAGATGAGCCCTGAGGCTGG + Intergenic
1142888945 17:2930398-2930420 GGGCACCTGAGCACTGAGGCTGG - Intronic
1143952299 17:10643131-10643153 GAGGAGATGCGGTCTGAGGCAGG - Intronic
1144731679 17:17529679-17529701 TTGAGCATGAGCACTGAGGCTGG - Intronic
1147453570 17:40520860-40520882 GTGGAGGTGGGCACTGAGGGAGG + Intergenic
1151417801 17:73977877-73977899 GTGGCCATGCGCACTCATTCAGG - Intergenic
1152563316 17:81089394-81089416 GTGGACCACAGCACTGAGGCAGG - Intronic
1152569479 17:81115420-81115442 GCGGACATCACCACTGAGGCTGG - Intronic
1154067902 18:11126372-11126394 GTGGCCATGGGCGCTCAGGCTGG - Intronic
1155030261 18:21978118-21978140 GTGCTCATGAGCACTGTGGCTGG + Intergenic
1155362318 18:25015795-25015817 CAGGACAAGCCCACTGAGGCTGG - Intergenic
1157278947 18:46333608-46333630 GGGGACGTGCGCTCGGAGGCTGG - Intronic
1161719816 19:5896523-5896545 GCGGACATGGGCGCTGATGCAGG + Exonic
1161736939 19:5997216-5997238 GGGGACAAGCGGACAGAGGCTGG + Intronic
1163116430 19:15191681-15191703 GTGGACATGCGCCAGGTGGCTGG - Intronic
1166075396 19:40411179-40411201 GTGGCTCTGCGCACTGGGGCAGG + Intronic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
1167665003 19:50818703-50818725 GTGGACATCGGAGCTGAGGCCGG - Intergenic
926782631 2:16488272-16488294 GTGGAGGTCCGCACTGAGGAAGG + Intergenic
931889987 2:66661424-66661446 GTGAACACCCGCACAGAGGCAGG - Intergenic
933439690 2:82297056-82297078 GTGGACGTGGGCCCTGTGGCAGG - Intergenic
938218944 2:129549049-129549071 GTGGACAGCCTCACTGCGGCTGG - Intergenic
938995492 2:136673554-136673576 GTGGATATGTGCAGTGAGGGGGG + Intergenic
940873524 2:158879931-158879953 GTGGACATCCACAGTGATGCGGG - Intergenic
941072378 2:160969487-160969509 ATGGACATGGGAACAGAGGCGGG - Intergenic
942405250 2:175646902-175646924 GTGCACATGCACACTCATGCTGG - Intergenic
945058002 2:205884874-205884896 GTGGACCTGGGCAGTGAGTCCGG - Intergenic
948447725 2:238046144-238046166 GTGAACAGGGTCACTGAGGCTGG - Intronic
1172356952 20:34286975-34286997 GAGGACTGGGGCACTGAGGCTGG - Intronic
1174070268 20:47894764-47894786 GTGGAGCTGCAGACTGAGGCAGG + Intergenic
1174086202 20:48009535-48009557 GTGGTCATCCGCATTGAAGCAGG + Intergenic
1174369622 20:50077814-50077836 GTGGAAAGGGGCACAGAGGCAGG + Intergenic
1175274404 20:57758166-57758188 GTGGTCAGGAGCACTGGGGCTGG - Intergenic
1175584433 20:60126810-60126832 GTGGCCATCCACACTGAGGGGGG - Intergenic
1176879486 21:14173749-14173771 CTGGGCATGTACACTGAGGCTGG + Intronic
1178104314 21:29300504-29300526 GTGGCCAATAGCACTGAGGCGGG + Intronic
1180233644 21:46443357-46443379 GTGGGCATGAGCACTGCGCCTGG + Intronic
1180712949 22:17852268-17852290 GTAGTCATGGGCACTGCGGCAGG - Intronic
1181058098 22:20269225-20269247 GTGGACCTGGGCTCTGAGGGGGG - Intronic
1183045020 22:35212580-35212602 GTGCACATGCACACTCAAGCAGG - Intergenic
1183091392 22:35524663-35524685 GTGGCCATGAAGACTGAGGCTGG + Intergenic
1183118778 22:35713470-35713492 GGGGAGAAGAGCACTGAGGCTGG - Intergenic
1183966236 22:41444636-41444658 ATGCACATGCGCGCTGAGGCGGG + Intronic
949935033 3:9109928-9109950 GTGAACATGGAGACTGAGGCAGG + Intronic
953435316 3:42873046-42873068 GGAGACATGGGCACTGAGGAGGG + Exonic
