ID: 1190363053

View in Genome Browser
Species Human (GRCh38)
Location X:49667025-49667047
Sequence CTGTGGGACTGGTGGCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 273}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190363046_1190363053 1 Left 1190363046 X:49667001-49667023 CCCTGGAGTCACTTTTGACTAAA 0: 1
1: 0
2: 0
3: 19
4: 170
Right 1190363053 X:49667025-49667047 CTGTGGGACTGGTGGCAGAATGG 0: 1
1: 0
2: 3
3: 15
4: 273
1190363047_1190363053 0 Left 1190363047 X:49667002-49667024 CCTGGAGTCACTTTTGACTAAAC 0: 1
1: 0
2: 1
3: 7
4: 109
Right 1190363053 X:49667025-49667047 CTGTGGGACTGGTGGCAGAATGG 0: 1
1: 0
2: 3
3: 15
4: 273
1190363041_1190363053 29 Left 1190363041 X:49666973-49666995 CCTAGGTTTCTTGTGGCCAGCTC 0: 1
1: 0
2: 1
3: 12
4: 105
Right 1190363053 X:49667025-49667047 CTGTGGGACTGGTGGCAGAATGG 0: 1
1: 0
2: 3
3: 15
4: 273
1190363045_1190363053 13 Left 1190363045 X:49666989-49667011 CCAGCTCGGCGGCCCTGGAGTCA 0: 1
1: 0
2: 2
3: 6
4: 105
Right 1190363053 X:49667025-49667047 CTGTGGGACTGGTGGCAGAATGG 0: 1
1: 0
2: 3
3: 15
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190363053 Original CRISPR CTGTGGGACTGGTGGCAGAA TGG Intergenic
900271498 1:1791756-1791778 CTGAGGGACTGACTGCAGAAGGG + Intronic
900495247 1:2973188-2973210 CTGGGGGACTGATGGCAGCTGGG + Intergenic
900971231 1:5993305-5993327 CGGAGGGGCTGGGGGCAGAATGG - Intronic
901857061 1:12051351-12051373 CTGGGGGCCTGGAGGCAAAATGG + Intergenic
903922659 1:26811812-26811834 TTGTGGGTCTGGTGGCAACAAGG - Intergenic
904016866 1:27428491-27428513 CTGTGGGAAGGGTGGCAGGAAGG - Intronic
904347746 1:29884364-29884386 CGATGGGAGTGGGGGCAGAAGGG - Intergenic
904810320 1:33159605-33159627 CAGTGGGAGTGGAGGCAGATGGG - Intronic
905118957 1:35666992-35667014 CTTTGGGAGTGGAGGAAGAAGGG + Intergenic
905167029 1:36088797-36088819 CTGTGGGCCTGGCGGCGGAGTGG + Intergenic
906299746 1:44673473-44673495 CTCTGGGAATTCTGGCAGAAGGG - Intronic
906609652 1:47192547-47192569 CTTTGGGAGTGGTGGGGGAAGGG + Intergenic
906680216 1:47721200-47721222 CTGTGGGAGAGGAAGCAGAATGG - Intergenic
907824952 1:58006772-58006794 CTGAGGGACGGGAGGCAGAGAGG - Intronic
909193515 1:72586424-72586446 CTGTGGATTTGGTGACAGAAAGG + Intergenic
910156348 1:84224515-84224537 CAGTGGTAGTGGTGGCAGACTGG + Intronic
911780570 1:101870734-101870756 CTGTGGGGGTGTAGGCAGAAAGG + Intronic
912886417 1:113479255-113479277 CATTGGGACTGGTGGAACAATGG - Intronic
915275196 1:154783686-154783708 CTGTGGGACTGGAAGGAGAGGGG + Intronic
917459011 1:175211986-175212008 CTTTGGGACTGATGGAAGGAGGG - Intergenic
920372817 1:205490207-205490229 CTGTTGGGCTGGTGGCATCAGGG + Intergenic
920654823 1:207867636-207867658 CTTTGGCATTGGTGGCAGGAGGG - Intergenic
