ID: 1190391430

View in Genome Browser
Species Human (GRCh38)
Location X:49935596-49935618
Sequence CTGAATTTATAGAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 1, 2: 2, 3: 42, 4: 408}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190391429_1190391430 0 Left 1190391429 X:49935573-49935595 CCTATGAAAAAGAATAGTAGAGA 0: 1
1: 0
2: 3
3: 44
4: 428
Right 1190391430 X:49935596-49935618 CTGAATTTATAGAGAGAAGAAGG 0: 1
1: 1
2: 2
3: 42
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190391430 Original CRISPR CTGAATTTATAGAGAGAAGA AGG Intronic
900030314 1:366587-366609 TTGATTTCAGAGAGAGAAGAGGG - Intergenic
900050968 1:595651-595673 TTGATTTCAGAGAGAGAAGAGGG - Intergenic
903930359 1:26858439-26858461 CAGAATTTATGGAGAGAGAATGG - Intergenic
904098794 1:28004284-28004306 CTGACTATATAGTCAGAAGAGGG + Intronic
904124754 1:28230318-28230340 CTGTTTTCATAGAGTGAAGAGGG - Intronic
904957902 1:34302804-34302826 CTGAAATTATGGAGACCAGAAGG - Intergenic
905027657 1:34861993-34862015 CTGAATATGTGGAGAGGAGAAGG + Intergenic
905343625 1:37296387-37296409 CTGAATTTGTAGAAACAAAATGG + Intergenic
907597790 1:55735609-55735631 CTGGATTTAAAGAGCTAAGAAGG + Intergenic
908387538 1:63656427-63656449 CTGAATATATACCCAGAAGAGGG - Intronic
908769960 1:67586984-67587006 CTGAAGTTAGAGAGAGAAATGGG - Intergenic
908875682 1:68672352-68672374 CTGAATTAATACAGAGGAGCAGG - Intergenic
909080083 1:71099746-71099768 CTCATATTATAGTGAGAAGATGG + Intergenic
909141705 1:71875393-71875415 CTGCTTTTACAGAGAGAAGTAGG - Intronic
909252647 1:73378817-73378839 TTGGCTTTATAGAGAGAAAAAGG + Intergenic
909891245 1:81009859-81009881 AGGAATTTATAGAAGGAAGATGG + Intergenic
910268364 1:85365657-85365679 ATGAATTTAGAGAGATGAGAAGG + Intronic
910316271 1:85887181-85887203 CTGACTTTAAAGAGGGAACAAGG - Intronic
910355520 1:86349205-86349227 GTGAATTTTTAGACAGAAAATGG - Exonic
910584818 1:88867768-88867790 CTGTTTTTATAAAGACAAGATGG + Intronic
910724297 1:90322498-90322520 ATGGATTGGTAGAGAGAAGATGG + Intergenic
910925591 1:92395040-92395062 ATGAAATTATGGAGAAAAGATGG + Exonic
911166207 1:94726696-94726718 CAGATTTTATAGACAGAAAAGGG + Intergenic
911381907 1:97125749-97125771 GTGAAGTTATAGTGAAAAGATGG + Intronic
911840890 1:102680493-102680515 CTGCCTTTATGCAGAGAAGAAGG - Intergenic
913443095 1:118920349-118920371 CTGAATTTTTGAAGAGTAGAAGG + Intronic
915746994 1:158169288-158169310 CAGTATTTATAGAAAGAAAAAGG - Intergenic
916144848 1:161729133-161729155 CTGAAATTATACAGAGAGGCAGG + Intergenic
916308619 1:163369072-163369094 CTGAATTTTTAAGGAGAGGAAGG - Intergenic
917681252 1:177370260-177370282 CTTTATTTATAAAGAGAAAAAGG + Intergenic
918045626 1:180939305-180939327 CTGAAGTTCTGGAGAGCAGATGG - Intronic
918217666 1:182407138-182407160 CTAAATTGAGAGAGAGAACAGGG + Intergenic
918680058 1:187342934-187342956 CTGATTTTATAGAAAGAAACTGG + Intergenic
920607599 1:207404607-207404629 TTGAATCTATAGAGTGAATAGGG + Intergenic
921830243 1:219720187-219720209 ATTAAGTTATAAAGAGAAGAGGG + Intronic
923893748 1:238245093-238245115 CTAAATCTATATAGAGGAGACGG - Intergenic
924148703 1:241104882-241104904 CTCACTTTAAAAAGAGAAGAGGG + Intronic
1065430311 10:25647913-25647935 CGGAATTTATAGAGAGAGCATGG + Intergenic
1065963029 10:30749710-30749732 CTGCTTTTCTACAGAGAAGACGG - Intergenic
1066028556 10:31392266-31392288 CAGAATTTGAAGAGAGAAAAAGG - Intronic
1066700646 10:38124280-38124302 CTGAACTTATAGAGGGTAGAAGG + Exonic
1066784025 10:38982116-38982138 ATGAATGTATAGACATAAGATGG - Intergenic
1067245887 10:44542965-44542987 CTGAATCTATTGAGATAATATGG + Intergenic
1067412750 10:46079214-46079236 CTGTCTTTATAGAGAGCACAAGG - Intergenic
1067778753 10:49182384-49182406 CTTAATTTATAATGAAAAGATGG - Intronic
1068545515 10:58340318-58340340 CTGAATGTAAAGACAGAATAAGG - Intronic
1068761657 10:60717943-60717965 CAGTATTTATAGACAGAAAAAGG + Intronic
1069112668 10:64466050-64466072 CTGAATATTTAGAGGCAAGAAGG + Intergenic
1069686979 10:70324696-70324718 CTGAATCTAGTGAGAGAAGCCGG + Intronic
1070220226 10:74434534-74434556 TTGACTTTATAGACAGAAAAGGG + Intronic
