ID: 1190362970

View in Genome Browser
Species Human (GRCh38)
Location X:49666571-49666593
Sequence CCTTTTAAGTGTAAGATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 1, 2: 3, 3: 32, 4: 255}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190362970_1190362975 15 Left 1190362970 X:49666571-49666593 CCACAGATCTTACACTTAAAAGG 0: 1
1: 1
2: 3
3: 32
4: 255
Right 1190362975 X:49666609-49666631 TGTCCAATAGTGCATTTACAAGG 0: 1
1: 0
2: 0
3: 11
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190362970 Original CRISPR CCTTTTAAGTGTAAGATCTG TGG (reversed) Intergenic
901150481 1:7097955-7097977 ATTTTTAAGTGTAAGTTCAGTGG - Intronic
902365934 1:15974472-15974494 CCATTTAAGAATCAGATCTGTGG - Intronic
905099914 1:35510920-35510942 CCTTTTAAATGTAAGGAATGTGG + Intronic
906229749 1:44151746-44151768 CCTTATAAATGTAAGAAATGTGG - Intergenic
907233401 1:53022016-53022038 CATTTTAAGTGTACGTTCAGTGG + Intronic
908154335 1:61337005-61337027 CCTTTTAAATGTAAGAGAGGAGG + Intronic
908905845 1:69007827-69007849 CTCTTTAAGAGTATGATCTGTGG - Intergenic
908959384 1:69676998-69677020 ACTTTTAAGTGTAAGAACTAAGG - Intronic
909210454 1:72816449-72816471 CCTTTTTGGTTTAATATCTGCGG - Intergenic
912390278 1:109297904-109297926 CCTTCTAACTGCAAGCTCTGAGG + Intronic
914389711 1:147208936-147208958 CATTTTATATGGAAGATCTGTGG - Exonic
916949767 1:169767738-169767760 ACTTTTAAGTGAAGGATCAGTGG + Intronic
919416791 1:197320521-197320543 CCTTATAAGTGAAAGATCAAGGG + Intronic
921587208 1:216961918-216961940 CCTTTAAAGTGAATAATCTGTGG - Intronic
922984302 1:229854016-229854038 CCTATTAAGAGGAAGACCTGGGG + Intergenic
924737470 1:246771106-246771128 CCTTTTCAGTGTAGAGTCTGCGG - Intergenic
1064837510 10:19550347-19550369 CTTTTTAATTGTAAGTTCAGGGG + Intronic
1066462641 10:35625051-35625073 CCTTGTGAGTGTATGATCAGAGG + Intergenic
1066754628 10:38698594-38698616 CCTTTTAAGGGTAGGGTCTGTGG - Intergenic
1067136857 10:43616848-43616870 CCTTTTAAATGTAACAAGTGTGG + Exonic
1067334750 10:45351490-45351512 CCTTTGAAGTGTTAGATTTAGGG - Intergenic
1068748727 10:60566340-60566362 GCTTTAAAGTGGAAGATGTGTGG - Intronic
1069847145 10:71380173-71380195 CCTCTTAAGTGTAAAAGCCGTGG - Intergenic
1070438431 10:76416375-76416397 CATTATAAGTGATAGATCTGAGG - Intronic
1070472571 10:76797787-76797809 CGTGTTAAGTCTAACATCTGGGG + Intergenic
1072166037 10:92813969-92813991 CCTTTTAAGAGTAATTTCAGTGG - Intergenic
1072497762 10:95979499-95979521 CATTTTAAGCCAAAGATCTGGGG - Intronic
1072519898 10:96222197-96222219 CCTTCTAGGTGTATGATTTGGGG - Intronic
1072681475 10:97510273-97510295 CCTTTGATTTGTAAAATCTGAGG + Intronic
