ID: 1190390961

View in Genome Browser
Species Human (GRCh38)
Location X:49931160-49931182
Sequence GTTGTTGAGGTGATTGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 273}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190390956_1190390961 22 Left 1190390956 X:49931115-49931137 CCCCAGGTGATTCTAATGTGCAA 0: 14
1: 85
2: 325
3: 896
4: 1735
Right 1190390961 X:49931160-49931182 GTTGTTGAGGTGATTGTTGAAGG 0: 1
1: 0
2: 1
3: 23
4: 273
1190390958_1190390961 20 Left 1190390958 X:49931117-49931139 CCAGGTGATTCTAATGTGCAAAC 0: 2
1: 28
2: 173
3: 598
4: 1506
Right 1190390961 X:49931160-49931182 GTTGTTGAGGTGATTGTTGAAGG 0: 1
1: 0
2: 1
3: 23
4: 273
1190390957_1190390961 21 Left 1190390957 X:49931116-49931138 CCCAGGTGATTCTAATGTGCAAA 0: 5
1: 31
2: 190
3: 630
4: 1591
Right 1190390961 X:49931160-49931182 GTTGTTGAGGTGATTGTTGAAGG 0: 1
1: 0
2: 1
3: 23
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190390961 Original CRISPR GTTGTTGAGGTGATTGTTGA AGG Intronic
900423544 1:2566130-2566152 GGTGTTTAGGTGGTTGGTGAAGG - Intergenic
900849436 1:5130662-5130684 GATGGGGAGGTGATTGTTGAGGG + Intergenic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
902558219 1:17259730-17259752 GTCGTTGAGGTCATTGCTGGGGG - Exonic
903991000 1:27269472-27269494 GTTGGTGAGGTAAGTGTGGATGG + Intronic
904072587 1:27813083-27813105 GTTTTTGAGGTGGAGGTTGAGGG + Intronic
905808313 1:40893111-40893133 GTTGTTGTTGTTGTTGTTGATGG - Intergenic
907629946 1:56070466-56070488 GTTGTTGAGTGGATAATTGATGG - Intergenic
909577333 1:77188884-77188906 CTTGTTAAGGTGCTTGCTGAAGG + Intronic
910514928 1:88049640-88049662 ATTGGTGAGGTAATAGTTGAGGG - Intergenic
911319556 1:96396156-96396178 GTTGTTGTTGTGGTTGTTGGGGG + Intergenic
911650775 1:100385838-100385860 GTTGTTGCGGTTATTATAGAGGG + Intronic
911798734 1:102107662-102107684 GTTTTTAAGGTGATTGTTGTAGG + Intergenic
911964238 1:104346211-104346233 GTTGTTGTTGTTGTTGTTGATGG + Intergenic
912547940 1:110464854-110464876 GCTGTAGAGGGGCTTGTTGAAGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914846766 1:151287790-151287812 GCTGTTGAGGATCTTGTTGAAGG - Exonic
915342375 1:155183760-155183782 GTTGGGGACGAGATTGTTGAGGG - Intronic
915487814 1:156234256-156234278 GTTGTTGAGGGGATTAGGGAGGG + Intronic
917036908 1:170758155-170758177 GTTGATGAGATGATTTTTGATGG - Intergenic
917462974 1:175248120-175248142 CTTGCTGAGGTGCTTGCTGAAGG + Intergenic
918104749 1:181407167-181407189 GTTGTTATGGTGACTGTTCAAGG - Intergenic
918333850 1:183487741-183487763 GGGGTTGATGTGTTTGTTGATGG + Intronic
918425060 1:184400689-184400711 GTTGTTGTTGTTGTTGTTGATGG + Intronic
918951544 1:191146347-191146369 GTTGTGGAGGTGATTTTGGTGGG - Intergenic