953949739 3:47179843-47179865 TTGAAGATGCCCACTGAGGCAGG - Intergenic
956621574 3:71226425-71226447 GTGGAGTTGAGCAGTGAGGCTGG - Intronic
961212817 3:125139328-125139350 TTGACCAAGCGCACTGAGGCAGG + Intronic
963835582 3:150055209-150055231 CAGGATATGCTCACTGAGGCTGG + Intergenic
966933729 3:184691999-184692021 GTGGGCACACTCACTGAGGCAGG + Intergenic
967462000 3:189758427-189758449 GTCGACATGTGCACTAAGGAGGG - Intronic
968526204 4:1058819-1058841 GTGGGCATGCGGACTGTGCCTGG + Intronic
969526251 4:7705617-7705639 GTGGCCATGTGCTCTGTGGCAGG + Intronic
970616704 4:17774443-17774465 GTGGACACGGGCCCAGAGGCAGG + Intronic
971208694 4:24594783-24594805 GTGGGTGTGAGCACTGAGGCAGG + Intergenic
975511106 4:75194342-75194364 GTGAACATCTGCACAGAGGCTGG + Intergenic
976934078 4:90606868-90606890 GTTGGCATTCACACTGAGGCTGG + Intronic
978197833 4:105991204-105991226 GTGGACATCCCCAGTGAGTCAGG + Intronic
979915079 4:126421205-126421227 GTGGACACTCACAGTGAGGCAGG + Intergenic
980113713 4:128659044-128659066 GTGGTAGTGAGCACTGAGGCAGG + Intergenic
981212331 4:142122474-142122496 GTGGACATTTGCTGTGAGGCTGG + Intronic
984554618 4:181198987-181199009 TTTGACATGCTCACAGAGGCAGG + Intergenic
984833498 4:183998350-183998372 TAGGACAGGGGCACTGAGGCCGG - Intronic
985396906 4:189553809-189553831 GTGGACAGGTGCGCTGCGGCTGG - Intergenic
985396917 4:189553863-189553885 GTGGACAGGTGCGCTGCGGCCGG - Intergenic
985625130 5:981866-981888 CTGGACAGGTGGACTGAGGCAGG - Intergenic
985625153 5:981940-981962 CTGGACAGGTGGACTGAGGCAGG - Intergenic
985625174 5:982014-982036 CTGGACAGGTGGACTGAGGCAGG - Intergenic
985625195 5:982088-982110 CTGGACAGGTGGACTGAGGCAGG - Intergenic
985625214 5:982162-982184 CTGGACAGGTGGACTGAGGCAGG - Intergenic
985625233 5:982236-982258 CTGGACAGGTGGACTGAGGCAGG - Intergenic
985625253 5:982310-982332 CTGGACAGGTGGACTGAGGCAGG - Intergenic
987075440 5:14377851-14377873 GTAGACATGCTCACTGAGACAGG + Intronic
991946854 5:71906478-71906500 CTGGAGATGGGCAGTGAGGCTGG + Intergenic
1000310508 5:160039147-160039169 GTGGCCAGGGGCACTGAGTCAGG - Intronic
1000821511 5:165990297-165990319 GTCTACATGCACACTGAGGAAGG + Intergenic
1002596468 5:180327223-180327245 GTGGAGAGGCGGACAGAGGCCGG - Intronic
1003393408 6:5732594-5732616 GTGGACATTCTCAATGAGGAGGG + Intronic
1004285042 6:14313837-14313859 GTGGTCAGGCGGCCTGAGGCTGG + Intergenic
1008332304 6:50259843-50259865 GTGAACATCCACACAGAGGCAGG - Intergenic
1011150200 6:84263764-84263786 GTGGACATGCGCCTTTAGACAGG + Intergenic
1018469668 6:164084235-164084257 GAGGACATGGACTCTGAGGCGGG - Intergenic
1019490720 7:1311978-1312000 GTGGCCATGCGCTCTGGGGCCGG - Intergenic
1020643093 7:10779996-10780018 GGGCACATGCGCAGTGAGGTCGG + Intergenic
1032193814 7:129778925-129778947 GGGGGCAGGGGCACTGAGGCCGG - Intergenic
1033426595 7:141250425-141250447 GTGGAAATGAGCACTGATGCTGG - Intronic
1036687623 8:10922439-10922461 GTGGAAGTGAGCACTGAGCCTGG - Intronic
1037221448 8:16527589-16527611 GTGCTCATGCGCAGTGAGGCAGG + Intronic
1042866900 8:73364589-73364611 GTGGTCATTCTCACTGAGGTTGG + Intergenic
