ID: 1190372653

View in Genome Browser
Species Human (GRCh38)
Location X:49757881-49757903
Sequence GGGACCCTGAAACTCAGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190372653_1190372655 -8 Left 1190372653 X:49757881-49757903 CCCTCGCTGAGTTTCAGGGTCCC No data
Right 1190372655 X:49757896-49757918 AGGGTCCCTGTCTGCATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190372653 Original CRISPR GGGACCCTGAAACTCAGCGA GGG (reversed) Intergenic
No off target data available for this crispr