ID: 1190376794

View in Genome Browser
Species Human (GRCh38)
Location X:49796191-49796213
Sequence CCTTGGGGGCCTTTCTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190376784_1190376794 15 Left 1190376784 X:49796153-49796175 CCAAATCTATGGTCTGACTGTGG No data
Right 1190376794 X:49796191-49796213 CCTTGGGGGCCTTTCTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190376794 Original CRISPR CCTTGGGGGCCTTTCTCTCA GGG Intergenic
No off target data available for this crispr