919004042 1:191871766-191871788 TTTGTTGCTGTTATTGTTGAAGG - Intergenic
920283802 1:204864733-204864755 TTTGTTGTGGTTATTGTTGTTGG + Intronic
921627757 1:217396894-217396916 ACTGTTGAGGTGGCTGTTGAAGG - Intergenic
921886645 1:220313938-220313960 GTTCTGGAAGTGATTGGTGAAGG + Intergenic
923957516 1:239039616-239039638 CTTGCTGAGGTGCTTGCTGAAGG + Intergenic
924840499 1:247705863-247705885 TGTGTTGAGGTGCTTGCTGAGGG - Intergenic
1063788387 10:9410500-9410522 CTTGCTGAGGTGCTTGCTGAAGG + Intergenic
1063805217 10:9631380-9631402 GTTGTTGTTGTTGTTGTTGATGG + Intergenic
1065711719 10:28524681-28524703 GTTGCTTAGCTGAATGTTGAAGG - Intergenic
1065858370 10:29849244-29849266 GGTGGGGAGGTGATTGTAGAGGG - Intergenic
1067754086 10:48991748-48991770 CCTGTTGAGGTGCTTGCTGAAGG - Intergenic
1068007389 10:51407622-51407644 CCTGTTGAGGTGCTTGCTGAAGG - Intronic
1069594038 10:69659076-69659098 GGTGTTGAGGTGAGGGTGGATGG + Intergenic
1070496288 10:77026920-77026942 GTTATTAAGGTGTTTGTTGGAGG + Intronic
1070823266 10:79375589-79375611 GTTGTTGAGAAGATGGTAGAGGG + Intergenic
1071308780 10:84324045-84324067 CCTGTTGAGGTGCTTGCTGAGGG + Intergenic
1072046973 10:91666861-91666883 GTTGACAAAGTGATTGTTGAGGG + Intergenic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1076596888 10:131628873-131628895 GTGGTTGAGGTGAAAGATGAGGG - Intergenic
1077156575 11:1094699-1094721 GTGGTTGTGGTGGTTGTTGGAGG - Intergenic
1077156607 11:1094816-1094838 GTGGTTGTGGTGGTTGTTGGAGG - Intergenic
1077156659 11:1095005-1095027 GTGGTTGTGGTGATTGTTGGAGG - Intergenic
1077894379 11:6442874-6442896 GTTGTTGAGGAAATTCCTGATGG - Intergenic
1079264508 11:18917560-18917582 GCTGTTGAGGTGGCTGCTGAAGG - Intergenic
1081178013 11:39952977-39952999 TTTGGTGGGGTTATTGTTGAGGG - Intergenic
1082082934 11:48026147-48026169 GATGATGAGGTCATTGTGGAAGG + Intronic
1084379605 11:68803083-68803105 GTTTTTGATCTGATTGGTGAGGG - Intronic
1084801943 11:71549747-71549769 GTTGTTGAACTGATTAATGAAGG + Intronic
1085796725 11:79548001-79548023 GTTGCTGAGGTGAGCCTTGATGG - Intergenic
1087277816 11:96177860-96177882 GTTTTTGAGGGAATTTTTGAGGG + Intronic
1088964888 11:114708984-114709006 TTTGTTGAGGTGAGAGATGAGGG - Intergenic
1088977740 11:114830755-114830777 GTTGAGGAGGTTATTGTGGAAGG + Intergenic
1089255141 11:117190168-117190190 GTTGCTGAGGATGTTGTTGAAGG - Exonic
1089932350 11:122326184-122326206 GTTTTAGAGGGGGTTGTTGATGG + Intergenic
1092238580 12:6824263-6824285 GTTGCTGAGGCGGTAGTTGACGG - Exonic
1093522606 12:20067714-20067736 GTTGTTGTTGTTGTTGTTGATGG - Intergenic
1095849971 12:46791834-46791856 GATGTTGAGCTGATTCTTGAAGG + Intronic
1095939427 12:47716427-47716449 GTTGTTGAGGAGGTTGATGAAGG + Exonic
1095989087 12:48021892-48021914 GTTGTTAATGTGTTTGTTTAGGG - Intronic