921700185 1:218260214-218260236 CTGAGGTAGTGGTAGCAGAATGG + Intergenic
922062528 1:222105955-222105977 CAGTGGGACTGGAAGCAGAGAGG - Intergenic
1067350389 10:45470435-45470457 TTCTCTGACTGGTGGCAGAAAGG - Intronic
1068004038 10:51371616-51371638 CTGTGGCACTGCTGGCAGATGGG - Intronic
1069136656 10:64774947-64774969 CTCTGACACTGGTGGCAGTAAGG + Intergenic
1070377175 10:75843985-75844007 CTGTGGTAGTGGCAGCAGAAAGG + Intronic
1070763005 10:79036683-79036705 CTGTGGCCATGGTGCCAGAAGGG - Intergenic
1072148546 10:92666023-92666045 CAGTAGGAGTGGTGGCATAAGGG - Intergenic
1072456848 10:95583924-95583946 CTGTGGGACTGGTGAAAGGATGG + Intergenic
1073771832 10:106743346-106743368 TGGTGGGACTGGTGGCAGCCAGG - Intronic
1074406894 10:113187604-113187626 CTGTGGGGCTGCTGTCAGGAAGG - Intergenic
1074448178 10:113537692-113537714 CTTTGGGAGGGGTGACAGAAAGG - Intergenic
1075471148 10:122690571-122690593 CTTTGGGCCTGGGGTCAGAAGGG + Intergenic
1076342680 10:129760249-129760271 CTGTGTGTGTGGGGGCAGAAAGG + Intronic
1076880956 10:133238960-133238982 CTGTAGGACTGGCATCAGAAAGG - Intronic
1077420873 11:2449291-2449313 CTGGGGTACTGGGGGCAGGAGGG + Intronic
1078096551 11:8300829-8300851 CTGGGGCACTGGGGGCAGAGGGG - Intergenic
1078309092 11:10220511-10220533 CTAAGGGAGTGGTGGTAGAAAGG - Intronic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1083205355 11:61145513-61145535 CTGTGGCATTGGTGAGAGAAAGG - Intronic
1083263544 11:61535849-61535871 AGGTGGGGCTGGGGGCAGAAGGG + Intronic
1083887890 11:65581607-65581629 CTGGGGGACTGGGGGCCGGAGGG - Exonic
1084009598 11:66340209-66340231 CTCTGGGTCTCGGGGCAGAATGG - Exonic
1084085303 11:66852375-66852397 CTGTGGGACTGGCCACAGAGCGG + Intronic
1084982320 11:72836458-72836480 CTGTGGGACATGTGCTAGAAGGG - Intronic
1085722847 11:78928389-78928411 CTTAGGAACTAGTGGCAGAATGG - Intronic
1089235168 11:117018156-117018178 CTGGGGGACTGGTTCCAGGAAGG + Intronic
1089350045 11:117816995-117817017 CTGTGGGCATGGGGGCAGGAGGG - Intronic
1089782161 11:120881311-120881333 CTGTGTACCTGGTGGGAGAAAGG - Intronic
1090977100 11:131687767-131687789 CCCTGGGTCTGGTGGCGGAAGGG + Intronic
1091529395 12:1339828-1339850 CTGTGGCAGTGTTGGCACAAGGG + Intronic
1091597295 12:1886648-1886670 CTGAGGGGCTGGCAGCAGAAAGG + Intronic
1091773022 12:3165636-3165658 CTGTGGGTCTGCTGGCAGCTGGG + Intronic
1092954247 12:13534928-13534950 CTGGGAGACTGGTGGATGAAAGG - Intergenic
1096188318 12:49598632-49598654 CTGCGGGACCAGGGGCAGAAGGG - Intronic
1096571442 12:52525644-52525666 CGGTGGGACTGGGGCCAGCAAGG - Intergenic
1096773132 12:53949232-53949254 CTGTGGGACTGCTGGCTGAAAGG - Intergenic
1097046901 12:56193757-56193779 GTATGGAACTGGAGGCAGAAAGG - Intergenic