1070237663 10:74646494-74646516 CTGTAGTTAAAGAGAGAAAATGG + Intronic
1070413268 10:76164933-76164955 CGTAATTTATAAAGAAAAGAGGG + Intronic
1071590316 10:86866196-86866218 CAGAATCTATAGATAGAAGAGGG + Intronic
1072789251 10:98305755-98305777 GGTAATTTATAAAGAGAAGAGGG + Intergenic
1072971154 10:100018695-100018717 TTGACTTTATAGGCAGAAGAGGG - Intergenic
1073857655 10:107696142-107696164 CCTTATTTACAGAGAGAAGAGGG + Intergenic
1074120667 10:110492056-110492078 CTGAAGTTTTAGAGAAGAGAAGG - Intergenic
1078940752 11:16002563-16002585 CTGTATTTATACATAGAAGGAGG + Intronic
1079816087 11:25060307-25060329 GTGAAATTACAGTGAGAAGATGG - Intronic
1079914462 11:26351585-26351607 GAGAATTTATAGACAGAAAAAGG + Intronic
1080163332 11:29205943-29205965 CTGAATTAATAGAGAAACAAAGG - Intergenic
1080870185 11:36230016-36230038 CAGAATTTATACAGGGTAGATGG - Exonic
1081226615 11:40531582-40531604 CTGAATTGAAAGAGTGAAGCTGG - Intronic
1081736867 11:45410438-45410460 CTGAACCTAAAGGGAGAAGATGG - Intergenic
1083355274 11:62061622-62061644 CTGCATTTGGAAAGAGAAGAGGG + Intergenic
1084122172 11:67076026-67076048 CAGAGTTTACAGAGACAAGAAGG + Intergenic
1085168144 11:74423381-74423403 CTGGCTTTAGAGAGAGAAGAAGG + Intergenic
1086965426 11:93022345-93022367 TTGGCTTTATAGACAGAAGAAGG + Intergenic
1087731666 11:101785093-101785115 CTGCATTTATTGAGATAATATGG + Intronic
1087978320 11:104578349-104578371 GTGAGGTTACAGAGAGAAGATGG + Intergenic
1087991078 11:104745630-104745652 CTGAATTTACAAAGAGAGGAAGG - Intergenic
1088219335 11:107551141-107551163 AATAATTTATAGATAGAAGAAGG - Intronic
1088332677 11:108669833-108669855 CTGACTTTAAAGACAGAAGAGGG + Intronic
1088745688 11:112802091-112802113 CTGAAAATGTAGAGAGGAGATGG - Intergenic
1088985718 11:114906173-114906195 TTGAACTCATAGAGAGTAGAAGG + Intergenic
1089168561 11:116496931-116496953 CTGAATTTGAAGACAGAAAAAGG + Intergenic
1089421728 11:118337073-118337095 CTGAATGTATCTTGAGAAGATGG + Intergenic
1090470991 11:126981173-126981195 CTGGATTTTTAGACAAAAGAAGG + Intronic
1090976559 11:131684714-131684736 CTGCATTCCTAGAGAGCAGAGGG + Intronic
1091106831 11:132929269-132929291 CTAAATTTATAGAAATAAAATGG + Intronic
1091248942 11:134125219-134125241 CTAAGTTGAGAGAGAGAAGAGGG - Intronic
1092405016 12:8215132-8215154 CTGAATTTAAAGAAAGAAAAAGG + Intergenic
1092804664 12:12208966-12208988 ATGCATTAATAGAGAAAAGATGG - Intronic
1093086718 12:14873645-14873667 CAGTATTTATAGACAGAAAAAGG - Intronic
1093367556 12:18322747-18322769 ATGATTTTATGGAGTGAAGATGG - Intronic
1093587068 12:20851172-20851194 TTGAATATATACACAGAAGAAGG + Intronic
1095701191 12:45192907-45192929 CTGAATCTAAACAGAGAAAAAGG - Intergenic
1095728841 12:45482639-45482661 CTGAATTTATAAAGAAAAAAAGG - Intergenic
1095878737 12:47109265-47109287 CTCCATTTACAGAGAGAGGAAGG - Intronic
1097096949 12:56557040-56557062 CCAAATTGATAGAGAGATGAAGG - Intronic
1098479977 12:70946294-70946316 CTGAATTTATAGCCACCAGAGGG - Intergenic
1098703151 12:73653963-73653985 TTGAAGTTATAGAAAGAAAAAGG - Intergenic
1098922308 12:76313627-76313649 CTTATTTTTTATAGAGAAGAAGG - Intergenic
1099757478 12:86871923-86871945 CAGTATTTATAGACAGAATATGG - Intergenic
1100716344 12:97310276-97310298 CTGGTTTTATAGACAGAAAAGGG - Intergenic
1101104939 12:101431337-101431359 CAGAATTCATAGAGACCAGAAGG + Intergenic
1101453449 12:104804375-104804397 ATGCATTTGTAGAGACAAGACGG - Exonic
1101821923 12:108190958-108190980 TTAACTTTATAGAGAGAAGATGG + Intronic
1102122818 12:110455877-110455899 CGGAATTTCTAGAGAGATCATGG + Exonic
1102416033 12:112763720-112763742 CTGAATTTCAAGAGGGAGGAGGG + Intronic
1103942184 12:124507147-124507169 CTGAATTCATAGAGACAAAAAGG + Intronic
1105253764 13:18725725-18725747 CTGAATCCATGGAGAGAAAAAGG - Intergenic
1106395177 13:29372875-29372897 CTGAATTTAGTGGGAGAAGAAGG - Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106841895 13:33692765-33692787 CTGAATTCCAAAAGAGAAGAGGG + Intergenic
1106882720 13:34149374-34149396 CTTAATTTCTAGAGGGAAAATGG + Intergenic
1107758275 13:43649672-43649694 CTCAATTCATAGAGAAAAAATGG - Intronic