1096436356 12:51593172-51593194 GTTGGTGAGGTGGTGGTTGTGGG + Intronic
1096581257 12:52587013-52587035 GTGGTTGGGGTGATTATTTATGG - Intronic
1099600814 12:84734974-84734996 GTTTTTGTGGTTATTGTAGAAGG - Intergenic
1099621042 12:85003211-85003233 GTTGTTGTTGTTGTTGTTGATGG + Intergenic
1101700402 12:107168560-107168582 GTTGCTGTGGGGATTGTTGAAGG + Intergenic
1102097025 12:110249090-110249112 GCTTTTGAGGTGATAGATGAGGG + Intergenic
1102135391 12:110569915-110569937 GTGGTTGAGGTGTTTGTTAGTGG - Intronic
1102651002 12:114442424-114442446 GTTGTTGGGGATATTTTTGAGGG - Intergenic
1102844054 12:116159038-116159060 TTTGTTGAAGTTGTTGTTGAAGG - Intronic
1104148068 12:126054594-126054616 CCTGTTGAGGTGCTTGCTGAAGG + Intergenic
1106070138 13:26402835-26402857 TTTGTTGGTGTGATTGTTGTTGG + Intronic
1107870732 13:44744327-44744349 GTTGTTGTTGTTGTTGTTGAAGG - Intergenic
1108879714 13:55095555-55095577 ATTGTTCAGGTCATAGTTGAGGG + Intergenic
1111999956 13:95200937-95200959 GGTGTTGAAGTCATTGTTGGAGG - Intronic
1112832565 13:103471767-103471789 CTTGCTGAGGTGCTTGCTGAAGG - Intergenic
1113181470 13:107632632-107632654 TTTGTTGTTGTGTTTGTTGAGGG - Intronic
1114613858 14:24058175-24058197 GTCACTGAGGTGACTGTTGAGGG - Exonic
1115313265 14:32001132-32001154 GTGATTGAGGTGATTGGAGATGG + Intergenic
1117412715 14:55465623-55465645 GTTGATGAGGTGATTGTGCCTGG + Intergenic
1117634398 14:57726317-57726339 CTTGCTGAGGTGCTTGATGAAGG + Intronic
1120555758 14:85928706-85928728 CTTGCTGAGGTGCTTGCTGAAGG - Intergenic
1120973965 14:90232765-90232787 GCTGCTGAGGTGCTTGCTGAAGG + Intergenic
1122508243 14:102245854-102245876 GTTGGTGAGGTGCTGGTTGGAGG - Intronic
1125301796 15:38262580-38262602 GTTGTTAAGGAAAGTGTTGAGGG + Intronic
1125879180 15:43177433-43177455 GTTGGTGTGGTGATTCTTCAGGG + Intronic
1126283868 15:46988183-46988205 CTTGCTGAGGTGCTTGCTGAAGG + Intergenic
1126840038 15:52708984-52709006 GATGTAGAGGTGAATGATGAAGG + Intronic
1128946783 15:71828983-71829005 GTTCTTGAAATGATTGTTCATGG - Intronic
1130330506 15:82918551-82918573 GCTGTGGAGGTGAGTGTGGAGGG - Intronic
1131444405 15:92485177-92485199 GGTGTTGAGGGGATATTTGATGG + Intronic
1131724277 15:95204739-95204761 TTTGCTGAGGTGCTTGCTGAAGG + Intergenic
1131772416 15:95753336-95753358 TTAGTGGAGGTGATTGTTGGGGG - Intergenic
1132217881 15:100080565-100080587 CTTGCTGAGGTGCTTGCTGAAGG + Intronic
1133396796 16:5453896-5453918 TTTGTTGGGGTGGTTGGTGAAGG + Intergenic
1134027952 16:10968760-10968782 GTTGATGATGTGATTTGTGATGG + Intronic
1134295868 16:12945201-12945223 AGTGTGGAGGTGAGTGTTGAAGG + Intronic
1134296782 16:12953205-12953227 GTTGTTGTTGTTGTTGTTGAGGG - Intronic
1134385071 16:13764093-13764115 TTTGATGAGGTGAATGTGGAGGG + Intergenic
