ID: 1190374467

View in Genome Browser
Species Human (GRCh38)
Location X:49775451-49775473
Sequence AGGGAGAGTGCAGCAACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190374467_1190374477 26 Left 1190374467 X:49775451-49775473 CCCCCAGTTGCTGCACTCTCCCT No data
Right 1190374477 X:49775500-49775522 ACACAGCATGACTGCTGCTGGGG No data
1190374467_1190374478 27 Left 1190374467 X:49775451-49775473 CCCCCAGTTGCTGCACTCTCCCT No data
Right 1190374478 X:49775501-49775523 CACAGCATGACTGCTGCTGGGGG No data
1190374467_1190374476 25 Left 1190374467 X:49775451-49775473 CCCCCAGTTGCTGCACTCTCCCT No data
Right 1190374476 X:49775499-49775521 CACACAGCATGACTGCTGCTGGG No data
1190374467_1190374475 24 Left 1190374467 X:49775451-49775473 CCCCCAGTTGCTGCACTCTCCCT No data
Right 1190374475 X:49775498-49775520 TCACACAGCATGACTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190374467 Original CRISPR AGGGAGAGTGCAGCAACTGG GGG (reversed) Intergenic
No off target data available for this crispr