1108089102 13:46827824-46827846 TTTAATTTCTAGAGACAAGATGG - Intergenic
1109611013 13:64764595-64764617 CTGCATGTATTGAGAGCAGAGGG - Intergenic
1109638229 13:65151147-65151169 TTGAATTTATAGAGAATAAATGG - Intergenic
1110047876 13:70854228-70854250 CTGAATAGGTAGAAAGAAGATGG - Intergenic
1110407032 13:75162262-75162284 CTGCTGTTATAGAGAGTAGAAGG + Intergenic
1111315041 13:86544586-86544608 CAGTATTTATAGACAGAAAAAGG + Intergenic
1112925109 13:104664123-104664145 ATGTATATATAGAGAGAATATGG + Intergenic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1114176630 14:20326734-20326756 CTGGATTTCTAGATAGAAGCTGG - Exonic
1115036363 14:28861533-28861555 CTATATTTATTGAGAGAAAAGGG - Intergenic
1115112748 14:29843221-29843243 GTGAAGATACAGAGAGAAGATGG + Intronic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116361354 14:44002280-44002302 ATAAATCTATAGACAGAAGATGG - Intergenic
1116422895 14:44753456-44753478 CTCTATTGATAGAGAGATGAAGG - Intergenic
1116684603 14:48021713-48021735 CTGAATTTAGAAAGAAAACATGG - Intergenic
1116691542 14:48113254-48113276 CTCAAATAATAGAGAAAAGAAGG - Intergenic
1118071368 14:62249878-62249900 ATGAAGTCACAGAGAGAAGATGG - Intergenic
1118106567 14:62666521-62666543 CTGCAGTCATAGAGAGCAGAAGG + Intergenic
1118504891 14:66400342-66400364 CTGAATTTTTGAAAAGAAGAAGG - Intergenic
1119461984 14:74813486-74813508 CTGAATTTCTAGAGTGATTAGGG - Intronic
1119881180 14:78101110-78101132 CAGAAATCAGAGAGAGAAGAAGG - Intergenic
1119992436 14:79214193-79214215 TAGAATATATAGAGAGAAGGTGG + Intronic
1120485985 14:85113624-85113646 CTGAATTTATAAAGAAAAAGAGG + Intergenic
1120500348 14:85289390-85289412 GTGAAATTACAGTGAGAAGATGG - Intergenic
1120572154 14:86133259-86133281 TTGAATTAAAAGAGAAAAGAGGG - Intergenic
1124650480 15:31470132-31470154 CAGAATGTATATATAGAAGAAGG - Intergenic
1126371899 15:47956136-47956158 CTGAATTGAGAGACAGCAGAAGG - Intergenic
1127246815 15:57186006-57186028 CTGACTTTATAGAAATAAAAAGG + Intronic
1129173981 15:73826524-73826546 TTGAATTTAAAGAGATGAGATGG - Intergenic
1129505133 15:76075132-76075154 CTGAAGTTCTGGGGAGAAGATGG + Intronic
1131851191 15:96545111-96545133 CTGAATTTGGAGAGAGAATTTGG + Intergenic
1133587299 16:7208343-7208365 GGGAATTTATAAAGAAAAGAGGG + Intronic
1133866143 16:9645277-9645299 CTGAATTTACAGATAGGAAATGG - Intergenic
1135020817 16:18961664-18961686 CTGGAGTTCTAGAGAGAGGATGG - Intergenic
1136690953 16:32028641-32028663 CTGGATGTCCAGAGAGAAGATGG - Intergenic
1137949923 16:52774032-52774054 CTGATTTGGTAGAGAGAGGAGGG - Intergenic
1138090780 16:54172538-54172560 ATGTAATTATAGAGAGAAGCAGG - Intergenic
1138391868 16:56676077-56676099 CTCAATTTATAGTTAGAAGAGGG - Intronic
1140977770 16:80076853-80076875 ATGAATCTATACAGAGAAGGAGG - Intergenic
1141085259 16:81089779-81089801 GGGAATTTACAGAGAAAAGATGG + Intronic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1143160986 17:4870897-4870919 CTGAAATTAGATAGTGAAGATGG - Intronic
1143737697 17:8924598-8924620 TTGGATTAATGGAGAGAAGACGG - Intronic
1146321849 17:31853031-31853053 CTAAATTGACAAAGAGAAGATGG + Intronic
1146496628 17:33328437-33328459 GAGAATTTAGAGAGAGAAGGAGG - Intronic
1146741202 17:35285223-35285245 CAGTATTTATAGAAAGAAAAGGG + Intergenic
1147045373 17:37747451-37747473 CTGAATTTTGAGAGAGAATGAGG - Intergenic
1149147051 17:53506586-53506608 TTGAACTTATAGAAAGTAGAAGG - Intergenic
1149518966 17:57303958-57303980 CTGAATTACTAGAGGGAGGAGGG + Intronic
1149801019 17:59567522-59567544 CTGATTGTATAGACAGAAAAGGG - Intronic
1152875192 17:82782397-82782419 CTGTAATTAAAGAGAGAAGAAGG - Intronic
1152949444 17:83219970-83219992 TTGATTTCAGAGAGAGAAGAGGG + Intergenic
1153177199 18:2390010-2390032 CTGAATTGATTGAGAGATCATGG - Intergenic
1156735411 18:40252182-40252204 CTCTATCAATAGAGAGAAGAAGG - Intergenic
1157135129 18:45046542-45046564 GTGTATTTATTCAGAGAAGAAGG + Intronic
1157554067 18:48601346-48601368 CAGAATATATAGAGATCAGAAGG - Intronic
1158533797 18:58288882-58288904 CTGAATCTATACTGAGAACATGG - Intronic
1159351335 18:67278465-67278487 CTGAATATATATAAAAAAGATGG + Intergenic