1097079753 12:56421399-56421421 CTCTGGGGCTGGTGGCTGAGCGG - Exonic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1103252123 12:119508954-119508976 CACTGGCGCTGGTGGCAGAAGGG + Intronic
1104881178 12:132071628-132071650 CTGGGGGACGGATGGCAAAAAGG - Intronic
1111418808 13:87983207-87983229 TTGTGTGACTGAAGGCAGAAGGG - Intergenic
1112556420 13:100472563-100472585 GTGTGGGTCAGGAGGCAGAAAGG + Intronic
1113042366 13:106119014-106119036 CTGTGGGAATGCTGTCAGATAGG - Intergenic
1113595679 13:111530227-111530249 GGGTGGGAGTGGAGGCAGAAAGG + Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1115498839 14:34031688-34031710 CAGAGTGACTGGTGCCAGAATGG - Intronic
1118695323 14:68379389-68379411 CAGAGGGACTGCTGGGAGAAGGG + Intronic
1118789093 14:69072677-69072699 CTGTAAGAATAGTGGCAGAAGGG + Intronic
1119419797 14:74501694-74501716 CTGTGGGGGTGGGGGCAGAGAGG + Intronic
1121088795 14:91167204-91167226 CTCTGGGTATGGTGGGAGAAGGG - Exonic
1122285910 14:100652533-100652555 CTGTGGGTCTAGTGGCAACAGGG + Intergenic
1122985989 14:105211830-105211852 CTGTGGGCCTGGTGCCTGCAGGG - Intronic
1123662571 15:22577269-22577291 CAGTGTGACTGGCAGCAGAAAGG + Intergenic
1124261712 15:28198642-28198664 CAGTGTGACTGGCAGCAGAAAGG - Exonic
1124316373 15:28671570-28671592 CAGTGTGACTGGCAGCAGAAAGG + Intergenic
1124624198 15:31298925-31298947 CTGTGGGCCTTGCGCCAGAAGGG - Intergenic
1125437698 15:39665069-39665091 CGATGGGAGTGGTGGGAGAAGGG - Intronic
1125775098 15:42205521-42205543 GTGTGGGACTGGTACCAGAAAGG + Intronic
1128331347 15:66757590-66757612 CTGTGGGACAAGGGCCAGAAGGG - Intronic
1129110388 15:73333719-73333741 CTGTGGCCCTGGTGACAGAGGGG + Intronic
1130133250 15:81160959-81160981 CTTTGGGAAGGGTGGGAGAATGG + Intronic
1130161381 15:81404281-81404303 CAATGGGACTGGTGGGTGAATGG - Intergenic
1130257630 15:82333119-82333141 CTGTGGGACAGTTGGCGGGACGG + Intergenic
1130402563 15:83571312-83571334 CACTGGCACTGGTGGCAGAGGGG + Intronic
1130531584 15:84750808-84750830 CTGTGGGGCTGGAGGGGGAAAGG + Intronic
1131093717 15:89642519-89642541 CTGTGGTACTGGTGGTGCAAAGG - Intronic
1131227539 15:90637795-90637817 CTCTGGGACTGGGGACAGCAGGG - Intronic
1131547178 15:93325496-93325518 TTGTTAGACTGGTAGCAGAAGGG + Intergenic
1132645420 16:997268-997290 GTGTGGGACTGGGGGCTGACAGG - Intergenic
1135230098 16:20698403-20698425 CTGGAGGTCTGGAGGCAGAAAGG + Intronic
1135951013 16:26914116-26914138 CTGAGTGAATGGTGGGAGAACGG + Intergenic
1136480743 16:30540023-30540045 CTGGGGGCCTGGAGACAGAAAGG + Intronic
1137786318 16:51140457-51140479 CTGGGGGGCTGGTGGCAGAATGG + Exonic
1142058419 16:88014931-88014953 CTGAGGGCCTGGTGTCAGTAGGG - Intronic
1203141176 16_KI270728v1_random:1767805-1767827 CTGTGTTACTGGTGGGAGGAGGG + Intergenic