1074182162 10:111075238-111075260 CCTTTCCAGTGTTAGTTCTGAGG - Intergenic
1075415469 10:122259197-122259219 CCCCTTGGGTGTAAGATCTGAGG + Intergenic
1075502865 10:122993847-122993869 CCTTTTCAGTGTAATATATGTGG - Exonic
1078006217 11:7534555-7534577 CCCTTGAAGGGTAAGTTCTGGGG + Intronic
1079557185 11:21774166-21774188 CCTGTTCAGTGTAAGATTAGTGG + Intergenic
1079639359 11:22784862-22784884 GCTTTTAACTATAAGATCTGAGG + Intronic
1080111946 11:28578004-28578026 ACTTTAAAGTGTAATATCAGTGG + Intergenic
1080586163 11:33684843-33684865 CCTTTAAAGTGTAATAACAGTGG - Intergenic
1082850702 11:57761854-57761876 CATTTTAGGTGTTGGATCTGAGG + Exonic
1085662858 11:78385296-78385318 CCTTTTAAATGTCAGGACTGTGG + Intronic
1085821643 11:79800197-79800219 GCTTTTAATTGAAAGCTCTGAGG + Intergenic
1086015838 11:82166559-82166581 CTTTTTACCTGTAAGTTCTGAGG + Intergenic
1086330757 11:85751724-85751746 CTTGTTAAGTGTCAGATGTGTGG - Intronic
1087019476 11:93588057-93588079 CCTTTTAAGTGACAAATATGTGG + Intergenic
1088554170 11:111044883-111044905 CCTTTTCATTGTATCATCTGTGG + Intergenic
1088614991 11:111617114-111617136 CATTTTAAGTGTAAGCCATGGGG + Intronic
1089039560 11:115433737-115433759 CTTTTAAAGTGGAAGAGCTGAGG + Intronic
1089796454 11:120985147-120985169 CTTTTTAGGTGTCAGAACTGTGG - Intronic
1090028175 11:123185343-123185365 CTTGTTAAGTGCCAGATCTGAGG + Intronic
1090822037 11:130351359-130351381 ATTTTTAAGTGTAAGTTCAGTGG + Intergenic
1092749333 12:11703813-11703835 CCTTTCAATTTTAAGATTTGAGG + Intronic
1094670120 12:32562125-32562147 CCTTTTTAGTGTTGGGTCTGTGG - Intronic
1095407012 12:41878025-41878047 TGTTTTAAGTATAAGATTTGTGG - Intergenic
1097023236 12:56035242-56035264 CCTTTTGAGTGCAACATCTGTGG + Exonic
1098202481 12:68070503-68070525 CCTTTTAAGTGTAAATACTTAGG - Intergenic
1100769062 12:97901169-97901191 GCTTGTAAGTGTCAGAGCTGGGG - Intergenic
1101142471 12:101810650-101810672 CCTTTAAAATGTAGGCTCTGTGG - Intronic
1102269416 12:111519685-111519707 GCTTTTGAGAGTAAGCTCTGTGG - Intronic
1105061571 12:133156540-133156562 CCTTTTGAGTGTAAGGATTGTGG + Exonic
1107132361 13:36910476-36910498 GCTTTTAAGTGTAAAATGTATGG - Intronic
1107230448 13:38103925-38103947 CCCTTTCAGGGTAGGATCTGTGG - Intergenic
1108020122 13:46119828-46119850 ACTTTTAAGTGTTAAATCTGAGG - Intergenic
1108110463 13:47065897-47065919 CATGTTAAATGAAAGATCTGTGG + Intergenic
1108326880 13:49341891-49341913 TGTTTTAAGTGTAAAATGTGAGG - Intronic
1108405482 13:50096566-50096588 CCTTTTAATTCTGAGAACTGGGG - Intronic
1109044621 13:57393411-57393433 AGTCTTTAGTGTAAGATCTGGGG - Intergenic
1109998078 13:70155732-70155754 CCTCTTCAGTTTAGGATCTGAGG + Intergenic