1047209376 8:122828650-122828672 GTGGCCATGGGCACTGAGAAGGG + Intronic
1047743057 8:127822648-127822670 GGGGGCATTCCCACTGAGGCAGG + Intergenic
1048366798 8:133745449-133745471 GTGGAAAGGGGCACAGAGGCAGG - Intergenic
1050248039 9:3712889-3712911 GTGGAAAGGGGCACTGAGGAGGG + Intergenic
1052861051 9:33438048-33438070 GTGCACACACACACTGAGGCAGG + Intergenic
1053878619 9:42568665-42568687 CTGCACATGCTCAGTGAGGCCGG + Intergenic
1053894047 9:42725713-42725735 CTGCACATGCTCAGTGAGGCCGG - Intergenic
1054233071 9:62533030-62533052 CTGCACATGCTCAGTGAGGCCGG - Intergenic
1055036145 9:71820646-71820668 GTACACATGGGCACTGAGACAGG - Intergenic
1057919627 9:99086353-99086375 GTGGAGAAGTGTACTGAGGCAGG + Intergenic
1060965989 9:127712619-127712641 GTGGAAATGGGCACTGAGGTTGG + Intronic
1061496226 9:130976120-130976142 GTGGACCTGCACACCCAGGCAGG - Intergenic
1062203352 9:135321054-135321076 GGGGCCATGCTCACTGGGGCAGG - Intergenic
1062573127 9:137194609-137194631 GTGCACATGGGCCCTGAGCCTGG + Intronic
1189659182 X:43278850-43278872 CTGGACCTGCTCACTCAGGCGGG - Intergenic
1189678378 X:43487365-43487387 GTGAACACCTGCACTGAGGCTGG + Intergenic
1190341890 X:49303618-49303640 GTGGACATGCGCACTGAGGCGGG - Intergenic
1190344107 X:49322009-49322031 GTGAACATGCGCACTGAGGCGGG - Intergenic
1190345201 X:49331554-49331576 GTGAACATGCGCACTGAGGCGGG - Intergenic
1190346295 X:49341120-49341142 GTGAACATGCGCACTGAGGCGGG - Intergenic
1190347547 X:49532149-49532171 GTGAACATGCGCACTGAGGCGGG - Intergenic
1190348648 X:49541705-49541727 GTGAACATGCGCACTGAGGCGGG - Intergenic
1190349749 X:49551261-49551283 GTGAACATGCGCACTGAGGCGGG - Exonic
1190350853 X:49560814-49560836 GTGAACATGCGCACTGAGGCGGG - Intronic
1190351954 X:49570372-49570394 GTGAACATGCGCACTGAGGCGGG - Intergenic
1190353055 X:49579921-49579943 GTGAACATGCGCACTGAGGCGGG - Intergenic
1190354156 X:49589468-49589490 GTGAACATGCGCACTGAGGCGGG - Intergenic
1190355258 X:49598992-49599014 GTGAACATGCGCACTGAGGCGGG - Intronic
1190379952 X:49829660-49829682 GTGAACACGAGCACTGAGGCAGG - Intronic
1190619330 X:52269639-52269661 GCAAACATGTGCACTGAGGCCGG - Intergenic
1190629265 X:52369042-52369064 GTGAACATGCACACTGAGGCAGG - Exonic
1190642703 X:52495775-52495797 GTGAACATGCGCACTGAGGTGGG - Exonic
1190644970 X:52517092-52517114 GTGAACATGCGCACTGAGGTGGG + Exonic
1190648293 X:52543830-52543852 GTGAACCTGTGCACTGAGGCGGG - Intergenic
1190650363 X:52563260-52563282 GTGAACATGCGCACTGAGGCAGG + Intergenic
1190652756 X:52582958-52582980 GTGAACATGTGCACTGAGGTGGG - Intergenic
1190681454 X:52830262-52830284 GTGAACATGTGCACTGAGGTGGG + Intergenic
1190685339 X:52868120-52868142 GTGGACATGCGCAGTGAGGTCGG + Intergenic
1190998544 X:55636302-55636324 GTGAACATGCGCACTGAGGTGGG + Intergenic
1191000777 X:55658004-55658026 GTGGACATGCGCAGTGAGGTCGG + Intergenic
1194217404 X:91148035-91148057 GTGAACATGTGCATGGAGGCTGG - Intergenic
1195761526 X:108251115-108251137 TTCCACATGCGGACTGAGGCAGG + Intronic
1195881054 X:109593051-109593073 GTGGACATGCTCACTAAGTGAGG - Intergenic
1200553918 Y:4611827-4611849 GTGAACATGTGCATGGAGGCTGG - Intergenic