1159706898 18:71701700-71701722 CTGAATTTATATAGTGGAAATGG - Intergenic
1160379014 18:78435806-78435828 CTGAATTCAGAGAGTGCAGAGGG + Intergenic
1160526465 18:79541383-79541405 CTGACTTTCTAGTGAGAAGGGGG + Intergenic
1161540293 19:4846752-4846774 GTGAATACACAGAGAGAAGATGG + Intronic
1163054599 19:14708849-14708871 GTGAAGATATAGAGAGAAGATGG - Intronic
1164720113 19:30425769-30425791 CTGATTTTATAGTCAGAAGCAGG + Intronic
1166575347 19:43832101-43832123 TTGAATATTTAGGGAGAAGAGGG + Intronic
1166620042 19:44289197-44289219 CTGAAAGGATAGAGAGAATAAGG + Intronic
1167077465 19:47258155-47258177 CTGAATTTCTATGGAGAAGATGG + Intronic
1167809654 19:51817617-51817639 TTGATTTTATAGGGAGAGGAGGG - Intronic
1167937868 19:52922495-52922517 CTGGATGTACAGAGAGATGAAGG - Intergenic
1167999453 19:53432848-53432870 CTGGATGTACAGAGAGATGAAGG + Intronic
1168331481 19:55572416-55572438 CAGAATTGACAAAGAGAAGACGG - Intergenic
1168616859 19:57844930-57844952 CTGCATTTATAGTCAGCAGAGGG + Exonic
924997034 2:371240-371262 CTGTATTTATTGAGACGAGAGGG + Intergenic
925092991 2:1169948-1169970 CTGAATTTATAGAGAGATTATGG - Intronic
925096290 2:1206723-1206745 CTGATTTTATAAAGAAAAAATGG + Intronic
925710660 2:6736525-6736547 TTTAATTTATAGAGAGTAGATGG - Intergenic
926368520 2:12156202-12156224 CTGAATTTTTAGAGTAAAGATGG + Intergenic
926832902 2:16983626-16983648 CTGAAATCATAGAAATAAGAAGG - Intergenic
927019274 2:19000287-19000309 TTGAATGTATTGAGAGAAGTTGG - Intergenic
927972311 2:27313378-27313400 CAGAAAGTATAGAGAGAGGAAGG + Intronic
928468166 2:31543113-31543135 CAGAAATTTTAGAGATAAGAAGG + Intronic
929064161 2:37956363-37956385 CTGATTTTATAGAAATAAAAAGG - Intronic
929211910 2:39366539-39366561 CTGAATTCAGAAAGGGAAGAGGG + Intronic
929667958 2:43848268-43848290 CAGTATTTATAGACAGAAAAAGG + Intronic
929737071 2:44561579-44561601 CTGAATTGATTGAGAGTAAATGG - Intronic
930003270 2:46876002-46876024 CTGGCTTTATAGACAGAAAAGGG + Intergenic
930804461 2:55476460-55476482 CAGGATTTACATAGAGAAGAGGG + Intergenic
933127426 2:78626690-78626712 CTGGATTAATTGAAAGAAGATGG + Intergenic
933765128 2:85702485-85702507 CTGACCTTACAGAGAGAAAAAGG - Intergenic
934488006 2:94735928-94735950 CTGAATCCATGGAGAGAAAAAGG - Intergenic
935013977 2:99162213-99162235 CTGAATCTAATGAGAGAAGAAGG + Exonic
935100920 2:99995253-99995275 CTGAAATTATAGAAAAAGGATGG + Intronic
935556234 2:104512471-104512493 CTAAATTTTTAGAAAGAACATGG - Intergenic
935809474 2:106783087-106783109 CTTAATTTAAAGAGAAAATAAGG - Intergenic
936641851 2:114321770-114321792 CTGAATAAATAGCCAGAAGATGG + Intergenic
937048257 2:118864555-118864577 CTGAATTTATGGAGGGATGTAGG - Intergenic
938836926 2:135113633-135113655 CAGCATTTATAGACAGAAAATGG - Intronic
939329658 2:140740768-140740790 ATGAAGATATAGGGAGAAGATGG - Intronic
939930820 2:148230944-148230966 CTCCATTTAAGGAGAGAAGAAGG - Intronic
940125571 2:150319795-150319817 CTGAAAGTCCAGAGAGAAGAAGG - Intergenic
940242393 2:151577425-151577447 CTGATTTTACAGAGATATGAAGG - Intronic
940277998 2:151959506-151959528 CTGCATTTACATAGAGAAGCTGG - Intronic
940697881 2:157002684-157002706 GTGAATGTAGATAGAGAAGAGGG + Intergenic
941273244 2:163457150-163457172 CTGAGGGTAAAGAGAGAAGAGGG - Intergenic
941431393 2:165418288-165418310 TTGAATATATAGAAAGATGAGGG + Intergenic
941624722 2:167818745-167818767 CTGAACTTGTAGTAAGAAGAAGG + Intergenic
942766946 2:179468650-179468672 CTGAATCTAGAGAGGAAAGAGGG - Intronic
943086223 2:183314976-183314998 GTAAATATATAAAGAGAAGAGGG - Intergenic
943153409 2:184143201-184143223 ATGAGTTGATAAAGAGAAGAGGG + Intergenic
943272227 2:185821125-185821147 CTGAGTTTATAGAAATAAAAAGG + Intronic
945043633 2:205763338-205763360 CAGAATCTAGAGGGAGAAGAAGG + Intronic
945245670 2:207714462-207714484 ATGAATGTATAGACATAAGATGG - Intronic
945522152 2:210842346-210842368 CTGAATATATAAAGAAAAGTGGG + Intergenic
945935182 2:215896754-215896776 GTGAAGTTAGAGTGAGAAGATGG - Intergenic
946028523 2:216687327-216687349 CTGAAGATATATAGAGAAAAGGG + Intronic
946485978 2:220101156-220101178 CTGAGTTTGTAGACAGAAAAAGG + Intergenic
