ID: 1190374789

View in Genome Browser
Species Human (GRCh38)
Location X:49778317-49778339
Sequence CTTAAATAGAGGGCTGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190374785_1190374789 -2 Left 1190374785 X:49778296-49778318 CCACATGGAAAGTATAAAGCTCT No data
Right 1190374789 X:49778317-49778339 CTTAAATAGAGGGCTGGACATGG No data
1190374783_1190374789 25 Left 1190374783 X:49778269-49778291 CCTGGTAGAAAGGGATTGAATGA No data
Right 1190374789 X:49778317-49778339 CTTAAATAGAGGGCTGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190374789 Original CRISPR CTTAAATAGAGGGCTGGACA TGG Intergenic
No off target data available for this crispr