1135696282 16:24589732-24589754 TTGATTGTGGTGATTGTTGATGG - Intergenic
1138191951 16:55020849-55020871 GTTGTAGAGATGAGGGTTGATGG + Intergenic
1139703167 16:68722082-68722104 GTTGTTGATGTTGTTGTTGTTGG - Intronic
1140018238 16:71209777-71209799 GTTTTTGTGGTAATTGTTAATGG - Intronic
1140137070 16:72216140-72216162 GTTGGTCAGCTGAGTGTTGAGGG + Intergenic
1140604859 16:76523249-76523271 GTTTTTGATGTGATGGTTGGTGG - Intronic
1144798536 17:17909664-17909686 GTTCTGGAGATGGTTGTTGATGG + Intronic
1148129745 17:45255639-45255661 ATTGTTGAGCTGCATGTTGATGG + Exonic
1148372285 17:47109484-47109506 GTTGTTGAGGTGTATGTTCAGGG + Intergenic
1150889378 17:69129304-69129326 ATTATTGAGGTTATTTTTGAGGG - Intronic
1150916598 17:69443822-69443844 GTTGTTGAGCTGTATTTTGAAGG + Intronic
1155601094 18:27548988-27549010 GTTTTTGATGTGTTTGTTGTTGG + Intergenic
1155833450 18:30547419-30547441 ATTGTTGTTGTGGTTGTTGAGGG + Intergenic
1156133542 18:34007418-34007440 CTAGCTGAGGTGCTTGTTGAAGG + Intronic
1156755868 18:40524512-40524534 TTTGTTGAAGTGATTTATGAAGG - Intergenic
1157928270 18:51790213-51790235 GTTGTTGTTGTTATTGTTGGAGG + Intergenic
1157942144 18:51940897-51940919 GCTGTTGCGGTGATTGTGAAGGG + Intergenic
1158176563 18:54663688-54663710 GTTGTTGAAATGATTGTAAATGG + Intergenic
1161757609 19:6145808-6145830 GTTGTTGAGGGGGTTGTTGAGGG - Intronic
1162730465 19:12715455-12715477 GATGTTGAGGGGCCTGTTGAGGG + Exonic
1164393164 19:27843135-27843157 GGAGTTTAGGTGTTTGTTGAGGG + Intergenic
1165892291 19:39121055-39121077 GTTGAGGAGGTGACTCTTGAGGG - Intergenic
1167482183 19:49739866-49739888 GTTGCTGAGATGATCGTGGAGGG + Exonic
925099631 2:1234347-1234369 GTTGTTGACATGAATGCTGATGG - Intronic
927082830 2:19647564-19647586 ATTGTTAAGGTGATTGTTGCAGG - Intergenic
927096936 2:19754528-19754550 ATTGGTCAGGTGATTTTTGAGGG - Intergenic
928251750 2:29686912-29686934 CTTGTTGATGTGATTGCTCAAGG + Intronic
929715355 2:44304229-44304251 CATGCTGAGGTAATTGTTGAAGG - Exonic
929755917 2:44764738-44764760 GTTGTTGAGAAGATCGCTGAGGG + Intronic
930154645 2:48093586-48093608 GTTGCTAAGGTGATTCTTGCTGG - Intergenic
930937422 2:56970591-56970613 GTTGTTGAGGTCTTTGGTGATGG - Intergenic
931550775 2:63443712-63443734 GTGGTTGAGGTGAGAGATGATGG + Intronic
931561844 2:63570399-63570421 GTTGATGAGGTGAAGGTTAAGGG - Intronic
931952070 2:67375626-67375648 GTTGTTGTTGTTGTTGTTGATGG + Intergenic
935189150 2:100761955-100761977 GTTGTCAAGGTGATGGGTGATGG - Intergenic
936464594 2:112735762-112735784 GTTGTGGAAATGATTGTGGATGG - Intronic
937152606 2:119696278-119696300 GCTGTTGAGGTCATTATTGAGGG + Intergenic
937968151 2:127530214-127530236 GTGCTTGAGGTGATATTTGAAGG + Intergenic
