ID: 1190366775

View in Genome Browser
Species Human (GRCh38)
Location X:49702282-49702304
Sequence AAATCTAATAACTTTGGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190366775_1190366780 20 Left 1190366775 X:49702282-49702304 CCATAACCAAAGTTATTAGATTT No data
Right 1190366780 X:49702325-49702347 CCGTAGCAAAAGCTGGTGAAGGG No data
1190366775_1190366777 13 Left 1190366775 X:49702282-49702304 CCATAACCAAAGTTATTAGATTT No data
Right 1190366777 X:49702318-49702340 GTAAACTCCGTAGCAAAAGCTGG No data
1190366775_1190366778 19 Left 1190366775 X:49702282-49702304 CCATAACCAAAGTTATTAGATTT No data
Right 1190366778 X:49702324-49702346 TCCGTAGCAAAAGCTGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190366775 Original CRISPR AAATCTAATAACTTTGGTTA TGG (reversed) Intergenic
No off target data available for this crispr