946502188 2:220261380-220261402 CTGAATTTTTTCAGAGAAGCTGG + Intergenic
946543176 2:220707999-220708021 CTGACTCCATAGAGAGATGAAGG - Intergenic
947186239 2:227458125-227458147 CTGAATGTAGACAGATAAGAAGG - Intergenic
1169006145 20:2208607-2208629 CTGGCTTTATAGACAGAAAAGGG - Intergenic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169810884 20:9608046-9608068 GTGAGGTTATAGTGAGAAGATGG - Intronic
1170020504 20:11832132-11832154 CTGTATTTCTATAGAGAAGATGG - Intergenic
1170252919 20:14305461-14305483 CAGTATATATAGAGAGAAGAGGG + Intronic
1171098939 20:22364001-22364023 ATGAATTTATAAAGAAAATATGG + Intergenic
1171295466 20:24012947-24012969 GTGTCTTTACAGAGAGAAGAGGG - Intergenic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1175346675 20:58284042-58284064 TTGAATTGGTAGGGAGAAGATGG - Intergenic
1175701199 20:61138422-61138444 CTGAAGTTAGAGAGAGAGGGTGG - Intergenic
1176839273 21:13825721-13825743 CTGAATCCATGGAGAGAAAAAGG - Intergenic
1176968925 21:15243619-15243641 CTGAATTTGAAGTGGGAAGAAGG + Intergenic
1177125198 21:17185250-17185272 CTGGGTTTATAGAGGGAGGAAGG - Intergenic
1177613914 21:23491418-23491440 CTGATTTTATATAGACAATATGG - Intergenic
1177709594 21:24755397-24755419 CAGAATTTATAGCCAGTAGAAGG - Intergenic
1178002703 21:28181752-28181774 CGTAATTTATAAAGAAAAGAGGG - Intergenic
1178497291 21:33098120-33098142 ATGACTTTAAAGGGAGAAGAGGG + Intergenic
1179450805 21:41467072-41467094 TTTGATTTATAGAGAGCAGAGGG - Intronic
1179721802 21:43320549-43320571 CTGAAGATACAGGGAGAAGACGG + Intergenic
949628129 3:5891141-5891163 CTGAAATTACAAAGAGAACAAGG - Intergenic
949695564 3:6690176-6690198 CTGAAATCATGGAGAGAAGAAGG + Intergenic
950167736 3:10814544-10814566 CTGAATTTAAGGAGAGAGAAAGG + Intergenic
951586649 3:24221675-24221697 AAGACTTTATAGAGAGTAGAAGG - Intronic
951674748 3:25225131-25225153 TTGAATTAATGGAGAGATGAAGG - Intronic
952769700 3:36987142-36987164 CTGAATATATAGTGACCAGAAGG + Intergenic
953199223 3:40763319-40763341 TTGAACTTATGGAGAGTAGAAGG + Intergenic
955164969 3:56501977-56501999 GTGAAGACATAGAGAGAAGATGG - Intergenic
955196310 3:56807623-56807645 CTGAAATTAGAGAGAGGAGAGGG - Intronic
955579171 3:60400449-60400471 CTGGAGGTATAGAGATAAGAGGG - Intronic
955997961 3:64697039-64697061 CTGATTTTATTTAGAGGAGAAGG + Intergenic
956368463 3:68532199-68532221 CTGAGGTTATAGAAAGAATAGGG + Intronic
956931949 3:74053463-74053485 CTGGAGTCATAGAGAGAAAATGG + Intergenic
957743744 3:84309953-84309975 CTGATTTTCTATAGAAAAGAGGG - Intergenic
957983952 3:87548325-87548347 CTGACTTTAGAGAGAGCAGGTGG + Intergenic
958018084 3:87966153-87966175 CTGAGGTTAGAGTGAGAAGACGG - Intergenic
959208187 3:103340588-103340610 CTGAAAATATAAAGAGAAGGTGG + Intergenic
959243968 3:103839064-103839086 AAGAAATTATAGAAAGAAGACGG + Intergenic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
959643682 3:108672055-108672077 GTGAAGTTATAGTGGGAAGACGG - Intronic
959708008 3:109357310-109357332 CTGAGGTTACAGAAAGAAGAGGG - Intergenic
960447057 3:117762086-117762108 ATGAATTTTTAGACAGCAGAGGG + Intergenic
960556827 3:119039361-119039383 CTGGATTTGAAGATAGAAGAAGG - Intronic
961752153 3:129103064-129103086 CCGACATTATAGAGAAAAGAGGG + Intronic
962092239 3:132256591-132256613 GTGAATTGAAAAAGAGAAGACGG + Intronic
962246330 3:133797328-133797350 CTGGATTGATAGAGATAGGAAGG + Intronic
962349221 3:134644552-134644574 AGGAAGCTATAGAGAGAAGATGG - Intronic
963323818 3:143838965-143838987 ATGAATTTAGAGAGATAATATGG + Intronic
963608420 3:147434635-147434657 GTGAATTTATGGAGAGATAAAGG - Intronic
963729128 3:148954424-148954446 CTGAATTTATAGCCAAGAGATGG + Intergenic
963884457 3:150565466-150565488 CTGCATTTATATAGAAAAGGCGG + Intronic
963912606 3:150827448-150827470 ATGGTTTTATAGAGTGAAGATGG - Intergenic
964630049 3:158800797-158800819 CAAAATTTAGAGAGAGAAGGAGG - Intronic
964696425 3:159512880-159512902 TTGAACTCATAGAGAGTAGAAGG - Intronic
964724247 3:159797861-159797883 TTGACTTTATAGAGAGGAAAGGG + Intronic
964993954 3:162851009-162851031 ATGAGTTCATAGAAAGAAGAGGG - Intergenic