1115187351 14:30705128-30705150 GCAATTAAGTGTAAAATCTGTGG + Intronic
1117430049 14:55648198-55648220 ACTATTAAGTTTAAGATCTATGG - Intronic
1117748906 14:58900468-58900490 CTTTTTAAGTGGTAGAACTGAGG + Intergenic
1118578314 14:67267177-67267199 CATTTTAAGTGTATAATTTGAGG + Intronic
1119127074 14:72137426-72137448 CCCTTTACCTGTGAGATCTGAGG - Intronic
1122245478 14:100400175-100400197 CTTTTTAAGTGACAGAGCTGGGG + Intronic
1123502381 15:20901221-20901243 CCTATCAAGTGTAAGGACTGTGG - Intergenic
1123595867 15:21912202-21912224 CCTATCAAGTGTAAGGACTGTGG - Intergenic
1126827377 15:52565654-52565676 CCTTTTAAGAGTAAACTATGAGG - Intronic
1126930081 15:53638092-53638114 CCTTTTAACTGTAAGGAATGAGG + Intronic
1129153162 15:73701999-73702021 CCATTAAAATGTAAGTTCTGTGG + Intronic
1129938343 15:79470484-79470506 CCTGTTAAATGGAAGATTTGGGG - Exonic
1131196678 15:90360951-90360973 CCTTTTAAGTGCGAAAACTGTGG + Exonic
1202967976 15_KI270727v1_random:202065-202087 CCTATCAAGTGTAAGGACTGTGG - Intergenic
1134676892 16:16097075-16097097 CCTTTGGAATTTAAGATCTGAGG + Intronic
1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG + Intergenic
1136014827 16:27389607-27389629 AATTTTAAGTGTAAGTTCAGTGG - Intergenic
1136728057 16:32378253-32378275 CCTTTTAAGGGTAGGGTCTGTGG + Intergenic
1137786231 16:51140003-51140025 CCCTTTAAGTGTAAGATCTGTGG - Exonic
1137786379 16:51140774-51140796 CCATTCAAGTGCAACATCTGCGG - Exonic
1139162607 16:64529105-64529127 CCTATTAACTGTGAGATCTGGGG + Intergenic
1140047251 16:71449252-71449274 CCCTATCAGTGTAAGATGTGTGG - Exonic
1140287878 16:73621779-73621801 CATTTTTAATGGAAGATCTGGGG - Intergenic
1140641920 16:76984822-76984844 CCTCTTAAGTTTAATAACTGAGG - Intergenic
1140794553 16:78424947-78424969 CCTTTCAAGTGAATCATCTGGGG + Exonic
1202998382 16_KI270728v1_random:139501-139523 CCTTTTAAGGGTAGGGTCTGTGG - Intergenic
1203129975 16_KI270728v1_random:1675905-1675927 CCTTTTAAGGGTAGGGTCTGTGG - Intergenic
1147342934 17:39765863-39765885 CCTTTCGAGTGTAACATGTGTGG - Exonic
1150649922 17:67003286-67003308 CCTATTAGCTGTATGATCTGGGG - Intronic
1153421278 18:4908163-4908185 ATTTTTAAGTGACAGATCTGGGG + Intergenic
1154217877 18:12428847-12428869 CCTTTTATGTGAAAAATTTGGGG + Intronic
1154404771 18:14079616-14079638 CCTCTGAAGTCAAAGATCTGTGG - Intronic
1154407276 18:14105311-14105333 CCTTTCAAGTGTAAGGAATGTGG - Exonic
1154407299 18:14105563-14105585 CCTTTCAAGTGTAAGGAATGTGG - Exonic
1155573644 18:27222141-27222163 TCTTTTAAGTGGAACATTTGGGG + Intergenic
1155645209 18:28069578-28069600 TCTTTTATTTTTAAGATCTGAGG - Intronic
1158101466 18:53834487-53834509 CCTTTTAAAAATAAGTTCTGGGG - Intergenic