1142629688 17:1216752-1216774 CTCTGGGTCTGGTGGCCAAAGGG + Intronic
1142641068 17:1286241-1286263 CTAGGGGCCTGGTGGCAGCAGGG + Intronic
1143839630 17:9721667-9721689 CTCTGGGACTCCTGGCAGGAAGG + Intronic
1144132184 17:12257079-12257101 CTGTGGGAGTGTTGTCAGCAGGG + Intergenic
1144664302 17:17091536-17091558 CTGGGTGACTGGGGGCTGAATGG + Intronic
1145752358 17:27364341-27364363 CTGCAGGACGGGAGGCAGAATGG - Intergenic
1146418498 17:32660158-32660180 CTTGGAGACTGGTAGCAGAAAGG - Intronic
1147333152 17:39710627-39710649 CTGTGGAGCAGGTGGCAGTAAGG + Intronic
1147478734 17:40738721-40738743 ATGTGGGCCAGGAGGCAGAAAGG - Intergenic
1148103226 17:45105368-45105390 CTGTGGCACTGGGGGAGGAAGGG - Intronic
1148630413 17:49103776-49103798 CTCTGTGGCTGGTGCCAGAACGG + Intergenic
1148684962 17:49495986-49496008 CGGAGGGACTGGAGGCAGAGGGG + Intronic
1149407425 17:56368056-56368078 CTCTGGATCTGATGGCAGAATGG - Intronic
1149775447 17:59353452-59353474 CTGTAGGTCCGGTGGCAGGAGGG - Exonic
1150015700 17:61554483-61554505 CTGTAGTACTGGTGTCAGGATGG + Intergenic
1151554598 17:74840388-74840410 CTGGGGGACAGGTAGCAGGAAGG - Intergenic
1152039065 17:77891627-77891649 CTGTGGGATTGCAGGCAGAAGGG - Intergenic
1152556268 17:81054703-81054725 GTGGGGGACTGGTGGCTGCAGGG + Intronic
1153024110 18:657964-657986 CTGCGGGACGGGTGGCGGGAAGG + Exonic
1153988195 18:10371758-10371780 CTGTGGGATTGCTGGCTGCAGGG + Intergenic
1154158773 18:11964630-11964652 CTCTGGGAGTGGTGGTAGTAGGG - Intergenic
1156518613 18:37702155-37702177 CTGTGAGGCTGGTGGCAGACAGG + Intergenic
1156795875 18:41045582-41045604 CTGTGTGTCTGGAAGCAGAATGG - Intergenic
1156912944 18:42432619-42432641 CTGTGCATCTGTTGGCAGAAGGG - Intergenic
1157165420 18:45354376-45354398 CTGGGTGATTGGTGGCAGCAGGG + Intronic
1157581898 18:48778545-48778567 CTCTGGGCATGTTGGCAGAAGGG + Intronic
1158918174 18:62158276-62158298 CTGTGGTGCAGGTGGCAGAGGGG + Intronic
1160393771 18:78557537-78557559 CTGTGGAACAGATGTCAGAAGGG + Intergenic
1161795447 19:6383677-6383699 TTGAGGGACTCGGGGCAGAACGG - Intronic
1162289896 19:9771120-9771142 CTGGGGGAAGGGTGGGAGAAGGG - Intronic
1163639138 19:18451584-18451606 CTGGGGGGCTGGAGGCAGCAGGG + Exonic
1164725285 19:30461822-30461844 ATGTGTGGCTGGTGGGAGAAGGG + Intronic
1164808913 19:31140768-31140790 CTCTGGGACTGGAGGCTGCAGGG - Intergenic
1167429593 19:49446894-49446916 CTGTGGGCCTCCTGGCAGAGAGG + Intronic
926224558 2:10957759-10957781 CAGTGGGACTCCTGGCAGGAGGG + Intergenic
926756991 2:16244359-16244381 CCGTGGGCCTGGTGGGAGGAGGG + Intergenic
927210187 2:20634422-20634444 CTGTTGCACTGGTGGCATCAGGG + Intronic
928266373 2:29815497-29815519 GAGAGGGACTGGTGGAAGAAGGG - Intronic