965687004 3:171314793-171314815 CTGAATCTAGAGTGAGGAGAAGG + Intronic
965703928 3:171486886-171486908 CTGATTGGATATAGAGAAGAAGG + Intergenic
965777813 3:172251379-172251401 CTGCTTTTGTAGATAGAAGAAGG - Exonic
967331009 3:188289742-188289764 CTGGATGTTTAGAGAGAAAATGG + Intronic
969040696 4:4293522-4293544 CTGACCATATACAGAGAAGATGG - Intronic
969383461 4:6825247-6825269 CTGAGTTTATAGTGAGAAATTGG + Intronic
970755748 4:19424144-19424166 TTGAAGTTATAAACAGAAGAGGG - Intergenic
971338226 4:25743932-25743954 TAGAATTTAAAGAGAGAAGAGGG + Intergenic
971434848 4:26609640-26609662 ATGAATTTGTAGAGATAAGTTGG + Intronic
972173612 4:36377038-36377060 CTGATTCTATAGCTAGAAGAGGG - Intergenic
973845715 4:54910993-54911015 ATGAATTTAGAAGGAGAAGAGGG - Intergenic
974442530 4:61938785-61938807 CAGAATTTATAGACACAAAATGG - Intronic
974680304 4:65152164-65152186 TTTAATTTATAGAGAGACAAGGG + Intergenic
974719514 4:65719453-65719475 GTGACATTATAGTGAGAAGATGG - Intergenic
974922904 4:68264326-68264348 CTGAATTTATAGAAATAATCAGG + Intergenic
975888831 4:78999839-78999861 CTGAAGTTATAAAGAGTAGTTGG - Intergenic
976581018 4:86737575-86737597 CTGACTATAAAGAGACAAGAGGG - Intronic
977313426 4:95414484-95414506 CTGAATTTATTGGCAGATGATGG + Intronic
977404049 4:96573876-96573898 CTGATTTTTTAAAGACAAGAGGG - Intergenic
978194350 4:105953578-105953600 CTGCATCTGTAGAGAGAATAGGG + Intronic
978963947 4:114719114-114719136 GTGAAGTTATAGTGAGAAGATGG - Intergenic
978969757 4:114788793-114788815 CTAAATTTAGAGTGTGAAGATGG + Intergenic
980634927 4:135489719-135489741 CTGTATTTACAGAAAGCAGACGG - Intergenic
981202440 4:141996613-141996635 CAGCATTTAAAGAGAAAAGATGG + Intergenic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
981724576 4:147834123-147834145 GTGACTTTATAGAAAGAAAAAGG - Intronic
982550836 4:156797403-156797425 CAGAATTTAAAGACAGAAAAAGG + Intronic
983558910 4:169082238-169082260 CTGGAGTTAGAGAGAGAAGCAGG - Intergenic
984213246 4:176876665-176876687 TTGAAATTATATATAGAAGAAGG + Intergenic
984222843 4:176999422-176999444 TTGAATATATACACAGAAGAGGG - Intergenic
984349193 4:178569513-178569535 GAGAATTTAGAGTGAGAAGAGGG - Intergenic
984363547 4:178769548-178769570 CTGAATTTATGGAGACCAGAAGG - Intergenic
984731932 4:183076385-183076407 ATGAAAATATAGGGAGAAGATGG - Intergenic
984752108 4:183288100-183288122 ATGCATTTGTAGAGAGGAGAGGG + Intronic
986482000 5:8198854-8198876 CTGTATTTCTACAGAGAAGATGG + Intergenic
987564669 5:19568667-19568689 GTGAAAATATAGGGAGAAGAGGG + Intronic
987772447 5:22323781-22323803 TTTAAGTTATAGAAAGAAGAGGG + Intronic
987960492 5:24802441-24802463 CTGACTTTAAAGATGGAAGAAGG - Intergenic
988821233 5:34888140-34888162 GTGAGTTTACAGAAAGAAGATGG + Intronic
988830654 5:34984024-34984046 CTTCATTTCTAGAGAGAGGAGGG - Intergenic
990160124 5:52928759-52928781 TTGACTTTATAGAGAGAAAAGGG + Intronic
992014239 5:72559515-72559537 TTGAATTTATATAGAAAAGGGGG + Intergenic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
992516219 5:77495450-77495472 CTGACTTTGCAGAGAGAAAAGGG + Intronic
993955257 5:94224897-94224919 CTTAATTTAGAGACAGATGAAGG - Intronic
994466756 5:100144354-100144376 AGCAATATATAGAGAGAAGATGG - Intergenic
994568180 5:101481423-101481445 CTATGTTTATAGAGAGAAAATGG + Intergenic
994688500 5:102987163-102987185 ATGAATGGATAGAGAGAAGGTGG + Intronic
994780839 5:104088062-104088084 CTGAATTTAAAGATGGAAGAAGG - Intergenic
994949204 5:106435313-106435335 CTGTCTTTACAGAAAGAAGAAGG - Intergenic
996578495 5:125002992-125003014 CAGAATGTCAAGAGAGAAGAGGG + Intergenic
997602326 5:135149237-135149259 CTCTATTAAGAGAGAGAAGAAGG + Intronic
998512866 5:142728281-142728303 CTGAGTTTATATGGAGAAGCGGG - Intergenic
999340555 5:150766980-150767002 CTGAAGATATAGAAAGAAGAAGG + Intergenic
999456652 5:151722186-151722208 TTGAATTGATAGAGAGAAGGAGG + Intergenic
999862727 5:155665908-155665930 CTCCATCTATAAAGAGAAGATGG + Intergenic
1000418605 5:161011438-161011460 CTGATTTCAGAGAGAAAAGATGG + Intergenic
1000681940 5:164196045-164196067 CTGAAGAGGTAGAGAGAAGATGG - Intergenic
