ID: 1190389622

View in Genome Browser
Species Human (GRCh38)
Location X:49919291-49919313
Sequence CTCTCTACAGAAATCCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190389622_1190389624 -8 Left 1190389622 X:49919291-49919313 CCTGGCTGGATTTCTGTAGAGAG No data
Right 1190389624 X:49919306-49919328 GTAGAGAGTGGTCTGAGCCATGG No data
1190389622_1190389625 -7 Left 1190389622 X:49919291-49919313 CCTGGCTGGATTTCTGTAGAGAG No data
Right 1190389625 X:49919307-49919329 TAGAGAGTGGTCTGAGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190389622 Original CRISPR CTCTCTACAGAAATCCAGCC AGG (reversed) Intergenic
No off target data available for this crispr