928549105 2:32354595-32354617 CTGTGGGGCTGGAGTGAGAAGGG - Intergenic
928885505 2:36143707-36143729 CTGTGAGACTGGGGGCAACAGGG - Intergenic
930909237 2:56610840-56610862 CTGTGGCTCTGGTGGTTGAAGGG - Intergenic
931472146 2:62549100-62549122 ATGTGGGCCTGGTCTCAGAAGGG - Intergenic
932420760 2:71599961-71599983 ATGTGGGACTGTTTGGAGAAGGG + Intronic
933994063 2:87655059-87655081 CTGTGTGACTGGTGGGATGAAGG + Intergenic
935155449 2:100480126-100480148 CTGTGAAACTGGTGTAAGAATGG - Intronic
935216387 2:100978162-100978184 CTTTGGGACTGGTGGGGCAAGGG - Intronic
936299801 2:111295851-111295873 CTGTGTGACTGGTGGGATGAAGG - Intergenic
937457586 2:122055786-122055808 CAGTGGGGCTGGTGGGGGAAAGG - Intergenic
938791546 2:134680774-134680796 CTGTGGCACTGGAGCCAGAGAGG + Intronic
939995304 2:148914500-148914522 CAGTGGGAATTTTGGCAGAAAGG + Intronic
942770822 2:179517108-179517130 CTGTGAAACTGGTGAAAGAATGG - Intronic
944557901 2:200906170-200906192 CTTTGGGACTGGTGAAAGGAGGG - Intergenic
945178105 2:207064039-207064061 ATGGGGGACGGGTGGAAGAATGG + Intergenic
946355581 2:219182391-219182413 CTGGGGAACAGGTGGGAGAATGG - Exonic
947350674 2:229241420-229241442 CTGTTGGACTGAGGGCAAAATGG - Intronic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1172262316 20:33578721-33578743 ATGTGGGAATGGTGCCAGAGTGG - Intronic
1172290204 20:33770455-33770477 CTTTGGCACTGGTGGAAGAAAGG + Intronic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1174421865 20:50404575-50404597 CTGCTGGGCTGGTGGCAGGATGG - Intergenic
1176119250 20:63446582-63446604 CTGTGGGGCTGGGGGCAGATGGG + Intronic
1176664831 21:9675971-9675993 CTGGGGGACCGGTGGCCGGAGGG - Intergenic
1178552192 21:33550553-33550575 CTGTGGCACTGGTGTCACAGAGG - Exonic
1179609220 21:42538814-42538836 CTGGGGACCTGGTGGCATAAGGG - Intronic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1180912791 22:19464617-19464639 CTGAGAGACTTGTGTCAGAAAGG + Intronic
1181065307 22:20303047-20303069 CTGTGGTGCTGGTGGCACAGGGG + Intergenic
1181316112 22:21971819-21971841 GTTTGGGGCTGGTGTCAGAAAGG + Intronic
1181763074 22:25071362-25071384 CTCTGGGACTGGCGGCTAAAAGG - Intronic
1181953418 22:26571153-26571175 CAGTGGGGTTGGGGGCAGAAAGG - Intronic
1182358220 22:29732120-29732142 GTATGGGACAGGTGGAAGAATGG - Intronic
1183387673 22:37524472-37524494 CTATGGGACTGGGGAGAGAAGGG + Intergenic
1184297436 22:43533813-43533835 CTATGGGGCAGGTGGCAGCAAGG + Intronic
1184668673 22:46001673-46001695 CTCTGGGGCTGGTGGCCAAACGG - Intergenic
1184723669 22:46330575-46330597 CTGAGGGACTGGGGCCAGCACGG + Exonic
1185272152 22:49934644-49934666 CTGGGGGTCGGGGGGCAGAAGGG + Intergenic
1185341431 22:50293033-50293055 CTGGCCGACTGGTGGCAGAGAGG + Intronic
