ID: 1190366774

View in Genome Browser
Species Human (GRCh38)
Location X:49702265-49702287
Sequence TTATGGTGTTCAAGCAGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190366774_1190366777 30 Left 1190366774 X:49702265-49702287 CCACTGCTGCTTGAACACCATAA No data
Right 1190366777 X:49702318-49702340 GTAAACTCCGTAGCAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190366774 Original CRISPR TTATGGTGTTCAAGCAGCAG TGG (reversed) Intergenic
No off target data available for this crispr