940283963 2:152015114-152015136 GTTTTAGAGGTGCTGGTTGAGGG - Intronic
942333900 2:174859662-174859684 GATGTTAAGGTGTTTGTTCAGGG + Intronic
943239007 2:185361049-185361071 CCTGTTGAGGTGCTTGCTGAAGG - Intergenic
945683802 2:212944801-212944823 GTTGTTGGGGATGTTGTTGATGG + Intergenic
946439913 2:219686385-219686407 GTTGTTGATGTCTTGGTTGAGGG - Intergenic
946533848 2:220605947-220605969 ATTGCTGAGGTGCTTGCTGAAGG - Intergenic
946833369 2:223747518-223747540 CTTGTTGATGTGATTGTACAAGG - Intergenic
947186689 2:227461662-227461684 GTTGTAGAGGAGGTTGTTGATGG + Intergenic
947277230 2:228406203-228406225 GTCGTTGAGGAGATTGGTGGTGG + Intergenic
947340748 2:229136236-229136258 CTCGTTCAGGTGATTGTTGGTGG - Intronic
948823442 2:240561951-240561973 GTTGATGAAGACATTGTTGAAGG + Exonic
1170458720 20:16556798-16556820 GCTGTGTAGGTGATTGGTGAAGG - Intronic
1173596196 20:44259828-44259850 GTTGTTGAGGGGGCTGTTGCTGG - Intronic
1175250914 20:57609760-57609782 ATTGTTGTGGTGATTGTTTTGGG - Intronic
1175473593 20:59252464-59252486 GTTATTGTTGTGATTGTGGAAGG - Intronic
1177445295 21:21187437-21187459 GTTGTTGTTGTTGTTGTTGATGG - Intronic
1177628516 21:23697680-23697702 TTTGTTGAGGTCAGTGTTGGGGG + Intergenic
1177842918 21:26254623-26254645 GTTATTGAAGGAATTGTTGAAGG + Intergenic
1179416407 21:41202211-41202233 TTTGATTAGGGGATTGTTGAAGG + Intronic
1179485130 21:41705203-41705225 GCTTTTGAGGTGGGTGTTGAAGG - Intergenic
1180234572 21:46450011-46450033 GCTTTTGAGGTGATTGTGGTGGG - Intergenic
1182744900 22:32597971-32597993 GTTGTTCATGTGTTTTTTGAGGG + Intronic
1183661582 22:39224633-39224655 GCTGTTGAGGTGGCTGTAGATGG - Exonic
1184979496 22:48085847-48085869 GTTGCTCAGGTGAGTGTTGGGGG - Intergenic
951003832 3:17594420-17594442 CCTGTTGAGGTGCTTGCTGAAGG + Intronic
951301306 3:21000459-21000481 GTTGTTGTGGAGATGGTGGATGG + Intergenic
953317442 3:41942034-41942056 GTGGTTGAGGTGAAGGTGGAGGG - Intronic
953457244 3:43053087-43053109 GCTGTTGAGATGATCATTGAAGG + Intronic
953595157 3:44304980-44305002 GTTGTTGATGTGATACTTGTTGG + Intronic
953827466 3:46266287-46266309 GTTTTAGAGGTGAGTGTGGAAGG - Exonic
953925207 3:46979338-46979360 GTGGTGGAGATTATTGTTGAAGG + Intronic
954927463 3:54248827-54248849 CTAGTTGAGGTGCTTGCTGAAGG + Intronic
956475456 3:69614778-69614800 GCTGTTGAGGTGGTTGTTCCTGG + Intergenic
957152028 3:76498314-76498336 GTTGGAGAGGTGTTTGTTAAAGG + Intronic
958514991 3:95102768-95102790 ATTTTTAAGGTGCTTGTTGAGGG + Intergenic
958934574 3:100242549-100242571 CCTGTTGAGGTGCTTGCTGAAGG + Intergenic
959309346 3:104713241-104713263 GTTGTTGAGGAGATTTTGGGGGG - Intergenic
959443999 3:106414426-106414448 ATTGGGGAGGTGATTGTTTAAGG - Intergenic
960337084 3:116431052-116431074 ATAGCTGAGGTGTTTGTTGATGG - Intronic
