ID: 1190391430

View in Genome Browser
Species Human (GRCh38)
Location X:49935596-49935618
Sequence CTGAATTTATAGAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190391429_1190391430 0 Left 1190391429 X:49935573-49935595 CCTATGAAAAAGAATAGTAGAGA No data
Right 1190391430 X:49935596-49935618 CTGAATTTATAGAGAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190391430 Original CRISPR CTGAATTTATAGAGAGAAGA AGG Intronic
No off target data available for this crispr