1185361254 22:50408526-50408548 GTGTGAGGCTGCTGGCAGAATGG + Intronic
949891205 3:8734664-8734686 GTGTGGGCCTGGAGGCAGCAGGG - Intronic
949983177 3:9516446-9516468 GTGTGGTACTGGTGAAAGAACGG - Intronic
950569652 3:13792150-13792172 CCCTGGGGCTGGTGGCAGTAGGG - Intergenic
950741811 3:15058161-15058183 CTGTGGGCCTGGTGGCACAGTGG - Intronic
956595305 3:70960580-70960602 CTCTGGGACAGGCTGCAGAAGGG + Intronic
960342929 3:116497298-116497320 CAGAGGGAGTGGTGGCAGAGAGG - Intronic
960565766 3:119130193-119130215 CACTGGGACTGGTTGGAGAATGG + Intronic
961470248 3:127106806-127106828 CTGTGTGGCTGGTGGCAGCCCGG - Intergenic
963831521 3:150014266-150014288 CTGTGGGCCAGATGGGAGAAGGG + Intronic
967919251 3:194602286-194602308 CAGTGGAAGTGGTGTCAGAAAGG + Intronic
969526974 4:7708813-7708835 CTGAGGGAGTGGTGGGAGGATGG + Intronic
971169532 4:24219107-24219129 CTGAAGTAGTGGTGGCAGAAAGG + Intergenic
971249199 4:24958340-24958362 CTGAGGCACTGCAGGCAGAAAGG - Intronic
972381805 4:38526385-38526407 CTGCCTGACTGGTGGGAGAAAGG - Intergenic
974264067 4:59560935-59560957 CAGTGGGACTGGTTGGAGAGTGG - Intergenic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
974875828 4:67701304-67701326 CTGTGGTGCAGGTGGCCGAAGGG + Intergenic
978189734 4:105896831-105896853 CTTTGGGCCTGGGGGTAGAAAGG + Intronic
980398783 4:132251942-132251964 CTCTGGGACTGGTGGTGGCAGGG + Intergenic
983513912 4:168637205-168637227 CGGAGGGGTTGGTGGCAGAATGG + Intronic
984016858 4:174436911-174436933 CGATGAGACTGGTGGCAGGATGG - Intergenic
986250116 5:6047764-6047786 CTGTGGGGCTTGTGGCAGGGAGG - Intergenic
989307472 5:39974360-39974382 CTGGGGGACAGAAGGCAGAATGG + Intergenic
991172997 5:63650352-63650374 CTGTGGGTGGGGTGACAGAAAGG - Intergenic
995773955 5:115705267-115705289 CTGTGAGACTGATAGCAGGATGG - Intergenic
995861141 5:116641891-116641913 CATTGGGACTGGTGTTAGAATGG + Intergenic
998205408 5:140153910-140153932 CTATGGGACAGGTGGAAGTAGGG - Intergenic
999274303 5:150318822-150318844 CAGTGGGACTGCAGGGAGAAGGG + Intronic
1001992910 5:176132944-176132966 CTGTAGGACTGGTAGCAGTTGGG + Intergenic
1002390916 5:178910829-178910851 CGGTGGCAGTGGTGGAAGAAGGG - Intronic
1002758487 6:183542-183564 CTCTGGGAGTGGGAGCAGAAGGG + Intergenic
1002854817 6:1027332-1027354 CTGGGGAACTGGGGGCAGGAAGG + Intergenic
1003579284 6:7325080-7325102 CTGTGGGAGTGGAGAGAGAAGGG - Intronic
1004009960 6:11675072-11675094 CAGTGGGATGGATGGCAGAATGG - Intergenic
1004959190 6:20766465-20766487 CAGTGGGACTACTAGCAGAAGGG - Intronic
1005351836 6:24943755-24943777 CTATTGGAATGGTTGCAGAATGG + Intronic
1006513316 6:34533081-34533103 CGGTGGGACTGGAGGAGGAACGG + Exonic
1006735222 6:36268554-36268576 CTGCGGGACTGGAGGCAGCTGGG - Intronic