961165805 3:124763077-124763099 GCTGTTGAGATGCCTGTTGAAGG - Exonic
961232848 3:125334783-125334805 GTGGTGGAGGTGGTCGTTGATGG - Intronic
961613411 3:128159615-128159637 GTCGTTGATGGGATCGTTGATGG - Intronic
961970959 3:130967169-130967191 TTTGGGGAAGTGATTGTTGATGG + Exonic
970275621 4:14397106-14397128 GTTGTTGACATGCTTGTTGTTGG - Intergenic
971100748 4:23464484-23464506 CCTGCTGAGGTGCTTGTTGAAGG - Intergenic
971915913 4:32869581-32869603 CCTATTGAGGTAATTGTTGAAGG + Intergenic
972893295 4:43586779-43586801 GTTGTTGAGTTCATTGTCAAGGG + Intergenic
973689627 4:53412533-53412555 GTTGTTGAGTTAATTGTTCTTGG + Intronic
973714618 4:53663410-53663432 CCTGCTGAGGTGATAGTTGAGGG + Intronic
974328112 4:60443143-60443165 CTTGTTGAGCTGACTGTTGAAGG - Intergenic
976005024 4:80419615-80419637 GATGATCAGGTGATTGTTAACGG - Intronic
979507300 4:121513360-121513382 GCTGCTGAGGTGCTTGCTGAAGG - Intergenic
979922757 4:126522196-126522218 GGTTTTGAGGAGACTGTTGAAGG + Intergenic
980867689 4:138572673-138572695 GTTGTTGAGGGGATTGAATAAGG + Intergenic
981845651 4:149165097-149165119 GTGGTTGAGGTCAAGGTTGAAGG + Intergenic
982587483 4:157260758-157260780 GTTGTTATTGTGATTGTTGGTGG + Intronic
983491077 4:168390009-168390031 GATGATGAGGTGGTTGTTGAGGG + Intronic
985011977 4:185592068-185592090 GTTGGTGAGGTGAGTGATGGTGG + Intronic
985832591 5:2245273-2245295 CTTGCTGAGGTGCTTGCTGAAGG + Intergenic
986875806 5:12107497-12107519 GTTGTTTAGGGAATTGTTTAGGG - Intergenic
987546618 5:19318687-19318709 GTTGCTTAGTTGATTGGTGATGG - Intergenic
988139395 5:27216919-27216941 GTTGCTTTTGTGATTGTTGATGG + Intergenic
988490171 5:31699313-31699335 ATTTTTGAGCTGAATGTTGAAGG + Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989998781 5:50867721-50867743 CTTGTTTAGGTGATTCCTGAGGG + Intergenic
991524279 5:67539152-67539174 GTTGATGGGGTGATTGTGGAGGG + Intergenic
991650513 5:68847858-68847880 GTCCTTCAGCTGATTGTTGAAGG - Intergenic
991775980 5:70086231-70086253 TTTGTTGAAGTGATAGATGATGG + Intergenic
991855268 5:70961685-70961707 TTTGTTGAAGTGATAGATGATGG + Intergenic
991869274 5:71094463-71094485 TTTGTTGAAGTGATAGATGATGG + Intergenic
993199301 5:84792287-84792309 ATGGTTGATGTAATTGTTGAAGG - Intergenic
993376537 5:87155399-87155421 GGTGTTGTGGTGTTTTTTGATGG + Intergenic
994430370 5:99651368-99651390 GTTGTTGAGATGTTTGTTAAAGG + Intergenic
994816889 5:104596290-104596312 GTTGTTTGGGTGTTTGGTGAAGG - Intergenic
997058506 5:130473183-130473205 GTTCTTGATTTGATTCTTGATGG + Intergenic
999712974 5:154334791-154334813 GTTGTTGCAGTGATTGGTGCTGG + Intronic
1002998249 6:2306703-2306725 CCTGCTGAGGTGCTTGTTGAAGG + Intergenic
1003264873 6:4556695-4556717 ATTGTTGAGCTGAATCTTGAAGG - Intergenic
