ID: 1190364046

View in Genome Browser
Species Human (GRCh38)
Location X:49675168-49675190
Sequence GCTTGCTTCAAAACTGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190364041_1190364046 14 Left 1190364041 X:49675131-49675153 CCCTGTTTTAACATTCTGGAGCT No data
Right 1190364046 X:49675168-49675190 GCTTGCTTCAAAACTGGTTCTGG No data
1190364042_1190364046 13 Left 1190364042 X:49675132-49675154 CCTGTTTTAACATTCTGGAGCTC No data
Right 1190364046 X:49675168-49675190 GCTTGCTTCAAAACTGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190364046 Original CRISPR GCTTGCTTCAAAACTGGTTC TGG Intergenic
No off target data available for this crispr