1000752492 5:165114086-165114108 CTTACTTTATAGTGAGAATATGG + Intergenic
1002665702 5:180822745-180822767 CTGAATATATAGAGAATAAATGG - Intergenic
1002743675 5:181453785-181453807 TTGATTTCAGAGAGAGAAGAGGG + Intergenic
1003770264 6:9291353-9291375 CTGAATTTATTGAGGGAAGGGGG - Intergenic
1003872675 6:10414483-10414505 ATGAATGAATAGAAAGAAGAAGG + Intronic
1004233028 6:13850032-13850054 CTGAATATATAAACAGATGATGG - Intergenic
1004382401 6:15143820-15143842 TAGAATTCATGGAGAGAAGATGG - Intergenic
1005219127 6:23566012-23566034 CTGTATTTACTGAGAGAATAGGG - Intergenic
1005311327 6:24562135-24562157 CTGACTTTATAGAAATAAAAAGG - Intronic
1006051673 6:31350145-31350167 CTGAATTCCAAGAGGGAAGAGGG + Intronic
1006252466 6:32799415-32799437 CAATATTTATAGAGAGAAAAAGG + Intergenic
1006891093 6:37429526-37429548 CAGTATTTATAGATAGAAAAAGG + Intergenic
1007562484 6:42821506-42821528 CTGCATTTAGAGAGAGAAGAGGG - Intronic
1008124896 6:47656824-47656846 GTGAATTTATACAGTGAATAAGG + Intronic
1008148465 6:47920908-47920930 CTGAGATTATAGAAAGAGGAAGG + Intronic
1008485587 6:52031414-52031436 CAGCATTTATAGACAGAAAATGG - Intronic
1009050385 6:58268091-58268113 TTGAAATTATAGAAAGAACAGGG + Intergenic
1009240025 6:61174297-61174319 TTGAAATTATAGAAAGAACAGGG - Intergenic
1010025360 6:71209389-71209411 CTGAATCTAGAGAGACAGGAGGG + Intergenic
1010568042 6:77441835-77441857 CTAAATTAATAAAGAGAAAATGG - Intergenic
1011143499 6:84187908-84187930 CAGAATTTAAAGAGAATAGAAGG + Intronic
1011454908 6:87538259-87538281 CTGCATTTAAAGACAAAAGAAGG - Intronic
1012150533 6:95745102-95745124 ATGATTTTAGGGAGAGAAGAAGG - Intergenic
1013452087 6:110292856-110292878 CTCAAATCATAGAGAAAAGATGG - Intronic
1014943368 6:127469619-127469641 TTGAAGTTATAGGGAAAAGATGG + Intronic
1015388310 6:132651450-132651472 CTAGATATATAGAGAGCAGAAGG - Intergenic
1015935947 6:138405729-138405751 CTTAATTTTTAGAGATAAAAGGG - Intronic
1016250360 6:142034003-142034025 CTGACTTTATAATGAGAAGAAGG + Intergenic
1017828869 6:158106430-158106452 CTGCATCTATACAGAGAATAGGG - Intergenic
1018430082 6:163715247-163715269 CTGCATTTATCGAGTGCAGAAGG + Intergenic
1019083372 6:169452010-169452032 CTCCATTTATGGAGACAAGATGG + Intergenic
1019248533 6:170727014-170727036 TTGATTTCAGAGAGAGAAGAGGG + Intergenic
1020390249 7:7649889-7649911 ATGAAATTATAGTGAAAAGATGG + Intronic
1020961695 7:14812710-14812732 AAGAATTAATAGAGTGAAGAGGG - Intronic
1020967302 7:14887454-14887476 CTGAGTGTACACAGAGAAGAAGG - Intronic
1020993746 7:15235066-15235088 CAGAATCTATAGAAAGAAGAGGG - Intronic
1021325120 7:19257033-19257055 CTGAATTTTATGGGAGAAGAGGG + Intergenic
1024094841 7:45975332-45975354 CGTAATTTATAAAGAAAAGAGGG + Intergenic
1024140450 7:46457916-46457938 CTGAGGTTACAGAAAGAAGAGGG + Intergenic
1025015565 7:55436327-55436349 CTGATTTTATAGAGAAGAAATGG - Intronic
1026418105 7:70203867-70203889 ATGTATTTGTAGAGAGAAGAAGG + Intronic
1027423042 7:78035514-78035536 CTGATTATATAGAGAGATTAAGG - Intronic
1028381209 7:90202030-90202052 CTCATTTTAAAGAAAGAAGAAGG + Intronic
1028997383 7:97116462-97116484 CAGTATTTATAGACAGAAAAAGG + Intergenic
1030414372 7:109222564-109222586 CTGTATTTATAGATAGTAAAAGG + Intergenic
1030724697 7:112913136-112913158 TTGCATTTCTAGAGAGAAGATGG - Intronic
1030994679 7:116345008-116345030 CTGACTTTATAGAAATAAAAAGG - Intronic
1031270364 7:119641723-119641745 CTGAATTTAAAGAGAGAAGAAGG - Intergenic
1033911718 7:146271961-146271983 ATGAATTTATTGGTAGAAGATGG - Intronic
1034506360 7:151495092-151495114 ATGAAGTTATTGAGAGAAAAAGG - Intronic
1035248186 7:157578908-157578930 ATGAAATTATAGAGTGAAGAGGG + Intronic
1035499513 8:80321-80343 TTGATTTCAGAGAGAGAAGAGGG - Intergenic
1036271211 8:7304694-7304716 CTGAATTTAAAGAAAGAAAAAGG - Intergenic
1036350138 8:8005649-8005671 CTGAATTTAAAGAAAGAAAAAGG + Intergenic
1037251097 8:16895152-16895174 CTGAATTTAGGTAGAGGAGATGG + Intergenic
1037541615 8:19877454-19877476 CTGATTTTATAGACAGAAACTGG + Intergenic
1038095438 8:24304429-24304451 CTAAATTTATACAGAGAGAATGG - Intronic
1039858518 8:41436815-41436837 CTGGGTATAAAGAGAGAAGAAGG + Intergenic
