ID: 1190366777

View in Genome Browser
Species Human (GRCh38)
Location X:49702318-49702340
Sequence GTAAACTCCGTAGCAAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190366774_1190366777 30 Left 1190366774 X:49702265-49702287 CCACTGCTGCTTGAACACCATAA No data
Right 1190366777 X:49702318-49702340 GTAAACTCCGTAGCAAAAGCTGG No data
1190366776_1190366777 7 Left 1190366776 X:49702288-49702310 CCAAAGTTATTAGATTTAATATA No data
Right 1190366777 X:49702318-49702340 GTAAACTCCGTAGCAAAAGCTGG No data
1190366775_1190366777 13 Left 1190366775 X:49702282-49702304 CCATAACCAAAGTTATTAGATTT No data
Right 1190366777 X:49702318-49702340 GTAAACTCCGTAGCAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190366777 Original CRISPR GTAAACTCCGTAGCAAAAGC TGG Intergenic
No off target data available for this crispr