1158895145 18:61905841-61905863 ACTTTTAAGTGTCAGTTCAGTGG + Intergenic
1159006657 18:63019500-63019522 CCTTTTAACTGTGAGATAGGAGG - Intergenic
1160454920 18:78993330-78993352 CCCTTCAAGTGCAACATCTGCGG + Exonic
1160455097 18:78994107-78994129 CCGTTCAAGTGCAAGATCTGCGG + Exonic
1160616299 18:80132184-80132206 CCCTTTAAGTATGAAATCTGAGG - Intronic
1162247456 19:9413936-9413958 CCCTTTGAATGTAAGATATGTGG - Exonic
1162253529 19:9467802-9467824 CCTTATAAATGTAAGCACTGTGG - Exonic
1162284402 19:9727419-9727441 CCTTTCAATGGGAAGATCTGGGG - Intergenic
1162594549 19:11617503-11617525 CCTTATAAATGTAAGGTGTGTGG + Exonic
1162598919 19:11652044-11652066 CCTTATAAATGTAAGTTTTGTGG + Intergenic
1162603122 19:11685251-11685273 CCTTATAAATGTAAGTTTTGTGG + Intergenic
1162607623 19:11722941-11722963 CCTTATAAATGTAAGTTGTGTGG - Exonic
1162611403 19:11757351-11757373 CCTCATAAATGTAAGATATGTGG - Intergenic
1162613972 19:11780743-11780765 CCTCATAAATGTAAGATATGTGG + Exonic
1162614020 19:11781328-11781350 CCTCATAAATGTAAGATATGTGG + Exonic
1162614044 19:11781580-11781602 CCTCATAAATGTAAGATATGTGG + Exonic
1162616614 19:11806341-11806363 CCTTATAAATGTAAGTTTTGTGG + Exonic
1162616655 19:11806761-11806783 CCTCATAAATGTAAGATATGTGG + Exonic
1162619681 19:11831771-11831793 CCTTATAAATGTAAGTTTTGTGG + Exonic
1162619717 19:11832191-11832213 CCTTATGAATGTAAGATATGTGG + Exonic
1162619748 19:11832545-11832567 CGTTATAAATGTAAGATATGTGG + Exonic
1162619793 19:11832982-11833004 CCTTATAAATGTAAGATATGTGG + Exonic
1162623914 19:11867706-11867728 CCTTATAAATGTAAGTTTTGTGG + Exonic
1162628450 19:11905472-11905494 CCTTATGAATGTAAGATATGTGG + Intronic
1162628485 19:11905826-11905848 CCTTATAAATGTAAGCTATGTGG + Intronic
1162629067 19:11911856-11911878 CCTTATAAATGTAAGATATGTGG + Intronic
1162633691 19:11949105-11949127 CCTTATAAATGTAAGATATGTGG + Exonic
1162637183 19:11978519-11978541 CCTTATAAATGTAAGTTTTGTGG + Exonic
1162637234 19:11979102-11979124 CCTTATAAATGTTAGATATGTGG + Exonic
1162637273 19:11979454-11979476 CCTTATAAATGTAAGACATGTGG + Intergenic
1162637321 19:11979892-11979914 CCTTATAAATGTAAGATATGTGG + Intergenic
1162641793 19:12016256-12016278 CCTTATAAGTGTAAATTTTGTGG - Exonic
1162656320 19:12133572-12133594 CCTTATAAATGTAAGTTTTGTGG - Exonic
1162663193 19:12187129-12187151 CCTTATAAATGTAAGGTATGTGG + Exonic
1162663239 19:12187549-12187571 CCTTATAAATGTAAGGTATGTGG + Exonic
1162672917 19:12273227-12273249 CCTCATAAATGTAAGATATGTGG - Exonic
1162678432 19:12318997-12319019 CCTCATAAATGTAAGATATGTGG - Exonic
1162678467 19:12319417-12319439 CCTTATAAATGTAAGTTGTGTGG - Exonic