1007107510 6:39293978-39294000 CTGTGGGGACAGTGGCAGAAGGG - Intergenic
1007654961 6:43446322-43446344 TTGTGGCACTGGTGGCAAACTGG - Exonic
1008040952 6:46797615-46797637 CTTTGGGACAAGAGGCAGAATGG + Intronic
1008536137 6:52507745-52507767 CTGTGGGACTCGTGGGACATGGG - Intronic
1010375763 6:75168403-75168425 CTGTGGTACAGTTGGCAGGATGG + Intronic
1014591456 6:123276941-123276963 CTCTGGGACTGGTGGAACAGTGG - Intronic
1016480131 6:144471705-144471727 CTGTGGGAATAGTGTCAGACAGG + Intronic
1016990487 6:149924941-149924963 CTGAGTGGCTGGGGGCAGAATGG - Intergenic
1017094262 6:150790529-150790551 ATGTAGGACTGGTGGGTGAAAGG - Intronic
1017908277 6:158771636-158771658 CTCTGGGACGGGTGGAGGAAGGG + Intronic
1018576313 6:165263621-165263643 CTGAGGGTGTGGTGGAAGAAGGG + Intergenic
1018612749 6:165661107-165661129 CTGAGGCAGAGGTGGCAGAAAGG - Intronic
1018873860 6:167803429-167803451 CTGTGGGCCTGGAGGCAGAGGGG + Intergenic
1018919955 6:168165499-168165521 ATGTGGTCCTGGTGGCTGAAGGG - Intergenic
1019165082 6:170093475-170093497 CAGTGGCTCTGGTGGCAGATCGG - Intergenic
1019621194 7:1992861-1992883 TTGTGGGCCTGGGGCCAGAACGG + Intronic
1022985647 7:35651022-35651044 CTGTGGTAGTAGTGGCAGATTGG - Intronic
1023637628 7:42228263-42228285 CTGGGTGTCTGGGGGCAGAAGGG + Intronic
1023689539 7:42772193-42772215 CAGTGGGAATGGAGGCAGCAAGG - Intergenic
1024606088 7:51023745-51023767 ATGTAGGACTGCTGGCACAATGG - Intronic
1026015761 7:66669456-66669478 CTGTGGGATGGGTGGCAGGGAGG + Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1028642018 7:93053040-93053062 CTGTGGAACAGGTGTCAGCAAGG - Intergenic
1029959158 7:104671045-104671067 ATCTAGGACTGATGGCAGAAGGG - Intronic
1031295491 7:119997376-119997398 CTGGTGGTGTGGTGGCAGAAAGG - Intergenic
1031736466 7:125368390-125368412 CTGAGGCACTGGTGGGAGTAGGG + Intergenic
1032097246 7:128945770-128945792 CTATGGGACAGGAGGCAGACTGG + Intronic
1032307409 7:130748999-130749021 GTGTGGTACTGGTGGGAAAATGG + Intergenic
1032824072 7:135552146-135552168 AGGTGAGACTGGAGGCAGAAGGG + Intergenic
1034246497 7:149648571-149648593 CTGTGGGAGTGATGACAGCAAGG + Intergenic
1034431236 7:151042184-151042206 CAGTGGGACTGAGGGCAGCAGGG + Intronic
1035377732 7:158416457-158416479 ATGTGGGATTGGTGGCTGCATGG + Intronic
1035898492 8:3431845-3431867 CTGTGGGCGTGGTGGCAGGCTGG - Intronic
1036778306 8:11628606-11628628 CTGTGGGAATGATTGCAGGAAGG + Intergenic
1036967932 8:13320955-13320977 CTCTTCCACTGGTGGCAGAAGGG - Intronic
1037627421 8:20620211-20620233 GTGTGGCACTGATGCCAGAATGG + Intergenic
1037950382 8:23015623-23015645 CAGTGGAACTGGGGACAGAAGGG - Exonic
1038612360 8:29068636-29068658 CTCTGGGAATGGTGGCGGACGGG - Exonic
1039101734 8:33948710-33948732 CTGTTGGAGTGGTGGCTGGAAGG + Intergenic