1004334255 6:14749910-14749932 GTTGTTGATGTGATTGGAGGAGG + Intergenic
1004919778 6:20365774-20365796 GTTATTGAGGAGATATTTGAAGG + Intergenic
1005040581 6:21596246-21596268 GTTATTGATGTTGTTGTTGATGG + Exonic
1005148618 6:22721926-22721948 GTTTTTGAGGTGACTTTTTAAGG + Intergenic
1005241515 6:23835230-23835252 GTTGTTGTGGGGACTGTTGTGGG - Intergenic
1005707549 6:28470295-28470317 TTTGTTGAGGATATTGCTGATGG - Intergenic
1006216480 6:32448109-32448131 GTTGTTAAGGTGATTGTGTGGGG - Intergenic
1006954960 6:37860845-37860867 GGTGTTGAGGTGGATGTAGAAGG + Intronic
1010676045 6:78744876-78744898 TTTATTGAGTTTATTGTTGAAGG + Intergenic
1011162572 6:84408242-84408264 GTTATTGACGTGATTGTAAATGG + Intergenic
1011850930 6:91628089-91628111 GGTGTTAAGGTGACTGTTTAAGG + Intergenic
1012341777 6:98134995-98135017 TTTTTTGATGTGATTGCTGAGGG - Intergenic
1012344886 6:98172528-98172550 CCTGCTGAGGTGCTTGTTGAAGG + Intergenic
1015443007 6:133270607-133270629 CCTGTTGAGGTGCTTGCTGAAGG - Intronic
1015473171 6:133629399-133629421 GCAGTTGAGGTGCTTGTTGAAGG + Intergenic
1016105237 6:140154064-140154086 TTTGATGAGATGATTTTTGAGGG + Intergenic
1018841638 6:167521700-167521722 GTTGTTGAGTTGGCTGTGGACGG - Intergenic
1024036702 7:45512821-45512843 GTTGATGAGGTGATGCTTGGTGG - Intergenic
1025226746 7:57171996-57172018 ATTGTTGAGGTTATGGATGATGG - Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027008389 7:74718920-74718942 GAAGTTGAGGTGACTATTGAAGG + Intronic
1027406791 7:77871098-77871120 CTTGCTGAGGTGCTTGCTGAAGG - Intronic
1027924059 7:84437136-84437158 ATTGTTGAGGTGATTCTTAAAGG + Intronic
1028938328 7:96490636-96490658 GTTGCAGAGGTGATTATTCATGG + Intronic
1031081555 7:117263137-117263159 GTTGTGGAGGTTATTTTAGAGGG - Intergenic
1032349265 7:131144982-131145004 GTTGTTGTGGTTGTTGTTGCTGG - Intronic
1032991283 7:137397438-137397460 GTTTTTGAGCTTATTTTTGACGG - Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034022535 7:147660869-147660891 TTTGTTGAGGTCTTTGTTAAGGG + Intronic
1034941115 7:155231052-155231074 CCTGTTGAGGTGAATGATGATGG + Intergenic
1036187612 8:6637811-6637833 GTGGTTCAGGTGATTAGTGATGG + Intronic
1037205946 8:16320471-16320493 GTTGTTGATGTTGTTTTTGAAGG - Intronic
1039931886 8:41999759-41999781 GCTGCTGAGGTGATTCTTGTAGG - Intronic
1040868856 8:52079426-52079448 GTAGCTGTGGTGAATGTTGAAGG + Intergenic
1041216582 8:55607357-55607379 GAAGTTGAGGTGAGGGTTGAGGG + Intergenic
1041536831 8:58936155-58936177 GTTCTTTAGGTGGTTGTTGAAGG + Intronic
1043216473 8:77596331-77596353 CTAGTTGAGCTGATTGGTGAAGG + Intergenic
1043339197 8:79217165-79217187 GTTCTGGAGATGGTTGTTGATGG - Intergenic
1043417040 8:80061815-80061837 CTTGTTGATGTGATTGTAAATGG - Intronic