1162681860 19:12350521-12350543 CCTCATAAATGTAAGATATGTGG - Exonic
1162685546 19:12380552-12380574 CCTCATAAATGTAAGATATGTGG - Exonic
1162685578 19:12380972-12380994 CCTTATAAATGTAAGTTGTGTGG - Exonic
1162686636 19:12391370-12391392 CCTCATAAGTGTAAGATATGTGG - Exonic
1162686669 19:12391790-12391812 CCTTATAAATGTAAGTTGTGTGG - Exonic
1162690975 19:12431060-12431082 CCTCATAAATGTAAGATATGTGG - Exonic
1162691020 19:12431564-12431586 CCTTATAAATGTAAGTTGTGTGG - Exonic
1163857057 19:19711671-19711693 CCTTTTGAGTGTAAGCAATGTGG - Exonic
1165506698 19:36236330-36236352 CCTTATAAATGTAAGAGATGTGG + Exonic
1165524371 19:36341209-36341231 CCTTATAAGTGTAAGGAATGTGG - Exonic
1165543611 19:36514226-36514248 CCTTATGAGTGTAAGGTCTGTGG - Exonic
1165576060 19:36819565-36819587 CCTTTTAAATGTAAGGATTGTGG - Exonic
1165911137 19:39228683-39228705 CATTTTGAGCGTAAGATCTGAGG - Intergenic
1166609428 19:44176934-44176956 CCTTTTAAGTGTGAGGAGTGTGG + Exonic
1166609491 19:44177522-44177544 CCTTATAAATGTGAGATATGTGG + Exonic
1168199880 19:54806685-54806707 ATTTTTAAGTGTAAAATCTAGGG + Intronic
1168460693 19:56554547-56554569 CCTTTTAAGTGTAAAGAGTGCGG + Exonic
1168698088 19:58417239-58417261 CCTTTTAAGTGTAGTGACTGTGG + Exonic
925674185 2:6342847-6342869 CCTTTAAAGTTTTAGATCTGTGG - Intergenic
926555186 2:14349404-14349426 CCTTTGAATTGTTGGATCTGGGG - Intergenic
926955214 2:18287388-18287410 CTTTATAATTGTAATATCTGAGG + Intronic
927406449 2:22775029-22775051 CCTTTGAAATGTGAGATTTGGGG + Intergenic
932388917 2:71367056-71367078 CCTTCTAAATGTAAGTTCTTTGG - Intronic
939634266 2:144561972-144561994 CCTTTTTAATGTAAGATCCCAGG - Intergenic
940280181 2:151980494-151980516 TCTTTTAAATGTGAGTTCTGTGG + Intronic
940997169 2:160162168-160162190 ATTTTTAAGTGTTAGTTCTGTGG - Intronic
943757182 2:191569012-191569034 CCTTTAAAGTGGACCATCTGTGG + Intergenic
947517567 2:230820675-230820697 CCTTTTAGGTGGAAGAAGTGAGG + Exonic
948681650 2:239639211-239639233 TCTTTTAAGTGTACGGTGTGTGG - Intergenic
1169289238 20:4334529-4334551 GTTTTTAAGTGTAAGTTCAGTGG - Intergenic
1170283027 20:14672741-14672763 CCTTTTAATTACCAGATCTGTGG + Intronic
1170675464 20:18476120-18476142 CTTTTAAAGTGTAAAATCTTTGG + Intronic
1170800957 20:19590022-19590044 AGTTTTGAGTGTAGGATCTGGGG + Intronic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1177849551 21:26330243-26330265 TCTTTTTGGTGTAAGATCTCAGG - Intergenic
1180013381 21:45065928-45065950 ACTAATAAGTGTGAGATCTGTGG - Intergenic
1180306089 22:11126504-11126526 CCTTTTAAGGGTAGGGTCTGTGG - Intergenic
1180544608 22:16488687-16488709 CCTTTTAAGGGTAGGGTCTGTGG - Intergenic