1042493147 8:69425245-69425267 CTGTGGGACTTATTGCACAAGGG - Intergenic
1042574544 8:70203381-70203403 CTGTTGTACTGGTAGAAGAAGGG - Intronic
1045883288 8:107065512-107065534 CATTGGGACTGGTGGGACAATGG - Intergenic
1047253346 8:123197107-123197129 CTGGGGCAGGGGTGGCAGAAGGG + Intronic
1047299167 8:123598028-123598050 CTGGAAGACTGATGGCAGAAGGG - Intergenic
1047861663 8:128973565-128973587 CTGTGGGCCTGGTGGTAGGCTGG - Intergenic
1048733558 8:137471804-137471826 CTCAGGGACTGGTGGCCTAAAGG - Intergenic
1049297764 8:141852270-141852292 CTGTGGGGGTGGTGGGAGCAAGG + Intergenic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1053001271 9:34578380-34578402 CTGGGGGAGGGGAGGCAGAAGGG + Intronic
1054702417 9:68426638-68426660 CTCTGGGACTAGTTCCAGAAGGG + Intronic
1057443863 9:95100018-95100040 CTGTGGACATGGTGGCAGCAGGG - Exonic
1057704137 9:97385880-97385902 CTGGGGGCCTGGTGGCTGGATGG + Intergenic
1059345872 9:113627571-113627593 GTGTGTGACTGGTGGCTAAAGGG - Intergenic
1060375008 9:123109652-123109674 CTGGAGGACTTGTGGCAGCAGGG + Intronic
1060877860 9:127096141-127096163 CTGAGGGAGTGGTGGGGGAAAGG - Intronic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061216256 9:129223708-129223730 CTGTGGTGCTGGAGTCAGAAGGG + Intergenic
1061542208 9:131283375-131283397 TTGGGGGACTGACGGCAGAAAGG - Intergenic
1061672046 9:132194298-132194320 CTGTGAGCCTGGATGCAGAATGG - Intronic
1062045507 9:134422712-134422734 CTATGGGACTGTTGGGGGAAGGG + Intronic
1062407630 9:136404330-136404352 CTCTGGGACTGGGGGCCTAATGG + Intronic
1062536469 9:137023284-137023306 CTCTGGGAGTTATGGCAGAAGGG - Intronic
1062699734 9:137892627-137892649 CTGTGAGACTGCAGGCAGGAGGG + Intronic
1203777963 EBV:84710-84732 TTGTGGTACTGGTGGCAGTAGGG - Intergenic
1203661266 Un_KI270753v1:45776-45798 CTGGGGGACCGGTGGCCGTAGGG + Intergenic
1185552868 X:997949-997971 CTGTGTTACTGGCGGGAGAAGGG - Intergenic
1189625767 X:42895262-42895284 CTGGGAGACTGGGGGCAGGACGG + Intergenic
1190363053 X:49667025-49667047 CTGTGGGACTGGTGGCAGAATGG + Intergenic
1191946891 X:66544334-66544356 CTGTGGTGATGGTGGCAAAAGGG - Intergenic
1192866807 X:75142606-75142628 ATGTTGGACTGGTGGATGAATGG - Intronic
1194206623 X:91018718-91018740 CTGTGGGAGTGGTTTCAGGATGG + Intergenic
1195349032 X:103979757-103979779 GTGTGGGACTGGTACCAGATAGG + Intergenic
1195352696 X:104009712-104009734 TTGTGGGACTGGTGCCGGATAGG - Intergenic
1195358411 X:104059082-104059104 GTGTGGGACTGGTACCAGATAGG - Intergenic
1199844226 X:151679095-151679117 CTGTGGGTCTGGGGGCACAAGGG + Intergenic
1200552371 Y:4593507-4593529 CTGTGGGAGTGGTTTCAGGATGG + Intergenic
1201305924 Y:12550473-12550495 CAGATGGACTGGTGGCTGAATGG + Intergenic