ID: 1190364636

View in Genome Browser
Species Human (GRCh38)
Location X:49680108-49680130
Sequence GGGTCAGTCAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190364632_1190364636 3 Left 1190364632 X:49680082-49680104 CCACTTTCAATCACATGCAAATT 0: 3
1: 29
2: 108
3: 256
4: 526
Right 1190364636 X:49680108-49680130 GGGTCAGTCAATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190364636 Original CRISPR GGGTCAGTCAATGCAAATTG AGG Intergenic
No off target data available for this crispr