949452174 3:4197922-4197944 CCTGTTCATTGTAAGATCAGAGG - Intronic
950210344 3:11118415-11118437 CCTGTTAAGTGACAGAGCTGGGG - Intergenic
952176958 3:30874477-30874499 CCATTTATGTGTAAGATTTTGGG + Intronic
952473943 3:33685960-33685982 ATTTTTAAGTGTAAGTTCAGTGG - Intronic
953173951 3:40532302-40532324 CCCTTTAAGTGTAAGGAGTGTGG + Exonic
953633610 3:44642487-44642509 CCTTATAAGTGTAAGGAGTGTGG + Exonic
953643831 3:44734902-44734924 CCTTTTAAGTGTAATGAATGTGG + Exonic
953824906 3:46242880-46242902 GCTATTAAGTGTAAGCTCTTTGG - Intronic
955053165 3:55431878-55431900 TCTCTTTAGTGTAAGATTTGGGG - Intergenic
955758317 3:62249831-62249853 TCTTTTAAATGTAAGCTCTAGGG + Intronic
956856125 3:73276525-73276547 ACTTTTAGGTGAAATATCTGTGG + Intergenic
960025927 3:113009296-113009318 CCTTTTGAGTGTAAGAAATTTGG - Intronic
960831125 3:121849629-121849651 CCTCATAAGTGTAGGATTTGAGG - Intronic
961587251 3:127942272-127942294 CCTTTTAAGTGTATGTGCGGTGG + Intronic
961972789 3:130988332-130988354 CCTTTTCAGTGTCACATTTGTGG - Intronic
963276731 3:143338850-143338872 GTTTTTAAGTGAAAGAGCTGGGG + Intronic
963757699 3:149252966-149252988 CGTTTTTAGTGTAGGATCAGTGG - Intergenic
964003472 3:151805120-151805142 CCTTTTAAGTGTAGGGGCTTGGG + Intergenic
964641469 3:158913979-158914001 CACTTTAAGAGTAATATCTGGGG + Intergenic
967086921 3:186103898-186103920 TCTTTTAAATGTAAGAGCAGAGG - Intronic
969041988 4:4306146-4306168 CCTTTTGAATGTAACATTTGTGG + Exonic
969583825 4:8080706-8080728 TGTTTTAAGTGCAAGAGCTGTGG - Exonic
970017395 4:11527681-11527703 CAGTTTAAGTGTAATATTTGAGG - Intergenic
970511672 4:16787705-16787727 CCTTCTAAGTGGTAGAACTGGGG - Intronic
973847247 4:54925455-54925477 ACTTTTAACTTTAATATCTGTGG + Intergenic
974135687 4:57814011-57814033 TCTTTTAAGTCTAAGAGATGAGG + Intergenic
974797642 4:66773594-66773616 CATTTTAATTTTAAGTTCTGGGG - Intergenic
976521957 4:86039087-86039109 CCTTTTAAAAGTATGATTTGAGG + Intronic
976867589 4:89749194-89749216 CATTTTAAGTGTAACAGCTAGGG + Intronic
976946954 4:90782421-90782443 CCTATTAACGATAAGATCTGAGG - Intronic
977662709 4:99609388-99609410 CCATTTAAGTTTAAAATCTTAGG + Intronic
978778107 4:112522520-112522542 CCTTTTGAATGTAAGCTCTGTGG - Intergenic
980214604 4:129835387-129835409 CCTTTTAAGTCTGAGATCTGGGG + Intergenic
981071662 4:140546819-140546841 ACATTAAAGTGTAATATCTGAGG + Intronic
981079130 4:140621617-140621639 CCTTTGAAGGGGAACATCTGTGG + Exonic
981467624 4:145092308-145092330 AATTTTAAGTTTAAGTTCTGGGG - Intronic
982968954 4:161955048-161955070 TCTTATAAGAGTAAAATCTGCGG - Intronic
984056070 4:174930587-174930609 CCTTTTAAACATAAAATCTGAGG - Intronic