1043426999 8:80157476-80157498 TTTCTTCAGGTCATTGTTGAGGG - Intronic
1044563077 8:93632821-93632843 GTTTTTGTTGTGGTTGTTGATGG - Intergenic
1045176521 8:99730965-99730987 GTTACTGAGGTGATCCTTGAAGG + Intronic
1046197829 8:110886146-110886168 CCTGCTGAGGTGTTTGTTGAAGG + Intergenic
1046509485 8:115183681-115183703 GTTGTGGAGGATTTTGTTGATGG + Intergenic
1046873309 8:119227312-119227334 GTTGTTGTTGTTATTGTTTAAGG + Intronic
1048742427 8:137576311-137576333 GTTGTTGAGATCATTCTTAAGGG - Intergenic
1050482958 9:6104685-6104707 CCTGTTGAGGTGCTTGCTGAAGG + Intergenic
1050701867 9:8348796-8348818 GCAGTTGAGGTGAATCTTGAAGG - Intronic
1051216904 9:14807801-14807823 TGTGTTGAGGTAATTATTGAAGG + Intronic
1051624609 9:19086870-19086892 TTTGTTGGGGTGGTTGTTGGTGG - Intronic
1051839345 9:21376838-21376860 GTTCTTGATTTGATTGTTGCAGG - Intergenic
1052112142 9:24599426-24599448 GTTGTTGTTGTTGTTGTTGAAGG - Intergenic
1052737063 9:32353632-32353654 GATGCTGAGGTGGTTGCTGAAGG - Intergenic
1053655813 9:40217448-40217470 GTTGTTGAGGTCATTTATGAAGG + Intergenic
1053906167 9:42846656-42846678 GTTGTTGAGGTCGTTTATGAAGG + Intergenic
1054367928 9:64363675-64363697 GTTGTTGAGGTCATTTATGAAGG + Intergenic
1054528794 9:66158842-66158864 GTTGTTGAGGTCATTTATGAAGG - Intergenic
1054675547 9:67853419-67853441 GTTGTTGAGGTCATTTATGAAGG + Intergenic
1055098709 9:72440963-72440985 GATGTCGAGGTGAGTTTTGAAGG - Intergenic
1055702795 9:78964215-78964237 GTTGTTGAGGGGATTAATGGAGG - Intergenic
1055727784 9:79250162-79250184 GGTGTTTAGGTAATTCTTGAGGG - Intergenic
1055891467 9:81128715-81128737 CTTGTTCAAGTGATTGATGAAGG - Intergenic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1057372768 9:94489020-94489042 GTTGTTGAGGGTGTTGATGAAGG + Intergenic
1058229592 9:102409445-102409467 GTTGTTGTTGTTATTGTTGTTGG + Intergenic
1188248875 X:27866968-27866990 ATTGTAGTGGTCATTGTTGAAGG - Intergenic
1189944207 X:46160522-46160544 GTTGTTGTTGTGGTTGTTGGTGG - Intergenic
1190224467 X:48534560-48534582 GTTGTTAGGGTGACTGATGAGGG - Intergenic
1190390961 X:49931160-49931182 GTTGTTGAGGTGATTGTTGAAGG + Intronic
1191743333 X:64459400-64459422 GCTCTTGACTTGATTGTTGATGG + Intergenic
1191855884 X:65626435-65626457 GCTGTTTCGTTGATTGTTGAAGG + Intronic
1193295078 X:79824155-79824177 GTTGTAGAGGATATTGTTCAAGG + Intergenic
1193599960 X:83499611-83499633 CTTTTGTAGGTGATTGTTGAAGG - Intergenic
1194477948 X:94382665-94382687 TTTGTTGACATTATTGTTGATGG - Intergenic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1200879601 Y:8199008-8199030 GTTGGTGTGGTGATTCTTCAGGG + Intergenic
1201193468 Y:11469525-11469547 CCTGCTGAGGTGCTTGTTGAAGG - Intergenic
1201667519 Y:16475187-16475209 GTTCTTGAGGGTATTGTGGAGGG + Intergenic