1040839015 8:51764115-51764137 CTGAAATTATAGAAATAAAAGGG - Intronic
1041036796 8:53799818-53799840 CTGAGTTTACAGTGAAAAGATGG + Intronic
1042193192 8:66208739-66208761 CTGGATTCATGGAGAGAGGAGGG + Intergenic
1042253418 8:66778761-66778783 CTGGATTTATAGAGGGGAGTGGG + Intronic
1042690264 8:71490548-71490570 CAATATTTATAGAGAAAAGATGG + Intronic
1044290055 8:90457757-90457779 GTGAGTTTACAGTGAGAAGATGG + Intergenic
1044989598 8:97783786-97783808 CTGAAGTTACAGAAAGAATAGGG - Intronic
1046097482 8:109578592-109578614 GTGTATTTATGGAGAGAATAGGG + Intronic
1046388697 8:113539261-113539283 CTGAACTTATATTGATAAGATGG - Intergenic
1047183705 8:122613464-122613486 CAGAGTTTCCAGAGAGAAGATGG - Intergenic
1047195457 8:122717114-122717136 CTGGATTTTTAGAGAGAAGTCGG - Intergenic
1047379060 8:124339392-124339414 CAGTATTTATAGATAGAAAAAGG - Intronic
1048768771 8:137872323-137872345 CAGAATTTAGAGAAAGAATAAGG - Intergenic
1050924241 9:11242592-11242614 CTGAATTTATAGATAGAGTTAGG + Intergenic
1051441849 9:17093060-17093082 CTAAATTAAGAGTGAGAAGAAGG - Intergenic
1051533782 9:18133969-18133991 TGGAATGTATTGAGAGAAGATGG + Intergenic
1051681463 9:19611738-19611760 CTCAATTTATAGGGAAGAGATGG - Intronic
1052551882 9:29962054-29962076 CTGAATTAATAAAAAGAAAATGG + Intergenic
1052921339 9:33972510-33972532 CTGAAGTTAGAGAGAGACAAAGG + Intronic
1053669791 9:40348491-40348513 CTGAATCCATGGAGAGAAAAAGG + Intergenic
1053919588 9:42974746-42974768 CTGAATCCATGGAGAGAAAAAGG + Intergenic
1054514821 9:66027805-66027827 CTGAATCCATGGAGAGAAAAAGG - Intergenic
1054923052 9:70560947-70560969 CTGACTTTTTAGGGACAAGATGG - Intronic
1055251385 9:74311131-74311153 CTGACTTTATAGAAATAAAATGG + Intergenic
1055834376 9:80420858-80420880 CTGTATTTATAGAGACTATAGGG - Intergenic
1056276444 9:84998442-84998464 CTGGATTTATAGAGAAGAGCTGG - Intronic
1059945548 9:119405153-119405175 CTAAATTTTTGAAGAGAAGAAGG - Intergenic
1060816948 9:126640073-126640095 CCCAATGTATAGAAAGAAGAAGG + Intronic
1203609493 Un_KI270748v1:84278-84300 TTGATTTCAGAGAGAGAAGAGGG + Intergenic
1186084115 X:5967901-5967923 CTCAAATGATAAAGAGAAGAAGG - Intronic
1187120367 X:16399711-16399733 TTGAACTCATAGAGAGTAGAAGG - Intergenic
1187775862 X:22756334-22756356 ATGTATATATAGAGAGAAAAGGG - Intergenic
1188563792 X:31501202-31501224 CAGTATTTATAGATAGAAAAAGG - Intronic
1188836951 X:34969760-34969782 CTGATTTTAAAAAGAGAAGAGGG + Intergenic
1190068301 X:47258419-47258441 CAGAAATTAAAAAGAGAAGAAGG + Intergenic
1190391430 X:49935596-49935618 CTGAATTTATAGAGAGAAGAAGG + Intronic
1190795381 X:53736330-53736352 ATACATTTAGAGAGAGAAGAGGG - Intergenic
1190938692 X:55019644-55019666 CGGAATTGATATAGTGAAGATGG + Intronic
1191963966 X:66735813-66735835 CTGAAAGTGTAGTGAGAAGAGGG - Intergenic
1192230381 X:69260575-69260597 CTGAGGTTACAGTGAGAAGATGG - Intergenic
1192725099 X:73741673-73741695 CTGAAGTCATAGTGGGAAGAAGG - Intergenic
1193026395 X:76850321-76850343 GGGAATTTATAAAGAAAAGAAGG + Intergenic
1193426646 X:81347977-81347999 CTGAATATAGAGACAGACGATGG + Intergenic
1193480683 X:82024228-82024250 ATAAAATTATAGTGAGAAGATGG - Intergenic
1194857178 X:98946096-98946118 CAGAAATTATGAAGAGAAGATGG + Intergenic
1195441229 X:104900865-104900887 ATGAATTTAGGGAGAGACGAAGG + Intronic
1195935442 X:110121144-110121166 CTGAAGTCAAAGAGAGAACAAGG - Intronic
1196188670 X:112772249-112772271 CTGAATCTATAAAGATGAGATGG - Intergenic
1196364490 X:114908752-114908774 CTGAATTCTTAGAGAGCAGCAGG - Exonic
1196667744 X:118333889-118333911 CTGACTTTAACCAGAGAAGAAGG - Intergenic
1196892311 X:120303020-120303042 CTCAATTGTTAGAGAGCAGAAGG - Intronic
1198825468 X:140693974-140693996 CTGGATTCAAAGAGAAAAGAAGG - Intergenic
1198848455 X:140939191-140939213 CTGAATTTTTTGAAAGAAAATGG + Intergenic
1199028374 X:142967106-142967128 GTGAATATACAGGGAGAAGATGG - Intergenic
1199323894 X:146474806-146474828 GTGAAGTTACAGGGAGAAGATGG + Intergenic
1199367871 X:147008220-147008242 CTGAACTCATAGAGAGTAGAAGG - Intergenic
1199527219 X:148806034-148806056 GTGGATTTAAAGAGAGGAGAAGG + Intronic