986778095 5:11038051-11038073 CCCTTTAAATGTAACATCTCTGG - Intronic
989404992 5:41050489-41050511 CCTTTTAAGTGGTAGATCAGAGG - Intronic
990351039 5:54916677-54916699 ACTTTTAAGTGTATTAGCTGTGG + Intergenic
991412586 5:66359556-66359578 CATTTTATCTGTAAGCTCTGAGG - Intergenic
991730796 5:69585676-69585698 CCTGTTGAATGTAAAATCTGTGG + Exonic
991807232 5:70440838-70440860 CCTGTTGAATGTAAAATCTGTGG + Intergenic
991864154 5:71042180-71042202 CCTGTTGAGTGTAAAATCTGTGG - Exonic
992461558 5:76965492-76965514 CCTTTTGGGTGCATGATCTGAGG + Intronic
993328340 5:86568299-86568321 CCTTTTAGTGGGAAGATCTGGGG - Intergenic
993607555 5:90012359-90012381 CTTTTTAAATTTAAGATCTATGG - Intergenic
995378805 5:111509629-111509651 CCGTTTAACTGTAAAATCTTTGG + Intronic
996819329 5:127608721-127608743 CATTTTAAATGGAAGAACTGTGG + Intergenic
998786709 5:145718861-145718883 CTTGATAAGTGTAAGATGTGAGG + Intronic
1001108995 5:168879913-168879935 CCTTCTAAGTGCTAGTTCTGGGG - Intronic
1002554819 5:180028112-180028134 CCTTGTAAGTGAAGGATCTGAGG - Intronic
1002945740 6:1759374-1759396 CCTGCTAAGTGTTAGAGCTGGGG + Intronic
1003350927 6:5317230-5317252 CCTATTATGTGAAAGAACTGAGG - Intronic
1005211542 6:23470589-23470611 CCTTTTGAGGTTAAGATTTGGGG + Intergenic
1007987477 6:46221478-46221500 CCTTTTAAAAATAAAATCTGAGG - Exonic
1008257578 6:49322977-49322999 ACTTTGAAGTGGAAGGTCTGTGG - Intergenic
1008420965 6:51298696-51298718 CCTAATAAGTGGAAGAACTGGGG + Intergenic
1008803567 6:55400434-55400456 CTTTTTAAGTCTGAGATCTCTGG - Intronic
1010134158 6:72530788-72530810 ACTTGTAAGTGTCAAATCTGAGG + Intergenic
1010775125 6:79876781-79876803 CCTTTTGAGAGTAAGCTCTGAGG + Intergenic
1012231655 6:96767420-96767442 CATCTTCAGTGTTAGATCTGTGG - Intergenic
1013309165 6:108877591-108877613 CCTTTTATGTTTAAGCTCTGAGG - Intronic
1014284816 6:119485124-119485146 CCTTTTTAGTGTATAATTTGAGG + Intergenic
1014750688 6:125252712-125252734 CTTTTGAAGTGTAATTTCTGAGG + Intronic
1016403607 6:143706686-143706708 CCTTTTAAGGGTAAGATAAATGG - Intronic
1016910786 6:149196589-149196611 CATTTTAAGTGTAAGTCATGCGG + Intergenic
1016939427 6:149472219-149472241 CCTTTTAAAGGCAAGCTCTGGGG - Intronic
1018680150 6:166257873-166257895 CCTTTCAGTTGTAGGATCTGTGG + Intergenic
1018690951 6:166343519-166343541 CCTTTTAACTGAAAGATTTTAGG - Intergenic
1023333531 7:39144724-39144746 CTTTTTATGTGAAAGATCTCAGG + Intronic
1023626697 7:42121903-42121925 CCTTTTAATTTTAAGATCTGGGG - Intronic
1024531917 7:50400532-50400554 CCTTTTGAGTGCAACATGTGCGG + Exonic
1025619416 7:63154855-63154877 ACTTTTAAGAGTAAGATGGGGGG - Intergenic
1029288928 7:99486892-99486914 CCTTTTGAGTGTAAGGTCTGTGG + Exonic
