ID: 1190364042

View in Genome Browser
Species Human (GRCh38)
Location X:49675132-49675154
Sequence GAGCTCCAGAATGTTAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190364042_1190364045 7 Left 1190364042 X:49675132-49675154 CCTGTTTTAACATTCTGGAGCTC No data
Right 1190364045 X:49675162-49675184 GGCTCTGCTTGCTTCAAAACTGG No data
1190364042_1190364047 14 Left 1190364042 X:49675132-49675154 CCTGTTTTAACATTCTGGAGCTC No data
Right 1190364047 X:49675169-49675191 CTTGCTTCAAAACTGGTTCTGGG No data
1190364042_1190364046 13 Left 1190364042 X:49675132-49675154 CCTGTTTTAACATTCTGGAGCTC No data
Right 1190364046 X:49675168-49675190 GCTTGCTTCAAAACTGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190364042 Original CRISPR GAGCTCCAGAATGTTAAAAC AGG (reversed) Intergenic
No off target data available for this crispr