ID: 1190379748

View in Genome Browser
Species Human (GRCh38)
Location X:49828418-49828440
Sequence GGAAATGCACAGATGGGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190379742_1190379748 22 Left 1190379742 X:49828373-49828395 CCACATTGACTTAGCAGGGCTCT No data
Right 1190379748 X:49828418-49828440 GGAAATGCACAGATGGGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190379748 Original CRISPR GGAAATGCACAGATGGGCCT AGG Intergenic
No off target data available for this crispr