1029294831 7:99531875-99531897 CCTTATCAGTGTGATATCTGTGG + Exonic
1029895286 7:103977003-103977025 GTTGTTAAGTGTAAGATCTCTGG + Intronic
1030392913 7:108949255-108949277 CCTTTCAAGTGTAATATTAGTGG - Intergenic
1030395700 7:108983735-108983757 ATTTTTAAGTGTAAGATTTTTGG + Intergenic
1032047679 7:128622917-128622939 CCTTGTATCTGTAAGGTCTGGGG + Intergenic
1032336708 7:131031413-131031435 CCTATTAAATATAAGATCTTTGG - Intergenic
1036974019 8:13389728-13389750 CCTTTTGTGTGTAAGGTCTCTGG - Intronic
1040834580 8:51718823-51718845 CTTTTAAAGTGTAAAATCAGTGG - Intronic
1041709828 8:60884313-60884335 CCTTTTGACTGAAATATCTGGGG + Intergenic
1042074565 8:64977566-64977588 CATTTGAAATGTAAGAGCTGTGG + Intergenic
1043386599 8:79755100-79755122 TATTTTAAGTTTAAGTTCTGGGG + Intergenic
1044274222 8:90281540-90281562 CCTCTTGAGAGCAAGATCTGAGG + Intergenic
1045325328 8:101113381-101113403 CCTCTTAAGTGGCAGAGCTGGGG + Intergenic
1046754749 8:117961871-117961893 CCTTTCAACTATGAGATCTGTGG - Intronic
1052161229 9:25262390-25262412 CCTTTTAAGAGGAAGGTGTGAGG + Intergenic
1055006513 9:71513269-71513291 CCTTTTAAGTGTAGGATCCAGGG + Intergenic
1055592059 9:77826911-77826933 GCTTTTGGGTGTAAGATCTTTGG + Intronic
1055909221 9:81327906-81327928 GCTTTTTATTGTAAGATTTGAGG - Intergenic
1056854603 9:90115460-90115482 CCTTTAAAGTGTATCATCAGAGG - Intergenic
1060357045 9:122918940-122918962 CCTTTCCAGTGTAAAATCTGTGG - Exonic
1061140050 9:128760512-128760534 TCTTTTAAGTGCAGGCTCTGTGG + Intronic
1203629661 Un_KI270750v1:60263-60285 CTTTTTTAATGTAAGATATGAGG + Intergenic
1187135947 X:16547552-16547574 CCTTTTAAGTTTAATTTCTATGG + Intergenic
1187827820 X:23350307-23350329 CATTTTCAGTGTATGTTCTGAGG - Intronic
1189482378 X:41402409-41402431 CTTTTTAATTTTAAGTTCTGGGG + Intergenic
1190362970 X:49666571-49666593 CCTTTTAAGTGTAAGATCTGTGG - Intergenic
1193070033 X:77297307-77297329 CCTTTCAATGGGAAGATCTGGGG + Intergenic
1194946843 X:100079025-100079047 CCTTTCAAATGTAAAATCTGTGG + Intergenic
1195349602 X:103984089-103984111 CCTTCTAGGGGAAAGATCTGGGG + Intergenic
1195357841 X:104054750-104054772 CCTTCTAGGGGAAAGATCTGGGG - Intergenic
1195967869 X:110445467-110445489 CATTTTAAGTGTCAGGGCTGTGG + Intronic
1196733867 X:118967739-118967761 ACTTTTAAGTGCATGATCAGTGG - Intergenic
1198034930 X:132792532-132792554 CATTTAAAGTGTAAAATTTGAGG + Intronic
1198296026 X:135287558-135287580 CCTTTTAAGTGTCAGGAATGTGG - Exonic
1198816049 X:140591508-140591530 CCTTTAAAGTCTAAGCTCAGGGG - Intergenic
1201185477 Y:11397865-11397887 CCTTTTAAGGGTAGGGTCTGTGG - Intergenic
1201295512 Y:12459911-12459933 TTTTTTAATTGTAAGCTCTGAGG - Intergenic